PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of aemPermissionsJournals.ASM.orgJournalAEM ArticleJournal InfoAuthorsReviewers
 
Appl Environ Microbiol. 2010 January; 76(2): 500–507.
Published online 2009 November 20. doi:  10.1128/AEM.01524-09
PMCID: PMC2805207

Association of Beta-Glucan Endogenous Production with Increased Stress Tolerance of Intestinal Lactobacilli[down-pointing small open triangle]

Abstract

The exopolysaccharide beta-glucan has been reported to be associated with many health-promoting and prebiotic properties. The membrane-associated glycosyltransferase enzyme (encoded by the gtf gene), responsible for microbial beta-glucan production, catalyzes the conversion of sugar nucleotides into beta-glucan. In this study, the gtf gene from Pediococcus parvulus 2.6 was heterologously expressed in Lactobacillus paracasei NFBC 338. When grown in the presence of glucose (7%, wt/vol), the recombinant strain (pNZ44-GTF+) displayed a “ropy” phenotype, while scanning electron microscopy (SEM) revealed strands of polysaccharide-linking neighboring cells. Beta-glucan biosynthesis was confirmed by agglutination tests carried out with Streptococcus pneumoniae type 37-specific antibodies, which specifically detect glucan-producing cells. Further analysis showed a ~2-fold increase in viscosity in broth media for the beta-glucan-producing strain over 24 h compared to the control strain, which did not show any significant increase in viscosity. In addition, we analyzed the ability of beta-glucan-producing Lactobacillus paracasei NFBC 338 to survive both technological and gastrointestinal stresses. Heat stress assays revealed that production of the polysaccharide was associated with significantly increased protection during heat stress (60-fold), acid stress (20-fold), and simulated gastric juice stress (15-fold). Bile stress assays revealed a more modest but significant 5.5-fold increase in survival for the beta-glucan-producing strain compared to that of the control strain. These results suggest that production of a beta-glucan exopolysaccharide by strains destined for use as probiotics may afford them greater performance/protection during cultivation, processing, and ingestion. As such, expression of the gtf gene may prove to be a straightforward approach to improve strains that might otherwise prove sensitive in such applications.

Probiotics are normally consumed in fermented dairy products such as cheese and yoghurt and, in addition to conferring a health benefit to the host upon consumption (19), can also be actively involved in the fermentation process, where they can contribute to the flavor/organoleptic properties of the product (45). A number of health claims have been associated with probiotics, such as reduced lactose intolerance, reduction in duration of infectious diarrhea, improved immune function, management of inflammatory bowel diseases, reduction in allergic responses, and lowering serum cholesterol (5, 6, 16, 35, 38, 43, 53, 72). Given the increased clinical evidence supporting their role in health promotion, it is not surprising that there is an increasing demand for such functional foods within Europe (59). A prerequisite of a probiotic is that it needs to reach the target location within the host, i.e., the gastrointestinal tract (GIT), in sufficiently high numbers in order to exert a beneficial effect (27, 28), and so, standards insist that probiotic products contain at least 106 viable microorganisms per gram or per milliliter. Therefore, it is imperative that the probiotic survive cultivation, concentration, processing, and storage. In addition, the food product generally needs to be consumed regularly to deliver the relevant “dose” of live bacteria to the GIT, given that there is negligible evidence for long-term persistence of ingested strains. Hence, technological processing and storage of the functional foods followed by intestinal survival can all represent rate-limiting steps in the development of efficacious probiotic products. From both a technological and biological perspective, it is often preferable that a probiotic be tolerant to oxygen, acid, bile, and heat, as well as be able to grow in milk and metabolize prebiotics (8, 49, 66).

To date, numerous studies report on the technological and gastrointestinal robustness of probiotic strains, and more specifically, Lactobacillus strains (30, 47, 71). In one such study, gum acacia, an exudate gum from trees of various acacia species, consisting of a highly complex polysaccharide, has been shown to offer protection to Lactobacillus paracasei NFBC 338 during heat, bile, and H2O2 stress when added to the growth medium. In addition, gum acacia also acted as a thermoprotectant for live bacteria during the spray-drying process, with increased bacterial survival observed for the gum acacia spray-dried powder in comparison to that of the control when subjected to storage at a low temperature and exposure to porcine gastric juice (15). Similarly, spray drying bifidobacteria in the presence of either 10% gelatin, gum arabic, or soluble starch increased the survival of these cultures (37). A recent study demonstrated the increased expression of a bifidobacterial glycosyltransferase gene in the presence of bile, resulting in the increased production of an exopolysaccharide (EPS) in the bile environment (51).

Many microorganisms, including lactic acid bacteria (LAB; which are generally regarded as safe [GRAS] in food production), have the ability to synthesize EPS with a large variation in composition, charge, and molecular structure. EPS-producing LAB are responsible for a “ropy” phenotype characterized by a viscous and thick texture observed in spoiled alcoholic beverages, such as beer, cider, and wine (20, 39, 68). Despite this, the production of EPS has many beneficial effects both in the food industry and on individuals' health. In the food industry, EPSs produced by LAB and other microorganisms are used as viscosifiers, stabilizers, emulsifiers, or gelling agents to modify the rheological properties and texture of products. Xanthan, gellan, and dextran are examples of commercially available EPS and are widely accepted products of biotechnology (61, 67). In addition to their use in food production, EPSs have been reported to possess a number of health benefits, such as immunostimulatory and antitumoral/anticarcinogenic effects (31, 69), lowering blood cholesterol (41, 46), and prebiotic effects (33, 44). One of the major drawbacks with using microbial polysaccharides in food formulations (whether it is for rheological purposes or as an added health benefit) is the requirement for them to be considered food additives. However, this can be overcome by using LAB starter cultures which produce EPS in situ during milk fermentation, thereby alleviating consumer concerns and producing a product that is low in additives (52).

The EPS beta-glucan has been reported to have many health-promoting properties, which include immunomodulatory effects (1, 25, 64, 70), lowering serum cholesterol levels (63, 76), and antiosteoporotic (55), antitumorigenic, anticytotoxic, and antimutagenic effects (24, 42), as well as displaying prebiotic qualities (57). Curdlan, a bacterial 1,3-beta-d glucan, has been assessed for its safety in vitro and in vivo and is approved for use in numerous countries, including Japan and the United States, as a food additive (58). In addition, oat and barley beta-glucan have received GRAS status granted by the U.S. Food and Drug Administration (21, 22).

In this study, we have heterologously expressed the pediococcal glycosyltransferase gene (gtf) responsible for the synthesis and secretion of the 2 substituted (1, 3) beta-d-glucans in Lb. paracasei NFBC 338. Lb. paracasei NFBC 338 is a probiotic strain which was originally isolated from the human GIT during surgery. In a double-blinded placebo-controlled clinical trial in healthy adults, this has been shown to be associated with a 10-fold increase in the total fecal lactobacilli (C. Stanton, unpublished data). The resultant recombinant “ropy strain” showed significant improvements in its ability to cope with a number of stresses, including acid, heat, and bile. As such, the gtf gene may prove to be a useful tool in the future to improve “more sensitive” strains from the GIT and render them viable as more “resilient probiotics” for food uses.

MATERIALS AND METHODS

Bacterial strains, growth conditions, and media.

The bacterial strains used in this study are Escherichia coli (Top10 cells), the probiotic Lactobacillus paracasei NFBC 338 (obtained from University College Cork, Cork, Ireland, under a restricted material transfer agreement) and Pediococcus parvulus 2.6, formerly called Pediococcus damnosus 2.6 (75), which was isolated from ropy cider (20) and is protected by patent PCT/ES2005/070127 (GTF cells, vectors, sequences, and applications thereof in the food sector). Lactobacillus paracasei NFBC 338 and Pediococcus parvulus 2.6 were routinely cultured in Lactobacillus MRS (de Man, Rogosa, Sharpe) medium (Difco) and incubated anaerobically at 37°C and aerobically at 25°C, respectively. Escherichia coli was cultured in LB (Luria-Bertani) medium and incubated aerobically at 37°C. Concentrated stocks of chloramphenicol (CM; 30 mg/ml) were prepared and added to media at the appropriate levels when required.

Nucleic acid manipulation.

DNA extraction from agarose gels, plasmid isolation, and PCR purification were performed with the Qiagen gel extraction kit (Qiagen), the Qiagen QIAprep spin miniprep kit (Qiagen), and the PCR purification kit (Qiagen), respectively. T4 DNA ligase and restriction enzymes were purchased from Roche Diagnostics. All reagents were used according to the manufacturers' instructions. Chemically competent E. coli was purchased from Invitrogen and transformed according to manufacturer's protocol. Electrotransformation of Lb. paracasei NFBC 338 was achieved using the protocol outlined by Josson et al. (29). PCR was performed using a G-Storm thermal cycler (Gene Technologies). Oligonucleotide primers for PCR were synthesized by Sigma-Genosys Biotechnologies, and either Taq DNA polymerase (Biotaq; Bioline) or Kod DNA polymerase hot start (Novagen) was used for PCRs where appropriate. DNA preparations were isolated as outlined by Hoffman and Winston (26). Colony PCR was performed following lysis of cells with Igepal CA-630 (Sigma). Sequencing reactions were carried out by Eurofins MWG Operon.

Heterologous expression of pediococcal gtf in Lb. paracasei NFBC 338.

The Pediococcus parvulus 2.6 glycosyltransferase gene (gtf), together with its ribosome binding site, was amplified using primers GTF F (NcoI), 5′ ACATCCATGGAATTAAAGGAAT 3′, and GTF R (XbaI), 5′ GCTCTAGATTAATCATTCCAATCAACTG 3′ (75). This 1,726-bp PCR product was subsequently restriction digested (with the above-mentioned enzymes), cloned into a similarly digested pNZ44 plasmid (which contains the p44 constitutive promoter) (12), generating pNZ44-GTF+, and transformed into E. coli Top10 cells. The control plasmid (pNZ44; no insert) was also transformed into E. coli Top10 cells. Following transformation of E. coli, purified pNZ44-GTF+ plasmid was sequenced to ensure that no mutations had occurred, and both plasmids were subsequently electroporated into competent Lb. paracasei NFBC 338. Transformants were selected using MRS agar with 5 μg/ml chloramphenicol. The presence of the plasmid was confirmed using PCR with the following primers designed across the multiple cloning site of pNZ44: pNZ44 F, 5′ AAATTATCTGTACACTTACCTA 3′, and pNZ44 R, 5′ TCAAAGCAACACGTGCTGT 3′. The presence of the pNZ44-GTF+ plasmid was also confirmed phenotypically based on its ropy characteristics. Randomly amplified polymorphic DNA (RAPD) PCR was carried out using two separate random primers (56) to confirm that both constructs were transformed into the same genetic background. In addition, the 16S rRNA genes from both constructs were amplified and sent for sequencing, again confirming that the species was indeed Lb. paracasei.

Phenotypic analysis of beta-glucan-producing Lb. paracasei NFBC 338.

Phenotypic analysis was carried out by plating both control (pNZ44) and beta-glucan-producing (pNZ44-GTF+) strains onto MRS agar supplemented with 5 to 10% glucose and incubated for ~48 to 72 h. Following incubation, the loop touch test was used to analyze “ropiness” (50). In addition, viscosity was analyzed in both strains. For this, overnight cultures were inoculated at 2% into MRS medium containing 7% glucose, and viscosity readings were taken every 6 h for a 24-h period. Viscosity was measured using an AR-G2 rheometer (TA Instruments, Crawley, United Kingdom) fitted with a 60-mm aluminum parallel plate. Following equilibration for 5 min at 20°C, the shear rate was increased from 0.01 to 300 s−1, held for 1 min at 300 s−1, and then decreased from 300 to 0.01 s−1. Samples were held at 20°C throughout the run. Aliquots were taken every 6 h, and viable cell counts were performed by serial dilution in MRD (maximum recovery diluent; Oxoid) and enumerated on MRS agar plates, followed by incubation anaerobically at 37°C for ~48 h.

Scanning electron microscopy (SEM).

For SEM images, both the control (pNZ44) and beta-glucan-producing (pNZ44-GTF+) strains were grown overnight in MRS medium supplemented with 7% glucose and subsequently processed for SEM analysis using a Tescan Mira scanning electron microscope (magnification, ×16,670; high vacuum [HV], 5 kV; working distance [WD], 14.455 mm) (CMA; Trinity College Dublin, Dublin, Ireland).

Immunological analysis.

Agglutination tests were performed using Streptococcus pneumoniae type 37-specific antisera (Statens Serum Institut, Denmark) as previously reported, with slight modifications (73). Briefly, overnight cultures (24 h) were centrifuged (at 13,000 × g for 5 min), the pellet was resuspended in an equal volume of high-performance liquid chromatography (HPLC) water, and subsequently, 5 μl was spotted onto a slide with 5 μl of antiserum and incubated for 30 min at 4°C. When agglutination occurs, cells form agglomerates observed using phase-contrast microscopy.

Stress tolerance assays.

For the heat stress assay, 1 ml of overnight culture (12 h) was centrifuged (at 13,000 × g for 5 min), the supernatant was removed, and the pellet was resuspended in 1 ml of preheated (58°C) MRS medium and incubated at 58°C with agitation. For the acid stress assay, 1 ml of overnight culture (12 h) was centrifuged (at 13,000 × g for 5 min), the supernatant was removed, and the pellet was resuspended in 1 ml MRS which had been adjusted to pH 2 with 1 M HCl. For the simulated gastric juice stress assay, 1 ml of overnight culture (12 h) was centrifuged (at 13,000 × g for 5 min), the supernatant was removed, and the pellet was resuspended in 1 ml of simulated gastric juice which was made in accordance with that outlined by Corcoran et al. (9). For the bile stress assay, overnight cultures (12 h) (3%) were inoculated into 10 ml of MRS containing 0.7% porcine bile (Sigma). For the salt stress assay, 1 ml of overnight culture (12 h) was centrifuged (at 13,000 × g for 5 min), the supernatant was removed, and the pellet was resuspended in 1 ml MRS which had been adjusted to 5 M NaCl. For each stress assay with the exception of the heat stress assay, samples were incubated with agitation at 37°C for the duration of the experiment. For all stress assays, aliquots were taken at selected time points, and viable cell counts were performed by serial dilution in MRD and enumerated on MRS agar plates, followed by incubation anaerobically at 37°C for ~48 h.

Statistical analysis.

Data are presented as means per group ± standard errors of the means. The statistical significance of differences between means was calculated using analysis of variance (ANOVA) (P ≤ 0.05).

RESULTS

Heterologous expression of glycosyltransferase in Lb. paracasei NFBC 338.

We constructed plasmid pNZ44-GTF+, where the gtf gene is under constitutive control of the P44 promoter (12). We carried out the loop touch test (50) in order to confirm functional expression of glycosyltransferase in Lb. paracasei NFBC 338 (Fig. (Fig.1A),1A), which allowed us to detect ropiness, indicating EPS production. In addition, scanning electron microscopy (SEM) was used to further confirm production of this EPS (Fig. (Fig.1B).1B). In the pNZ44-GTF+ strain, EPS production can be clearly observed on the surface of the cells as an intricate network of linking structures, whereas the control (pNZ44) cells have generally a smooth phenotype with very few or no linking structures. Immunoagglutination assays were performed on 24-h cultures, where agglutination was observed for the genetically modified beta-glucan producer in the presence of anti-type 37 antibodies, indicating the presence of beta-glucan at the cell surface (Fig. (Fig.1C).1C). The viscosity of both the pNZ44-GTF+- and control pNZ44-inoculated broth media (which had been supplemented with 7% glucose) was measured using a rheometer (Fig. (Fig.2).2). An increase in viscosity of the broth medium coincided with the growth of the beta-glucan-producing strain (pNZ44-GTF+), indicating growth rate-dependent EPS production with maximum EPS being produced in late log/early stationary phase, as indicated in Fig. Fig.22 [in contrast to that of the control (pNZ44) strain (P ≤ 0.001)]. Over 24 h, a ~2-fold increase in viscosity was observed for the beta-glucan producer, whereas no significant increase was observed over the 24-h period for the control. Taken together, these results indicate that heterologous expression of the pediococcal glycosyltransferase gene in Lb. paracasei NFBC 338 confers the ability to synthesize and secrete the EPS beta-glucan.

FIG. 1.
(A) Loop touch test of pNZ44-GTF+ Lb. paracasei NFBC 338, displaying the “ropy” strand formed by the cellular mass of EPS-producing Lb. paracasei NFBC 338 grown in MRS broth containing 7% glucose. (B) Scanning electron ...
FIG. 2.
Viscosity analysis (bars) and growth curve (circles) of pNZ44 (control) and pNZ44-GTF+ (beta-glucan producer), following growth anaerobically at 37°C in MRS broth supplemented with 7% glucose. Error bars represent standard errors ...

The role of beta-glucan on environmental stress tolerance.

Previous studies in our laboratory have linked the addition of the complex polysaccharide gum acacia with the environmental stress tolerance of Lb. paracasei NFBC 338 (15). Therefore, we decided to analyze the influence (if any) of endogenously synthesized beta-glucan in the technological and gastrointestinal stress tolerance of this strain.

Heat stress assay.

Tolerance to an elevated temperature (58°C) over 60 min was analyzed (Fig. (Fig.3).3). After 10 min in the elevated temperature, a significant (P ≤ 0.05) 2-fold increase in viability was observed for the beta-glucan-producing probiotic (pNZ44-GTF+) compared to that of the control probiotic strain (pNZ44). This trend was maintained throughout the experiment, with significant (P of ≤0.001 to ≤0.05) 12-, 19-, 60-, and 28-fold increases in viability for the beta-glucan producer compared to that for the control at 20, 30, 40, and 50 min, respectively. At 40 min, where a 60-fold difference in survival was observed, the control strain was reduced from 9.5 × 108 to 6.1 × 103 CFU/ml compared to the beta-glucan-producing strain, which was reduced from 1 × 109 to 3.6 × 105 CFU/ml. However, at 60 min, no significant difference was observed between the two strains.

FIG. 3.
Survival of the pNZ44 control and pNZ44-GTF+ beta-glucan-producing Lb. paracasei NFBC 338 in an elevated temperature (58°C). Overnight cultures (12 h) were centrifuged and resuspended in MRS and incubated at 58°C. Viable cell counts ...

Acid stress assays.

Exposure to acidic conditions (pH 2) (Fig. (Fig.4)4) resulted in significant (P of ≤0.001 to ≤0.01) 2-, 20-, 20-, and 13-fold increases in viability of the beta-glucan-producing strain compared to that of the control strain after 5, 10, 15, and 20 min, respectively. At 15 min, where a 20-fold difference in survival was observed, the control and beta-glucan-producing strain cell numbers were reduced from 1.1 × 109 to 2.6 × 105 CFU/ml and 1.2 × 109 to 5.1 × 106 CFU/ml, respectively. Similarly, exposure to simulated gastric juice (pH 2) (Fig. (Fig.5)5) resulted in a significant (P ≤ 0.01) 15-fold increase in viability of the beta-glucan-producing probiotic compared to that of the control strain after 10 min, where viable cell numbers of the control strain were reduced from 1.2 × 109 to 3.8 × 103 CFU/ml compared to those of the beta-glucan-producing strain, which was reduced from 1.4 × 109 to 5.8 × 104 CFU/ml, indicating that production of beta-glucan offers protection to Lb. paracasei NFBC 338 during gastric environments.

FIG. 4.
Survival of the pNZ44 control and pNZ44-GTF+ beta-glucan-producing Lb. paracasei NFBC 338 in acid (HCl, pH 2). Overnight cultures (12 h) were centrifuged, resuspended in HCl at pH 2, and incubated at 37°C. Viable cell counts were performed ...
FIG. 5.
Survival of the pNZ44 control and pNZ44-GTF+ beta-glucan-producing Lb. paracasei NFBC 338 in simulated gastric juice (pH 2). Overnight cultures (12 h) were centrifuged, resuspended in simulated gastric juice, and incubated at 37°C. Viable ...

Bile stress assay.

In the bile stress assay, the beta-glucan-producing strain displayed significantly increased viability (~5.5-fold) compared to that of the control strain at time zero (P ≤ 0.01) (Fig. (Fig.6),6), with viable cell numbers of the control and beta-glucan producer reduced from 4.5 × 108 to 2.1 × 103 CFU/ml and from 4.2 × 108 to 1.1 × 104 CFU/ml, respectively. The beta-glucan-producing strain maintained a significantly (ranging from P values of ≤0.01 to ≤0.05) increased viable cell count (3- to 5.5-fold) above that of the control throughout the 90 min of exposure, with the viability of the control and beta-glucan producer reducing from 4.5 × 108 to 9.3 × 102 CFU/ml and 4.2 × 108 to 4.3 × 103 CFU/ml, respectively, after 15 min, indicating that beta-glucan offers protection to Lb. paracasei NFBC 338 in a bile stress environment.

FIG. 6.
Survival of the pNZ44 control and pNZ44-GTF+ beta-glucan-producing Lb. paracasei NFBC 338 in porcine bile (0.7%). Overnight cultures (12 h, 3%) were inoculated into MRS broth containing 0.7% porcine bile and incubated at ...

Salt stress assay.

No significant reduction in viability was observed for the beta-glucan-producing and control strains after 120 min of exposure to high-salt concentrations (5 M NaCl), with viable cell numbers reducing slightly but not significantly from 1.9 × 109 to 9.7 × 108 CFU/ml and 7.7 × 108 to 5 × 108 CFU/ml, respectively (data not shown).

DISCUSSION

Given that the effectiveness of a probiotic is dependent on sufficiently high numbers reaching the gastrointestinal tract (27, 28), it is imperative that the probiotic be both technologically and biologically robust. Previously, we had shown that the treatment of the Lb. paracasei NFBC 338 strain with exogenously added gum acacia, a complex polysaccharide, had improved its ability to survive heat, bile, H2O2, spray drying, and simulated gastric conditions. This study investigated the role of an endogenously produced exopolysaccharide, beta-glucan by Lb. paracasei NFBC 338, in environmental stress protection. Pediococcus parvulus 2.6 produces a beta-glucan-type EPS from a single plasmid-encoded glycosyltransferase gene (gtf) (18, 74, 75). This gene product (GTF) is membrane bound and responsible for catalyzing the biosynthesis and secretion of beta-glucan (75). Genetically modified beta-glucan-producing Lb. paracasei NFBC 338 was constructed by cloning the pediococcal gtf gene under the control of a constitutive promoter into Lb. paracasei NFBC 338, and survival was compared to that of a control Lb. paracasei NFBC 338 strain to determine the role (if any) of beta-glucan in Lactobacillus stress tolerance.

Production of EPS was initially confirmed by the loop touch test (50), which showed it to produce ropy viscous strands in broth. EPS production on the surface of cells was also studied using scanning electron microscopy, which indicated that neighboring cells were linked by strands of the polysaccharide. Moreover, the agglutination capacity conferred to Lb. paracasei NFBC 338 by GTF overproduction strongly suggests that, like the pneumococcal Tts glycosyltransferase (40), the protein is responsible for the synthesis and secretion of beta-glucan. Further analysis showed a ~2-fold increase in viscosity in broth media for the beta-glucan-producing strain over 24 h compared to the vector control, which did not show any significant increase in viscosity. This increase in viscosity indicates the potential use of beta-glucan-producing probiotics as natural viscosifier/thickening agents to alter the rheological properties of a fermented product. Indeed, we have recently demonstrated superior technological properties of yoghurt manufactured with this strain (N. Kearney, H. M. Stack, J. T. Tobin, M. A. Fenlon, C. Stanton, G. F. Fitzgerald, and R. P. Ross, unpublished data). Recent studies also reported successful expression of the pediococcal gtf gene in Lactococcus lactis (74) and Streptococcus pneumoniae (75), where both resultant strains demonstrated positive agglutination tests with pneumococcal serotype 37 antibodies and the ability to produce the EPS beta-glucan. Interestingly, in this study, a slight increase (1- to 3-fold) in log CFU counts for the beta-glucan-producting strain compared to that for the control strain has been consistently observed under nonstress conditions.

One technological stress that poses a major problem to the viability of probiotics is elevated temperatures. Spray drying is a cost-efficient method of producing large amounts of dairy ingredients that can be stored in a relatively stable form for long periods (32); however, to maintain viable cultures during this process, the microorganisms must have the ability to withstand relatively high temperatures. Previous work carried out by Gardiner et al. (23) demonstrated the various levels of heat tolerance among species, with an increase in heat tolerance observed for Lb. paracasei NFBC 338 both in medium-based experiments and during spray drying compared to Lactobacillus salivarius UCC118. In addition, overexpression of the stress-induced proteins (GroESL) in Lb. paracasei NFBC 338 elicited a modest increase in heat tolerance (7, 13, 14). In this study, in situ production of beta-glucan offered significant protection to Lb. paracasei NFBC 338 under conditions of elevated temperature, where there was a 60-fold increase in viability observed for the genetically modified beta-glucan-producing Lb. paracasei NFBC 338 compared to that observed for the control strain after 40 min. These results demonstrate significantly increased heat tolerance to that observed for Lb. paracasei NFBC 338 when gum acacia was added exogenously prior to heat stress (<10-fold increase in survival) (15). This heat tolerance offered by in situ-produced beta-glucan could prove very useful in the processing of fermented probiotic products.

Using in vivo expression technology, 72 Lactobacillus plantarum genes were shown to be induced within the murine gastrointestinal tract, indicating that there are many genes involved in survival in this adverse environment, which probiotic strains need to surmount in order to exert a beneficial effect (3). Acid is one of the most challenging hostile conditions and can be encountered by the probiotic in low-pH foods, during gastric transit, and following exposure to fatty acids in the small intestine (10). Liong and Shah demonstrated the various levels of acid resistance among a range of Lactobacillus strains (38). In this study, in situ production of beta-glucan provided Lb. paracasei NFBC 338 with significant 15-fold and 20-fold increases in tolerance to both simulated gastric juice and acid (HCl) stress, respectively. In a previous study, where Lb. paracasei NFBC 338 was spray dried in the presence of exogenously added gum acacia and subsequently exposed to porcine gastric juice, a 100-fold increase in survival was reported; however, gum acacia offered a 10-fold increase in survival to this strain during the spray-drying process; the net effect of the porcine gastric juice exposure was ~10-fold (15). Therefore, the endogenously produced exopolysaccharide beta-glucan offers significantly increased protection to this probiotic strain in acidic environments compared to that observed for the exogenously added polysaccharide gum acacia. Hence, a fermented food containing endogenous probiotic beta-glucan production could significantly enhance the viable cell numbers after technological processing and subsequent gastrointestinal challenge. This result correlates well with a recent study where they clearly demonstrate a link between gtf and stress resistance, where wild-type (P. parvulus) or recombinant (Lc. lactis) strains harboring a functional gtf gene result in increased stress tolerance (17). Interestingly, this result is in contrast to that reported by de Palencia et al. (11), who negated a role for beta-glucan in P. parvulus gastrointestinal stress tolerance. This may be due to strain variation or differences in stress assay conditions. The bile stress response has been evaluated in Lb. plantarum and Lactobacillus reuteri and has shown that the growth rate of these strains decreased significantly as the bile concentrations increased. In addition, promoter screening analysis and two-dimensional gel electrophoresis facilitated the identification of putative genes and proteins, respectively, whose expression was significantly altered by bile (4, 36). In this study, a significant difference (3- to 5-fold), although less than that observed with other stresses (15- to 60-fold), was observed between the beta-glucan-producing Lb. paracasei NFBC 338 and the control throughout bile challenge. Interestingly, a significant and rapid bactericidal effect was observed for both the beta-glucan-producing (4.5 log unit) and control (5.3 log unit) strains after 15 s of exposure to bile stress (0.7%). A similar trend was observed for Listeria monocytogenes when exposed to bile salts, where there was a ~5 log unit reduction in viable cell numbers after 15 s of exposure (2). The observation that bile tolerance improves in the presence of beta-glucan correlates well with a recent study, which demonstrated that the increased expression of a bifidobacterial glycosyltransferase gene in the presence of bile resulted in the increased production of an EPS in the bile environment (51). In addition, these results correlate to that observed for Lb. paracasei NFBC 338 when gum acacia was added exogenously prior to bile stress (<10-fold increase in survival) (15).

Environmental osmotic changes can be encountered either in the gastrointestinal tract of the host or as a result of usage in food formulations and processing; therefore, being able to surmount this stress is vital. The osmotic stress response has been evaluated in Lactobacillus rhamnosus, which has been shown to be sucrose tolerant, a consideration when making sugar-based foods (60). Previous studies demonstrate the inherent salt tolerance exhibited by Lb. paracasei NFBC 338 (14), a phenomenon we also observed in this study. As no significant reduction in viability was observed for the beta-glucan-producing and control strains after 120 min of exposure to high-salt concentrations (5 M NaCl), a role for beta-glucan in increasing the salt tolerance of probiotics could not be determined.

Encapsulation of bacteria can improve their survival, resulting in successful delivery to the GIT (48). Given the severe limitations that the food industry encounters with respect to compounds that can be used for encapsulation, it is not surprising that bacterial (exo)polysaccharides have received increased attention in recent years, as the (exo)polysaccharide provides a layer around the bacterial cell (probiotic), thus creating a natural barrier (34). The physical barrier created by the polysaccharide is probably the mechanism by which this genetically modified beta-glucan producer is protected from adverse environmental conditions, shielding the membrane from heat, acid, simulated gastric juice, and bile (52). Endogenous probiotic beta-glucan production can be used as an alternative to encapsulation to increase its survival in adverse environments, resulting in successful delivery to the GIT. In addition to increased survival, endogenously produced beta-glucan improves the organoleptic properties of the fermented food product (such as yoghurt) (Kearney et al., unpublished) and results in the development of a natural product low in additives. Apart from the improved desirable traits, the resultant strain may also display improved efficacy, given that beta-glucan is also known to be associated with a number of health benefits, such as lowering serum cholesterol (5, 63, 76) and displaying prebiotic properties (57). In this respect, in situ production in the product or in the upper intestine may stimulate growth of beneficial bacteria in the lower intestine.

In situ production of beta-glucan by probiotics may promote intimate adherence of the probiotic to the intestinal mucosa (54). This phenomenon is supported by a recent study, where beta-glucan-producing pediococci displayed increased adherence to colon epithelial cells compared to that of an isogenic control in which the plasmid responsible for beta-glucan production had been cured (no beta-glucan production) and an isogenic control in which the cells were washed (partial beta-glucan production) (11). In addition, beta-glucan may confer additional benefits to the host, as it has been shown to modulate the gut mucosal immune response through receptor-mediated interactions with M cells present in the Peyer's patches, resulting in cytokine production and enhanced resistance to infection (62, 65, 70). EPS-producing probiotics have been reported as promising therapeutics for the treatment of inflammatory bowel disease, which is a dysregulated immune response toward intestinal microflora (54). In this respect, beta-glucan may function as a signaling molecule to rebalance the mucosal immune system.

In conclusion, we have demonstrated that in situ-produced beta-glucan significantly increases survival of the probiotic strain Lb. paracasei NFBC 338 under conditions of elevated heat, simulated gastric juice, acid, and bile, which has implications for performance, stability, and persistence of strains that are not technologically or biologically robust. The challenge is to exploit this from a probiotic prospective. It is important to emphasize that these improvements are associated with the introduction of a single gene, namely, gtf. Given the major interest in the genetics of gut bacteria and the development of tools for their improvement, it should be possible to manipulate many intestinal bacteria by chromosomal insertion of gtf. Alternatively, isolation of natural beta-glucan-producing strains may offer many selective advantages over non-beta-glucan-producing probiotics and pave the way for the development of functional foods with natural beta-glucan-producing probiotics. A beta-glucan-producing probiotic has the potential not only to improve the organoleptic properties of a fermented food product but also to increase cell viability during processing, storage, and subsequent GIT challenge. In addition, beta-glucan-producing probiotics may have the prebiotic potential to enhance the growth of other beneficial microbes in the GIT and, most importantly, have many health-associated benefits.

Acknowledgments

This work was funded by FIRM under the National Development Plan, 2000-2006. N. Kearney is in receipt of a Teagasc Walsh Fellowship.

Footnotes

[down-pointing small open triangle]Published ahead of print on 20 November 2009.

REFERENCES

1. Akramiene, D., A. Kondrotas, J. Didziapetriene, and E. Kevelaitis. 2007. Effects of beta-glucans on the immune system. Medicina (Kaunas) 43:597-606. [PubMed]
2. Begley, M., C. G. Gahan, and C. Hill. 2002. Bile stress response in Listeria monocytogenes LO28: adaptation, cross-protection, and identification of genetic loci involved in bile resistance. Appl. Environ. Microbiol. 68:6005-6012. [PMC free article] [PubMed]
3. Bron, P. A., C. Grangette, A. Mercenier, W. M. de Vos, and M. Kleerebezem. 2004. Identification of Lactobacillus plantarum genes that are induced in the gastrointestinal tract of mice. J. Bacteriol. 186:5721-5729. [PMC free article] [PubMed]
4. Bron, P. A., M. Marco, S. M. Hoffer, E. Van Mullekom, W. M. de Vos, and M. Kleerebezem. 2004. Genetic characterization of the bile salt response in Lactobacillus plantarum and analysis of responsive promoters in vitro and in situ in the gastrointestinal tract. J. Bacteriol. 186:7829-7835. [PMC free article] [PubMed]
5. Chen, J., and H. Xu-Feng. 2009. The effects of diets enriched in beta-glucans on blood lipoprotein concentrations. J. Clin. Lipidol. 3:154-158. [PubMed]
6. Chiu, C. H., T. Y. Lu, Y. Y. Tseng, and T. M. Pan. 2006. The effects of Lactobacillus-fermented milk on lipid metabolism in hamsters fed on high-cholesterol diet. Appl. Microbiol. Biotechnol. 71:238-245. [PubMed]
7. Corcoran, B. M., R. P. Ross, G. F. Fitzgerald, P. Dockery, and C. Stanton. 2006. Enhanced survival of GroESL-overproducing Lactobacillus paracasei NFBC 338 under stressful conditions induced by drying. Appl. Environ. Microbiol. 72:5104-5107. [PMC free article] [PubMed]
8. Corcoran, B. M., C. Stanton, G. Fitzgerald, and R. P. Ross. 2008. Life under stress: the probiotic stress response and how it may be manipulated. Curr. Pharm. Des. 14:1382-1399. [PubMed]
9. Corcoran, B. M., C. Stanton, G. F. Fitzgerald, and R. P. Ross. 2007. Growth of probiotic lactobacilli in the presence of oleic acid enhances subsequent survival in gastric juice. Microbiology 153:291-299. [PubMed]
10. Cotter, P. D., and C. Hill. 2003. Surviving the acid test: responses of gram-positive bacteria to low pH. Microbiol. Mol. Biol. Rev. 67:429-453. [PMC free article] [PubMed]
11. de Palencia, P. F., M. L. Werning, E. Sierra-Filardi, M. T. Duenas, A. Irastorza, A. L. Corbi, and P. Lopez. 2009. Probiotic properties of the 2-substituted (1,3)-beta-d-glucan-producing bacterium Pediococcus parvulus 2.6. Appl. Environ. Microbiol. 75:4887-4891. [PMC free article] [PubMed]
12. de Ruyter, P. G., O. P. Kuipers, and W. M. de Vos. 1996. Controlled gene expression systems for Lactococcus lactis with the food-grade inducer nisin. Appl. Environ. Microbiol. 62:3662-3667. [PMC free article] [PubMed]
13. Desmond, C., C. Stanton, G. F. Fitzgerald, K. Collins, and R. P. Ross. 2001. Environmental adaptation of probiotic lactobacilli towards improvement of performance during spray drying. Int. Dairy J. 11:801-808.
14. Desmond, C., G. F. Fitzgerald, C. Stanton, and R. P. Ross. 2004. Improved stress tolerance of GroESL-overproducing Lactococcus lactis and probiotic Lactobacillus paracasei NFBC 338. Appl. Environ. Microbiol. 70:5929-5936. [PMC free article] [PubMed]
15. Desmond, C., R. P. Ross, E. O'Callaghan, G. Fitzgerald, and C. Stanton. 2002. Improved survival of Lactobacillus paracasei NFBC 338 in spray-dried powders containing gum acacia. J. Appl. Microbiol. 93:1003-1011. [PubMed]
16. Di Felice, G., B. Barletta, C. Butteroni, S. Corinti, R. Tinghino, P. Colombo, and M. Boirivant. 2008. Use of probiotic bacteria for prevention and therapy of allergic diseases: studies in mouse model of allergic sensitization. J. Clin. Gastroenterol. 42(Suppl. 3, Pt. 1):S130-S132. [PubMed]
17. Dols-Lafargue, M., H. Y. Lee, C. Le Marrec, A. Heyraud, G. Chambat, and A. Lonvaud-Funel. 2008. Characterization of gtf, a glucosyltransferase gene in the genomes of Pediococcus parvulus and Oenococcus oeni, two bacterial species commonly found in wine. Appl. Environ. Microbiol. 74:4079-4090. [PMC free article] [PubMed]
18. Duenas-Chasco, M. T., M. A. Rodriguez-Carvajal, P. Tejero Mateo, G. Franco-Rodriguez, J. L. Espartero, A. Irastorza-Iribas, and A. M. Gil-Serrano. 1997. Structural analysis of the exopolysaccharide produced by Pediococcus damnosus 2.6. Carbohydr. Res. 303:453-458. [PubMed]
19. FAO/WHO. 2001. FAO/WHO expert consultation evaluation of health and nutritional properties of powder milk with live lactic acid bacteria, Cordoba, Argentina—1 to 4 October 2001.
20. Fernandez, K., M. Duenas, A. Irastoraz, A. Bilbao, and G. del Campo. 1995. Characterization and DNA plasmid analysis of ropy Pediococcus damnosus spp. strains isolated from Basque Country ciders. J. Food Prot. 59:35-40.
21. Food and Drug Administration. 2003. Food labeling: health claims; soluble dietary fiber from certain foods and coronary heart disease. Final rule. Fed. Regist. 68:44207-44209. [PubMed]
22. Food and Drug Administration. 2008. Food labeling: health claims; soluble fiber from certain foods and risk of coronary heart disease. Final rule. Fed. Regist. 73:47828-47829. [PubMed]
23. Gardiner, G. E., E. O'Sullivan, J. Kelly, M. A. Auty, G. F. Fitzgerald, J. K. Collins, R. P. Ross, and C. Stanton. 2000. Comparative survival rates of human-derived probiotic Lactobacillus paracasei and L. salivarius strains during heat treatment and spray drying. Appl. Environ. Microbiol. 66:2605-2612. [PMC free article] [PubMed]
24. Gu, Y., Y. Fujimiya, Y. Itokawa, M. Oshima, J. S. Choi, T. Miura, and T. Ishida. 2008. Tumoricidal effects of beta-glucans: mechanisms include both antioxidant activity plus enhanced systemic and topical immunity. Nutr. Cancer 60:685-691. [PubMed]
25. Hida, T. H., K. Ishibashi, N. N. Miura, Y. Adachi, Y. Shirasu, and N. Ohno. 2009. Cytokine induction by a linear 1,3-glucan, curdlan-oligo, in mouse leukocytes in vitro. Inflamm. Res. 58:9-14. [PubMed]
26. Hoffman, C. S., and F. Winston. 1987. A ten-minute DNA preparation from yeast efficiently releases autonomous plasmids for transformation of Escherichia coli. Gene 57:267-272. [PubMed]
27. International Dairy Federation. 1992. General standard of identity for fermented milks. International Dairy Federation, Brussels, Belgium.
28. Ishibashi, N., and S. Shimamura. 1993. Bifidobacteria: research and development in Japan. Food Technol. 47:126-135.
29. Josson, K., T. Scheirlinck, F. Michiels, C. Platteeuw, P. Stanssens, H. Joos, P. Dhaese, M. Zabeau, and J. Mahillon. 1989. Characterization of a gram-positive broad-host-range plasmid isolated from Lactobacillus hilgardii. Plasmid 21:9-20. [PubMed]
30. Kim, W. S., L. Perl, J. H. Park, J. E. Tandianus, and N. W. Dunn. 2001. Assessment of stress response of the probiotic Lactobacillus acidophilus. Curr. Microbiol. 43:346-350. [PubMed]
31. Kitazawa, H., T. Harata, J. Uemura, T. Saito, T. Kaneko, and T. Itoh. 1998. Phosphate group requirement for mitogenic activation of lymphocytes by an extracellular phosphopolysaccharide from Lactobacillus delbrueckii ssp. bulgaricus. Int. J. Food Microbiol. 40:169-175. [PubMed]
32. Knorr, D. 1998. Technology aspects related to microorganisms in functional foods. Trends Food Sci. Technol. 9:295-306.
33. Korakli, M., M. G. Ganzle, and R. F. Vogel. 2002. Metabolism by bifidobacteria and lactic acid bacteria of polysaccharides from wheat and rye, and exopolysaccharides produced by Lactobacillus sanfranciscensis. J. Appl. Microbiol. 92:958-965. [PubMed]
34. Laws, A., Y. Gu, and V. Marshall. 2001. Biosynthesis, characterisation, and design of bacterial exopolysaccharides from lactic acid bacteria. Biotechnol. Adv. 19:597-625. [PubMed]
35. Lee, H. S., S. Y. Han, E. A. Bae, C. S. Huh, Y. T. Ahn, J. H. Lee, and D. H. Kim. 2008. Lactic acid bacteria inhibit proinflammatory cytokine expression and bacterial glycosaminoglycan degradation activity in dextran sulfate sodium-induced colitic mice. Int. Immunopharmacol. 8:574-580. [PubMed]
36. Lee, K., H. G. Lee, and Y. J. Choi. 2008. Proteomic analysis of the effect of bile salts on the intestinal and probiotic bacterium Lactobacillus reuteri. J. Biotechnol. 137:14-19. [PubMed]
37. Lian, W. C., H. C. Hsiao, and C. C. Chou. 2002. Survival of bifidobacteria after spray-drying. Int. J. Food Microbiol. 74:79-86. [PubMed]
38. Liong, M. T., and N. P. Shah. 2005. Acid and bile tolerance and cholesterol removal ability of lactobacilli strains. J. Dairy Sci. 88:55-66. [PubMed]
39. Llauberes, R. M., B. Richard, A. Lonvaud, D. Dubourdieu, and B. Fournet. 1990. Structure of an exocellular beta-d-glucan from Pediococcus sp., a wine lactic bacteria. Carbohydr. Res. 203:103-107. [PubMed]
40. Llull, D., E. Garcia, and R. Lopez. 2001. Tts, a processive beta-glucosyltransferase of Streptococcus pneumoniae, directs the synthesis of the branched type 37 capsular polysaccharide in Pneumococcus and other gram-positive species. J. Biol. Chem. 276:21053-21061. [PubMed]
41. Maeda, H., X. Zhu, K. Omura, S. Suzuki, and S. Kitamura. 2004. Effects of an exopolysaccharide (kefiran) on lipids, blood pressure, blood glucose, and constipation. Biofactors 22:197-200. [PubMed]
42. Mantovani, M. S., M. F. Bellini, J. P. Angeli, R. J. Oliveira, A. F. Silva, and L. R. Ribeiro. 2008. Beta-glucans in promoting health: prevention against mutation and cancer. Mutat. Res. 658:154-161. [PubMed]
43. Marteau, P. R., M. de Vrese, C. J. Cellier, and J. Schrezenmeir. 2001. Protection from gastrointestinal diseases with the use of probiotics. Am. J. Clin. Nutr. 73:430S-436S. [PubMed]
44. O'Connor, E., E. Barrett, G. Fitzgerald, C. Hill, C. Stanton, and P. R. Ross. 2005. Production of vitamins, exopolysaccharides and bacteriocins by probiotic bacteria, p. 167-184. In A. Tamime (ed.), Probiotic dairy products. Blackwell Publishing, Oxford, United Kingdom.
45. Parvez, S., K. A. Malik, S. Ah Kang, and H. Y. Kim. 2006. Probiotics and their fermented food products are beneficial for health. J. Appl. Microbiol. 100:1171-1185. [PubMed]
46. Pigeon, R. M., E. P. Cuesta, and S. E. Gililliand. 2002. Binding of free bile acids by cells of yogurt starter culture bacteria. J. Dairy Sci. 85:2705-2710. [PubMed]
47. Prasad, J., P. McJarrow, and P. Gopal. 2003. Heat and osmotic stress responses of probiotic Lactobacillus rhamnosus HN001 (DR20) in relation to viability after drying. Appl. Environ. Microbiol. 69:917-925. [PMC free article] [PubMed]
48. Ross, G. R., C. Gusils, and S. N. Gonzalez. 2008. Microencapsulation of probiotic strains for swine feeding. Biol. Pharm. Bull. 31:2121-2125. [PubMed]
49. Ross, R. P., C. Desmond, G. F. Fitzgerald, and C. Stanton. 2005. Overcoming the technological hurdles in the development of probiotic foods. J. Appl. Microbiol. 98:1410-1417. [PubMed]
50. Ruas-Madiedo, P., and C. G. de los Reyes-Gavilan. 2005. Invited review: methods for the screening, isolation, and characterization of exopolysaccharides produced by lactic acid bacteria. J. Dairy Sci. 88:843-856. [PubMed]
51. Ruas-Madiedo, P., M. Gueimonde, F. Arigoni, C. G. de los Reyes-Gavilan, and A. Margolles. 2009. Bile affects the synthesis of exopolysaccharides by Bifidobacterium animalis. Appl. Environ. Microbiol. 75:1204-1207. [PMC free article] [PubMed]
52. Ruas-Madiedo, P., J. Hugenholtz, and P. Zoon. 2002. An overview of the functionality of exopolysaccharides produced by lactic acid bacteria. Int. J. Dairy Res. 12:163-171.
53. Schultz, M., and R. B. Sartor. 2000. Probiotics and inflammatory bowel diseases. Am. J. Gastroenterol. 95:S19-S21. [PubMed]
54. Sengul, N., B. Aslim, G. Ucar, N. Yucel, S. Isik, H. Bozkurt, Z. Sakaogullari, and F. Atalay. 2006. Effects of exopolysaccharide-producing probiotic strains on experimental colitis in rats. Dis. Colon Rectum 49:250-258. [PubMed]
55. Shin, H. D., K. J. Yang, B. R. Park, C. W. Son, H. J. Jang, and S. K. Ku. 2007. Antiosteoporotic effect of Polycan, beta-glucan from Aureobasidium, in ovariectomized osteoporotic mice. Nutrition 23:853-860. [PubMed]
56. Simpson, P. J., C. Stanton, G. F. Fitzgerald, and R. P. Ross. 2002. Genomic diversity within the genus Pediococcus as revealed by randomly amplified polymorphic DNA PCR and pulsed-field gel electrophoresis. Appl. Environ. Microbiol. 68:765-771. [PMC free article] [PubMed]
57. Snart, J., R. Bibiloni, T. Grayson, C. Lay, H. Zhang, G. E. Allison, J. K. Laverdiere, F. Temelli, T. Vasanthan, R. Bell, and G. W. Tannock. 2006. Supplementation of the diet with high-viscosity beta-glucan results in enrichment for lactobacilli in the rat cecum. Appl. Environ. Microbiol. 72:1925-1931. [PMC free article] [PubMed]
58. Spicer, E. J., E. I. Goldenthal, and T. Ikeda. 1999. A toxicological assessment of curdlan. Food Chem. Toxicol. 37:455-479. [PubMed]
59. Stanton, C., G. Gardiner, H. Meehan, K. Collins, G. Fitzgerald, P. B. Lynch, and R. P. Ross. 2001. Market potential for probiotics. Am. J. Clin. Nutr. 73:476S-483S. [PubMed]
60. Sunny-Roberts, E. O., and D. Knorr. 2008. Evaluation of the response of Lactobacillus rhamnosus VTT E-97800 to sucrose-induced osmotic stress. Food Microbiol. 25:183-189. [PubMed]
61. Sutherland, I. W. 1998. Novel and established applications of microbial polysaccharides. Trends Biotechnol. 16:41-46. [PubMed]
62. Suzuki, I., H. Tanaka, A. Kinoshita, S. Oikawa, M. Osawa, and T. Yadomae. 1990. Effect of orally administered beta-glucan on macrophage function in mice. Int. J. Immunopharmacol. 12:675-684. [PubMed]
63. Theuwissen, E., and R. P. Mensink. 2008. Water-soluble dietary fibers and cardiovascular disease. Physiol. Behav. 94:285-292. [PubMed]
64. Tsoni, S. V., and G. D. Brown. 2008. Beta-glucans and dectin-1. Ann. N. Y. Acad. Sci. 1143:45-60. [PubMed]
65. Tsukada, C., H. Yokoyama, C. Miyaji, Y. Ishimoto, H. Kawamura, and T. Abo. 2003. Immunopotentiation of intraepithelial lymphocytes in the intestine by oral administrations of beta-glucan. Cell. Immunol. 221:1-5. [PubMed]
66. van de Guchte, M., P. Serror, C. Chervaux, T. Smokvina, S. D. Ehrlich, and E. Maguin. 2002. Stress responses in lactic acid bacteria. Antonie Van Leeuwenhoek 82:187-216. [PubMed]
67. van Kranenburg, R., I. C. Boels, M. Kleerebezem, and W. M. de Vos. 1999. Genetics and engineering of microbial exopolysaccharides for food: approaches for the production of existing and novel polysaccharides. Curr. Opin. Biotechnol. 10:498-504. [PubMed]
68. Van Oevelen, D., and H. Verachtert. 1979. Slime production by brewery strain of Pediococcus cerevisiae. J. Am. Soc. Brew. Chem. 37:34-37.
69. Vinderola, G., G. Perdigon, J. Duarte, E. Farnworth, and C. Matar. 2006. Effects of the oral administration of the exopolysaccharide produced by Lactobacillus kefiranofaciens on the gut mucosal immunity. Cytokine 36:254-260. [PubMed]
70. Volman, J. J., J. D. Ramakers, and J. Plat. 2008. Dietary modulation of immune function by beta-glucans. Physiol. Behav. 94:276-284. [PubMed]
71. Walker, D. C., H. S. Girgis, and T. R. Klaenhammer. 1999. The groESL chaperone operon of Lactobacillus johnsonii. Appl. Environ. Microbiol. 65:3033-3041. [PMC free article] [PubMed]
72. Walker, W. A. 2000. Role of nutrients and bacterial colonization in the development of intestinal host defense. J. Pediatr. Gastroenterol. Nutr. 30(Suppl. 2):S2-S7. [PubMed]
73. Walling, E., E. Gindreau, and A. Lonvaud-Funel. 2005. A putative glucan synthase gene dps detected in exopolysaccharide-producing Pediococcus damnosus and Oenococcus oeni strains isolated from wine and cider. Int. J. Food Microbiol. 98:53-62. [PubMed]
74. Werning, M. L., M. A. Corrales, A. Prieto, P. F. de Palencia, J. Navas, and P. Lopez. 2008. Heterologous expression of a position 2-substituted (1->3)-beta-d-glucan in Lactococcus lactis. Appl. Environ. Microbiol. 74:5259-5262. [PMC free article] [PubMed]
75. Werning, M. L., I. Ibarburu, M. T. Duenas, A. Irastorza, J. Navas, and P. Lopez. 2006. Pediococcus parvulus gtf gene encoding the GTF glycosyltransferase and its application for specific PCR detection of beta-D-glucan-producing bacteria in foods and beverages. J. Food Prot. 69:161-169. [PubMed]
76. Wilson, T. A., R. J. Nicolosi, B. Delaney, K. Chadwell, V. Moolchandani, T. Kotyla, S. Ponduru, G. H. Zheng, R. Hess, N. Knutson, L. Curry, L. Kolberg, M. Goulson, and K. Ostergren. 2004. Reduced and high molecular weight barley beta-glucans decrease plasma total and non-HDL-cholesterol in hypercholesterolemic Syrian golden hamsters. J. Nutr. 134:2617-2622. [PubMed]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)