PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Neurosci. Author manuscript; available in PMC 2010 April 21.
Published in final edited form as:
PMCID: PMC2804484
NIHMSID: NIHMS159499

The TC10-exo70 complex is essential for membrane expansion and axonal specification in developing neurons

Abstract

Axonal elongation is one of the hallmarks of neuronal polarization. This phenomenon requires axonal membrane growth by exocytosis of plasmalemmal precursor vesicles (PPVs) at the nerve growth cone, a process regulated by IGF-1 activation of the PI3k pathway. Few details are known, however, about the targeting mechanisms for PPVs. Here we show, in cultured hippocampal pyramidal neurons and growth cones isolated from fetal rat brain, that IGF-1 activates the GTP-binding protein TC10, which triggers translocation to the plasma membrane of the exocyst component exo70 in the distal axon and growth cone. We also show that TC10 and exo70 function are necessary for addition of new membrane and, thus, axon elongation stimulated by IGF-1. Moreover, expression silencing of either TC10 or exo70 inhibit the establishment of neuronal polarity by hindering the insertion of IGF-1 receptor in one of the undifferentiated neurites. We conclude that, in hippocampal pyramidal neurons in culture, (i) membrane expansion at the axonal growth cone is regulated by IGF-1 via a cascade involving TC10 and the exocyst complex, (ii) TC10 and exo70 are essential for the polarized externalization of IGF-1 receptor, and (iii) this process is necessary for axon specification.

Keywords: exo70-TC10, exocyst complex, membrane, neuron differentiation, polarity, axon

INTRODUCTION

The development of a typical polarized neuron, composed of one long axon and several branching dendrites, requires the action of two interrelated processes, neurite outgrowth and specification of the axon. The initial signals and pathways that determine polarity are beginning to be understood. A particularly early event, in neurons that do not yet exhibit a discernible axon (stage 2 of differentiation; Sosa et al. 2006), is the segregation of activatable IGF-1 receptors in one neurite. Subsequently, phosphatidylinositol-3 kinase (PI3k) and its product, PIP3, accumulate in the distal region and growth cone of that neurite, together with the IGF-1 receptor. These events are critical for the outgrowth of the future axon (Shi et al. 2003; Ménager et al. 2004; Nishimura et al. 2005). Indeed, designation of the axon requires activation of PI3k by the IGF-1 receptor (Shi et al. 2003; Sosa et al. 2006). Besides axonal specification, the establishment of polarity necessitates axonal elongation and, therefore, the addition of new membrane to the axon’s plasmalemma. Axolemmal expansion occurs by exocytosis of plasmalemmal precursor vesicles (PPVs) primarily at the neuronal growth cone (Pfenninger and Maylíe-Pfenninger, 1981; Pfenninger and Friedman, 1993; Furterman and Banker, 1996), a process regulated by IGF-1 activation of the PI3k pathway (Pfenninger et al. 2003; Laurino et al. 2005; Pfenninger, 2009).

The exocyst complex is thought to be critical for several forms of polarized exocytosis (TerBush et al. 1996). In yeast, it marks regions of membrane addition during budding and cytokinesis (TerBush and Novick, 1995; Finger et al. 1998: Guo et al. 1999). In multi-cellular organisms the exocyst complex has been implicated in a variety of processes involving exocytosis, such as the establishment of polarity in epithelial cells (Grindstaff et al. 1998; Yeaman et al. 2001), the insulin-regulated insertion of Glut4, the glucose transporter, into the plasmalemma of adipocytes (Inoue et al. 2003), and postsynaptic NMDA and AMPA receptor trafficking (Sans et al. 2003). In hippocampal neurons, a widely used system to study neuronal growth and polarization, exocyst subunits (the Sec6/8 complex) are enriched at growth cones (Hazuka et al. 1999). In PC12 cells, neurite outgrowth is repressed by a deletion mutant of the exocyst component Sec10 (Vega and Hsu, 2001), and in adipocytes yet another exocyst protein, exo70, translocates to the plasma membrane in response to insulin. This occurs via activation of the small GTPase TC10, which assembles a multiprotein complex including Sec6 and Sec8 at the plasmalemma (Inoue et al. 2003). An NGF-induced exo70-TC10 complex has been shown to modulate neurite outgrowth in PC12 cells (Pommereit et al. 2007).

In this study we examined the roles of exo70 and TC10 in axonal membrane biogenesis and growth of differentiating hippocampal pyramidal neurons in culture. In these cells loss of function of either TC10 or exo70 repressed not only axonal membrane expansion and outgrowth but also the establishment of neuronal polarity by inhibiting the polarized insertion of IGF-1 receptor in one of the minor neurites.

MATERIALS AND METHODS

shRNA Plasmids

Plasmids containing shRNA were constructed in pBS/U6 vectors according to the procedures described (Xia et al. 2003). cDNAs encoding shRNAs were inserted in a pCAGIG vector in which the GFP-cDNA is under the control of chick actin-minimal CMV (CAG) promoter (The pBS/U6 and pCAGIG vectors were a generous gift from Dr. C-H. Sung). The DNA sequences used as targets were: Exo70, ggagaatgtcgaaaagacc (a generous gift of Dr. R. Prekeris); Tc10, gggtaccagaactaaaggaat (similar to the sequence used by Kawase et al. 2006) and, for controls, gggtaaccaatagaggaca, a scrambled sequence that was created using the Wizard design web page (InVivogen). The resulting plasmids were referred to as Exo70-shRNA, TC10-shRNA and scramRNA (scrambled shRNA), respectively.

DNA constructs

The coding sequence of rat TC10 was PCR amplified from a rat brain cDNA library using forward primer 5’-cggcgaattcatggctcacgggccc-3’ and reverse primer 5’-ggatgtcgacgacaggctccctcccc-3’. The PCR product was cloned into the EcoRI / SalI sites of a pCMV vector (Clontech) that contained the sequence encoding the Myc or HA tag at the 5’ end of the cloning site. To construct the dominant-negative (T23N) mutant form of TC10, the wild-type construct was mutated using the QuikChange site-directed mutagenesis kit (Stratagene). Complementary primers on the site of mutagenesis for T23N were 5’-ggggcggtgggtaagaactgcctgctcatgagc-3’ and its complementary strand. The coding sequence of rat Exo70 was PCR amplified from a rat brain cDNA library using forward primer 5 ´-gcgctgtccgaattcatgattcccccgcagg-3 ’ and reverse primer 5 ’-gggcggaagatctggccgacttaagcagagg-3’. The PCR product was cloned into the EcoRI / BglII sites of the pCMV vector (Clontech) containing a Myc or HA tag at the 5’ end of the cloning site. The GFP-tagged L1 construct was a generous gift from Dr. T. Galli (Dequidt et al. 2007).

Primary antibodies

The following primary antibodies were used: Affinity-purified rabbit polyclonal antibody to exo70 (generous gift of Dr. R. Prekeris) diluted 1:1000 for immunofluorescence (IF) and 1:2000 for Western blot (WB); goat polyclonal antibodies to TC10 (E-13 and A-14; Santa Cruz Biotechnology Inc.) diluted 1:50 (IF) or 1:250 (WB); goat polyclonal anti-GAP-43 (C-19; Santa Cruz Biotechnology Inc.) diluted 1:250; rabbit polyclonal antibody to βIII-tubulin (Sigma) diluted 1:2000; rat monoclonal antibody to tyrosinated α-tubulin (clone Tub-IA2 Sigma), diluted 1:2000; mouse monoclonal and rabbit polyclonal antibodies to c-Myc (Sigma) diluted 1:400; rat monoclonal antibody to HA (cole 3F10 Roche) 1:700; mouse monoclonal antibody to the axonal marker Tau-1 (Calbiochem) diluted 1:200; mouse monoclonal anti-GFP (Roche) diluted 1:600.

Culture and transfection

Dissociated hippocampal pyramidal neurons were prepared from fetal rat brain and cultured as described (Rosso et al. 2004). In brief, cells were plated onto polylysine-coated glass coverslips and maintained in DMEM plus 10% horse serum for 1h. The coverslips with the attached cells were transferred subsequently to 60-mm Petri dishes containing serum-free medium plus the N2 mixture. Cultures were maintained in a humidified 37° incubator with 5% CO2. Shortly after plating, hippocampal neurons first extend lamellipodia (stage 1) and afterwards several minor neurites that are initially indistinguishable (stage 2). Then, at stage 3, one of these initially equivalent neurites grows more rapidly than the others and becomes the axon, whereas the other neurites subsequently develop into dendrites (stage 4). Neurons are considered to be at stage 3 when the length of the axon exceeds that of the average minor neurite by at least 20̣ µm (Craig and Banker, 1989). Transient transfection of cultured neurons was performed as described previously (Rosso et al., 2004), and the constructs used at a concentration of 2 µg/µl.

Immunofluorescence Microscopy

Cells were fixed for 1 h at room temperature with 4% (wt/vol) paraformaldehyde in phosphate-buffered saline (PBS) containing 4% (wt/vol) sucrose. Cultures were washed with PBS, permeabilized with 0.1% (vol/vol) Triton X-100 in PBS for 6 min, and again washed in PBS. After labeling with a first primary antibody (1–3 h at room temp.) and washing with PBS, cultures were incubated with fluorescent secondary antibody (conjugated to Alexa fluor 488, 546 or 633; 1 h at 37°) and washed with PBS. The same procedure was repeated for the second and third primary and secondary antibodies. For the experiments using the L1-GFP construct (Fig. 6), cells were fixed as described and labeled with the anti-GFP and a fluorescent secondary antibody (conjugated to Alexa fluor 546). Afterwards, cells were permeabilized as described and labeled with the anti-Myc antibody and the corresponding secondary antibody. The cells were observed with a Zeiss Pascal 5 confocal microscope. Images were captured and digitized using LSM Image software. For some experiments (Fig. 4 and Fig 5) cells were observed with a Nikon TIRF microscope. Images were captured using a CCD camera (Hamamatsu) and digitized directly into a Metamorph/Metafluor Image Processor (Universal Imaging Corporation, West Chester, PA). All images were printed using Adobe PhotoShop.

Fig. 4
Activation of TC10 triggers recruitment of exo70 to neuronal plasmalemma
Fig. 5
IGF-1-triggered association of exo70 with the plasmalemma requires functional TC10
Fig. 6
IGF-1-stimulated plasmalemmal insertion of L1-GFP requires functional TC10

Gel Electrophoresis and Western Blot

Proteins were separated by SDS-polyacrylamide gel electrophoresis. The concentration of acrylamide of the resolving gel varied from 7.5 to 11%. The resolved proteins were transferred to polyvinylidene difluoride (PVDF) membranes in Tris-glycine buffer containing 20% methanol. The membranes were first dried, washed with Tris-buffered saline (TBS; 10 mM Tris pH 7.5, 150 mM NaCl) and then blocked, or directly blocked for 1 h in TBS containing 5% BSA. The blots were incubated with the primary antibodies in PBS containing 0.05% Tween 20, for 2 h at room temperature. After washing with TBS containing 0.05% Tween 20, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (Sigma) for 1 h at room temperature. After washing the blots were developed using a chemiluminescence detection kit (ECL, Amersham Life Sciences Inc., Arlington Heights, IL).

Isolation of growth cones

Axonal growth cones were isolated from developing brain as described (Pfenninger et al. 1983; Lohse et al. 1996). In brief, brains of 18-day gestation fetal rats were homogenized (H). A low-speed supernatant (LSS) was prepared, loaded onto a discontinuous sucrose density gradient with steps of 0.83 and 2.66 M sucrose, and spun to equilibrium at 242,000 gmax. The fraction at the load/0.83 M interface (designated ‘A’) contained the isolated growth cones or growth cone particles (GCPs).

TC10 activity assays

GCPs (prepared as described) were incubated in control medium, medium containing 10 nM IGF-1, 10 nM IGF-1 plus 20 µM LY294002, or 50 nM insulin for 2 min. Lysed GCPs were incubated with binding buffer (25mMTris-HCl, pH7.5, 1mM dithiothreitol, 30mM MgCl2, 40mM NaCl and 0.5% NonidetP-40) in the presence of 7mg agarose-conjugated GST-Pak1 p21-binding domain (Upstate) for 1 h at 4°C. The beads were washed three times with 1% Nonidet P-40 washing buffer and TC10 levels were determined by immunoblot as described.

Exo70 and TC10 rescue experiments

To perform these experiments we titrated levels of exo70 or TC10 plasmid to determine the lowest concentration necessary to overcome the shRNA effects. Under these conditions cells transfected with exo70 or TC10 shRNA, together with exo70 or TC10 plasmid, respectively, exhibited protein levels that were similar to those of control non-transfected neurons (see supplementary figures 2 and 3-on line).

Time-lapse total internal fluorescence microscopy

For time-lapse total internal reflection fluorescence (TIRF) microscopy, cells were cultured in special Petri dishes (Paglini et al., 1998). Twelve hours after transfection with either wild-type TC10 or the dominant-negative form T23N-TC10 plus L1-GFP, the dishes containing the attached cells (deprived of growth factors for the last 4 h) were placed in a Harvard micro incubator located on top of the stage of a fully motorized Nikon TE-2000 E inverted microscope equipped for differential interference contrast, epifluorescence, and TIRF. We used TIRF to image single vesicular insertion events under low intensity conditions that minimize phototoxicity (Yudowski et al., 2006). Cells were visualized with a 60x, 1.45 numerical aperture (NA) objective, equipped for through-the-objective TIRF illumination using a 488 nm argon laser. Neurons were imaged in Neurobasal medium supplemented with 20 nM IGF-1 and 30 mM HEPES buffer, pH 7.2, and maintained at 37°C. Time-lapse sequences were acquired at a continuous rate of 1 frame/s during 4 min using an ORCA II-ER (Hamamatsu) camera and MetaMorph software (Molecular Devices). Pyramidal neurons were selected by morphological criteria (in wide-field images) before imaging in TIRF mode. Live-cell images shown represent raw data with simple background subtraction of the averaged blank field intensity. After time-lapse imaging, the cultures were fixed and stained with anti-myc antibody to identify cells transfected with either wt-TC10 or T23N-TC10. Only the growth cones from transfected cells were scored for quantification.

Animals

All animal procedures were done using approved protocols by the Board of Animal Welfare, School of Chemical Sciences, National University of Córdoba.

RESULTS

Distribution and Role of TC10 and exo70 in Neurite Growth

We first investigated the expression and subcellular distribution of exo70 and TC10 in different subcellular fractions of fetal brain, especially in the primarily axonal growth cone fraction (Pfenninger et al. 1983; Lohse et al. 1996). Results showed that exo70 was highly enriched in isolated growth cones (GCPs; Supplementary Fig. 1A-on line) compared to brain homogenate (H), low-speed supernatant (LSS), and fraction A (A), which consists of GCPs suspended in cytosolic proteins from the homogenate (Pfenninger et al. 1983). TC10 was particularly enriched in fraction A but also concentrated in GCPs (GCPs) with respect to brain homogenate (H) (Supplementary Fig. 1A on-line). The distribution of GAP43, a protein highly enriched in GCPs (Lohse et al. 1996), is shown for comparison. We also analyzed the expression and distribution of exo70 and TC10 in primary cultures of hippocampal neurons after 24 h of differentiation in vitro (DIV, Mascotti et al. 1997). Consistent with the fractionation data, exo70 immunostaining was enriched in the distal third of the axon and the growth cone of neurons at stage 3 of differentiation (Supplementary Fig. 1B; on-line). Immunostaining with an anti-TC10 antibody showed that, unlike exo70, this small GTP-binding protein was present in the perikaryon, the minor neurites, the axonal shaft and the growth cone of the hippocampal neurons (Supplementary Fig. 1B on-line). In the distal axon and growth cone (including the leading edge), a prominent site of new membrane addition in developing neurons (Pfenninger and Maylíe-Pfenninger, 1981; Craig et al. 1995; Pfenninger et al. 2003; Laurino et al. 2005), exo70 and TC10 were co-localized (Supplementary Fig. 1B and C-on line).

The IGF-1 receptor controls the establishment of neuronal polarity by activating the PI3k-Akt-Cdc42 pathway and also regulates addition of new membrane at the axonal growth cone of developing neurons. To study the possible involvement of exocyst complex components we silenced expression of such proteins using targeted shRNAs inserted into dicistronic plasmids also encoding enhanced green fluorescent protein (GFP). Transfection of hippocampal neurons in culture with exo70-targeted shRNA significantly and specifically decreased exo70 protein in the cultures (Fig. 1c). The transfected neurons expressed virtually no detectable exo70 and failed to form axons; only short, minor neurites were present (Fig. 1a, second row from top; arrow). Note also the lack of enrichment of tau-1 in any neurite of the transfected neurons (Fig. 1a-third row from top-arrow). In contrast, neurons transfected with a scrambled RNA sequence inserted in the same plasmid exhibited normal levels of exo70 and generated a long axon-like process (Fig. 1a, top; arrowheads). Co-transfection of neurons with exo70-targeted shRNA and a myc-tagged wild-type form of exo70 rescued the phenotype and induced the outgrowth of an axon-like process enriched in tau-1 protein (Fig. 1a, bottom). The levels of exo70 expression (as revealed by immunocytochemistry) in control non-transfected cells, shRNA transfected cells and shRNA plus wt-exo70 transfected cells are shown in Supplementary Fig. 2-online. Expression of exo70 in the co-transfected cells is similar to that in control non-transfected cells (see also Materials and Methods). To analyze this observation quantitatively we scored the differentiation stages of neurons transfected with exo70-targeted shRNA compared to neurons in the same cultures not containing shRNA, after 48 h in vitro. We found that over 95% of the transfected neurons remained at stages 1 or 2 of differentiation, and less than 5% had formed a discernible axon. In contrast, over 80% of the control neurons showed an identifiable, tau-1-containing axon (Fig. 1b). We performed similar experiments with shRNA targeting TC10, the exo70 activator. Western blots showed that transfection with the dicistronic plasmid containing TC10-targeted shRNA plus GFP significantly reduced TC10 expression in hippocampal neurons in culture (Fig. 2c). TC10 was not detectable by immunofluorescence in transfected neurons. Such neurons failed to form an axon and generated only short, minor neurites (Fig. 2a, top). These neurons also failed to polarize tau-1 protein to any process (Fig. 2a, middle), whereas growing axons from non-transfected neurons in the same culture were clearly tau-1-positive (Fig 2a, middle; arrowheads). Co-transfection with TC10 shRNA plus a myc-tagged wild-type form of TC10 rescued the phenotype and generated neurons with axon-like processes enriched in tau-1 protein (Fig. 2a, bottom). The levels of TC10 expression (revealed immunocytochemically) in control non-transfected cells, shRNA-transfected cells and shRNA plus wt-TC10-transfected cells are shown in Supplementary Fig. 3-online. The expression of TC10 in the co-transfected cells is similar to that in control non-transfected neurons (see also Materials and Methods). As in the case of exo70, most neurons transfected with TC10-targeted shRNA remained at stages 1 and 2 of differentiation (Fig. 2b). Additional evidence for the participation of TC10 in neurite outgrowth and the establishment of neuronal polarity was obtained by transfecting hippocampal neurons with a dominant-negative form of TC10 (T23N). After 36 hours in culture neurons transfected with wild-type TC10 (myc-tagged) differentiated apparently normally and grew a long, axon-like process (Fig. 3a, top). In contrast, neurons transfected with T23N-TC10 remained at stage 2 of differentiation, with only short, minor neurites without detectable tau-1 levels (Fig. 3 a, bottom). Quantitative data are shown in Fig. 3b. The levels of expression of endogenous TC10 and T23N-TC10 are shown immunocytochemically in Supplementary Fig. 4-on line and indicate that the mutant construct is not expressed at a very high, potentially toxic level. Taken together, these results indicate that the TC10-exo70 complex is essential for axonal growth and suggest that it is involved in the establishment of polarity in hippocampal neurons.

Fig. 1
Exo70 expression silencing
Fig. 2
TC10 loss of function
Fig. 3
Dominant-negative (T23N) TC10 inhibits neuronal polarization

TC10 Activation and exo70 Recruitment by IGF-1

Insulin-regulated translocation of Glut4 from intracellular storage sites to the plasma membrane requires activation of TC10 in adipocytes and muscle cells (Chiang et al. 2001). While insulin receptors are essentially absent from growth cones of differentiating neurons, IGF-1 receptors are enriched significantly (Quiroga et al. 1995; Mascotti et al. 1997; Sosa et al. 2006). Therefore, we investigated whether TC10 was activated by IGF-1 in growth cones. We stimulated isolated growth cones (GCPs) with 10 nM IGF-1 for 2 minutes, solubilized them, and affinity-purified the GTP-bound form of TC10 on GST-agarose containing the Cdc42 binding domain of Pak1 (Chiang et al. 2001). TC10 levels were determined by Western blot. These blots showed that the percentage of GTP-bound (activated) TC10 relative to total TC10 was increased significantly (p≤ 0.001) by IGF-1, as compared to control (unstimulated) GCPs, insulin-stimulated GCPs, or GCPs stimulated with IGF-1 in the presence of 20 µM LY294002 (Fig. 4a; numerical values shown below blots). Inhibition of TC10 activation by LY294002 suggested that PI3k was necessary for TC10 activation by IGF-1. In other cell systems, activation of TC10 results in translocation of exo70 to the plasma membrane (Inoue et al. 2003). This also applied to growth cones (Fig. 4b). Exo70 was below detection levels in the soluble fraction (S) in control GCPs, and this did not change with IGF-1 stimulation. Instead, most exo70 was associated with membrane (M) and cytoskeletal (C) fractions prepared from GCPs. 10 nM IGF-1 raised the association of exo70 with the membrane fraction significantly so that the membrane/cytoskeleton ratio of exo70 increased over 4-fold relative to that in control, unstimulated, GCPs.

We also studied exo70 association with the plasma membrane in intact hippocampal pyramidal neurons in culture. After control incubation or challenge with 10 nM IGF-1 for 2 min, the cultures were fixed, permeabilized, immunostained with an antibody to exo70 and analyzed using epifluorescence or evanescent-wave fluorescence (total internal reflection fluorescence, TIRF) microscopy. TIRF microscopy allows selective imaging of fluorescent probes located in close proximity (< 100 nm) to the coverslip on which the cells grow, i.e., associated with the adherent plasma membrane. While epifluorescence revealed similar levels of exo70 in control and IGF-1-stimulated neurons and processes, the TIRF images differed (Fig. 4c). In control neurites TIRF detected essentially no exo70, whereas neurons challenged with IGF-1 exhibited a strong exo70 TIRF signal in the distal third of the axon and growth cone, where most membrane addition occurs in developing neurons (Fig. 4c). For comparison, we analyzed the membrane association of the synaptic vesicle protein synaptophysin in neurons under similar experimental conditions. The results indicated that challenging with IGF-1 did not cause any noticeable increment of synaptophysin TIRF signal at the growth cone of the neurons (Supplementary Fig. 5-on line). In order to correlate exo70 recruitment to the plasma membrane with TC10 activity, we performed similar experiments in neurons transfected with wild-type or dominant-negative forms of TC10. In neurons transfected with wild-type TC10 and challenged with IGF-1, TIRF detected the expected increment of exo70 in the distal axon and growth cone (Fig. 5, top; arrow). Transfection with dominant-negative T23N-TC10, however, abolished IGF-1-triggered membrane recruitment of exo70 as seen by TIRF (Fig. 5, bottom).

TC10 and Membrane Expansion

In order to establish a direct link between TC10 activity and membrane addition at the growth cone, we used as a membrane marker the cell-adhesion molecule L1 fused at its N-terminus to GFP (L1-GFP) via a linker cleavable with thrombin (Dequidt et al. 2007). For experimentation such cultures were treated with thrombin to remove externally exposed GFP. Monitoring subsequent recovery of GFP at the cell surface allowed us to assess insertion of new membrane containing L1-GFP. We co-transfected hippocampal neurons (after 24 h in vitro) with L1-GFP and either wild-type TC10 or T23N-TC10; 12 h later the cells were treated for 100 s with thrombin and allowed to recover for 3 h in control conditions or after stimulation with 10 nM IGF-1.

Immunostaining of non-permeabilized cells with an anti-GFP antibody revealed the L1-GFP inserted into the plasmalemma during the recovery period. Results of these experiments are shown in Fig. 6a. They indicated that restoration of extracellular L1-GFP in the growth cone and distal axon was detectable only in those neurons that were transfected with wild-type TC10 and stimulated with IGF-1. (Fig. 6a, top). In contrast, the cells transfected with the dominant-negative T23N-TC10 exhibited no appreciable differences in extracellular GFP labeling between control neurons and IGF-1 stimulated neurons (Fig. 6a, bottom). For quantitative analysis we measured the fluorescence intensity of surface GFP (as revealed by immunostaining of non-permeabilized cells with anti-GFP antibody) and of total GFP in the distal third of the axon and growth cone of these neurons. The ratios of surface GFP/total GFP fluorescence intensity are shown in Fig. 6b. They indicate that treatment with IGF-1 did not significantly increase surface GFP in the cells transfected with dominant-negative T23N-TC10. In the cells transfected with wild-type TC10, however, treatment with IGF-1 triggered an almost 4-fold, significant increment in the ratio of surface/total GFP. Neurons mock-transfected with scrambled RNA and treated with IGF-1 also exhibited a significant increment of this ratio. In order to establish a direct relationship between TC10 activity and PPV exocytosis at the growth cone of differentiating hippocampal neurons, we used time-lapse TIRF microscopy (Bisbal et al., 2008) to evaluate whether or not transfection with T23N-TC10 reduced the number of fusion events of L1-GFP-containing vesicles with the growth cone plasmalemma. Figure 7 shows two examples of such fusion events at the growth cone of a hippocampal pyramidal neuron transfected with wt-TC10 plus L1-GFP. The estimated frequency of fusion events at the growth cone of neurons transfected with wt-TC10 plus L1-GFP was 1.2 ± 0.4 min−1 growth cone−1 (n=11) compared to 0.08 ± 0.04 min−1 growth cone−1 (n=10) for neurons transfected with T23N-TC10 plus L1-GFP (only one isolated fusion event was seen during the 4-min observation period in 3 out of the 10 growth cones recorded). These results indicate that TC10 activity is essential for the IGF-1-triggered addition of new membrane at the growth cone of differentiating neurons (Pfenninger et al. 2003; Laurino et al. 2005).

Fig. 7
Time-lapse TIRF images showing two examples of fusion events in the axonal growth cone of a hippocampal pyramidal neuron transfected with wt-TC10 plus L1-GFP. Vesicles that undergo fusion are marked with arrows. Images were recorded at 1-second intervals, ...

Insertion of the IGF-1 Receptor

An early event of axonal specification during neuronal differentiation is the enrichment of activatable IGF-1 receptor in one minor neurite at stage 2 of differentiation (Sosa et al., 2006). In order to be activated, the IGF-1 receptor needs to be inserted into the neuronal plasmalemma so that the ligand binding site is exposed to the extracellular space. Therefore, we studied the consequences of loss of function of exo70 or TC10 on the polarization of activated, i.e., phosphorylated IGF-1 receptor [mono-specificity of the antibody used for these assyas has been demonstrated previously (Sosa et al. 2006)]. In stage 2 neurons transfected with a scrambled RNA sequence (24 h in vitro), deprived of growth factor for 2 h, and stimulated for 2 min with 10 nM IGF-1, we observed the expected polarized distribution of the activated IGF-1 receptor (Fig. 8a, top). In contrast, neurons transfected with exo70 or TC10-targeted shRNA exhibited labeling of the activated IGF-1 receptor that was less intense and not confined to any particular minor process (Fig. 8a, middle and bottom rows). To quantify these differences we calculated an “active IGF-1 receptor polarization index” (see legend to Fig. 8b). As shown in Fig. 8b this index was significantly higher (p=0.0001) in the neurons transfected with the scrambled RNA sequence than in the TC10- or exo70-suppressed neurons. Neurons subjected to the same experimental conditions also were stained with βgc antibody, which recognizes both the phosphorylated and non-phosphorylated forms of the IGF-1 receptor (Quiroga et al., 1995). Control and exo70 or TC10 expression-silenced neurons exhibited at stage 2 (12 h in culture) punctate, presumably intracellular βgc labeling in all neurites (Supplementary Fig. 6-on line). After 36 h in culture, most control neurons had progressed to stage 3, with all IGF-1 receptors sequestered in the axon, whereas TC10- and exo70-silenced neurons failed to mature further and did not exhibit the same polarization (Supplemental Fig.7-on line; see also Fig. 1 and Fig 2). Taken together, these results suggested that TC10 and exo70 were essential for the polarized externalization of IGF-1 receptor in stage 2 neurons and, therefore, for axonal specification in hippocampal pyramidal neurons.

Fig. 8
exo70 and TC10 loss of function inhibits the polarization of activatable IGF-1 receptor

DISCUSSSION

During differentiation, neurons must enlarge their surface rapidly to support axonal outgrowth. This necessitates recruitment of newly synthesized membrane to the cell surface, by exocytotic insertion of PPVs at the growth cone (Pfenninger, 2009). Earlier studies from our laboratories demonstrated that IGF-1, unlike the classic neurotrophins, stimulates PPV exocytosis at the axonal growth cone (Pfenninger et al. 2003). This occurs via activation of a receptor isoform that contains the immunochemically distinct βgc subunit (Quiroga et al. 1995; Mascotti et al. 1997) and requires the activation of the phosphatidyl inositol 3-kinase (PI3k)-Akt signaling pathway (Laurino et al. 2005). Little is known, however, about (i) PPV targeting to the growth cone’s plasma membrane and (ii) the relationship between membrane expansion and axonal specification for the establishment of neuronal polarity. The present report addresses these issues.

Regulation of Membrane Expansion

Published data suggest that the exocyst complex participates in the targeting of PPVs to neuronal plasmalemma (Hazuka et al. 1999), and mutation of the exocyst protein sec5 is known to impair addition of new membrane in developing neurons (Murthy et al. 2003). In adipocytes, the exocyst complex assembles at the plasma membrane in response to insulin, via the association of exo70 with activated TC10, and this tethers vesicles carrying Glut4 to the site of exocytosis (Inoue et al. 2003). These observations prompted us to investigate the roles of TC10 and exo70 in IGF-1-regulated membrane expansion in hippocampal neurites.

Our results show that expression of TC10 and exo70 is substantial in hippocampal neurons developing in culture. While TC10 is distributed throughout the polarized neuron, exo70 is targeted selectively to the distal axon, where the IGF-1 receptor is enriched also. Thus, the IGF-1 receptor, TC10 and exo70 colocalize at the axonal growth cone, a prominent site of membrane addition. In adipocytes and PC12 cells, insulin (Inoue et al. 2003) and NGF (Pommereit et al. 2007), respectively, activate TC10, which recruits exo70 to the plasmalemma. We show here that IGF-1 (and not insulin) triggers robust and significant activation of TC10 in growth cones isolated from fetal brain. In both GCPs and hippocampal neurons in culture TC10 activation by IGF-1 results in translocation of exo70 (and, presumably, other proteins of the exocyst complex) to the distal axonal plasma membrane. Overexpression of a dominant-negative form of TC10 abolishes this translocation, even in the presence of IGF-1. Therefore, IGF-1 stimulation and activation of TC10, in conjunction with functional exo70, are essential for membrane expansion, as shown by the recruitment of L1-GFP to the cell surface, and thus for axon elongation. Together with our earlier findings (Pfenninger et al., 2003; Laurino et al., 2005) these results show that, in hippocampal pyramidal neurons in culture, membrane expansion at the axonal growth cone is regulated by IGF-1 via a cascade involving PI3k, TC10 and the exocyst complex.

Membrane expansion and Axon Specification

We have shown previously that IGF-1 and its receptor, which regulate exocytosis of PPVs at the axonal growth cone, are essential for the establishment of neuronal polarity (Sosa et al., 2006). IGF-1 could exert its influence on axon specification via a number of different mechanisms including pathways that do not include membrane expansion. We show here, however, that TC10- and exo70-deficient hippocampal neurons, i.e., neurons that cannot assemble the exocyst at the plasmalemma and exhibit impaired membrane expansion, are incapable of polarization. This indicates that, surprisingly, exocytosis of PPVs is necessary for axon specification.

Activation of the IGF-1 receptor requires its insertion into the plasmalemma. By probing for the appearance of activated IGF-1 receptor in undifferentiated neurites we demonstrate that the exocyst is necessary for IGF-1 receptor externalization in non-polarized neurons. It follows, therefore, that insertion of IGF-1 receptor in an undifferentiated neurite (stage 2 hippocampal pyramidal neurons) is necessary for polarization. In other words, the TC10-exocyst complex can control axonal specification via polarized exocytosis of the IGF-1 receptor. Because IGF-1 activates TC10 and triggers exocyst assembly it may regulate the insertion of its own receptor (among other membrane proteins not directly related to neuronal polarization, such as L1). This is a positive-feedback mechanism that could rapidly amplify the membrane expansion response to IGF-1 and, thus, the growth rate of an undifferentiated neurite.

We propose, therefore, that the process of IGF-1 receptor mobilization to neurite plasmalemma / receptor activation / and further membrane expansion may be (one of) the self-reinforcing mechanism(s) deemed necessary for axonal specification (Arimura and Kaibuchi, 2007- Nature Rev Neurosci; see also Pfenninger, 2009). We do not know what mechanism confines this process to a single neurite. However, initial insertion of a few IGF-1 receptors in one of the undifferentiated neurites (possibly a stochastic process) would suffice to trigger the described positive-feedback mechanism and accelerated growth of the axon-designate.

Supplementary Material

Supp1

Acknowledgements

This work was supported by grants from the Agencia Nacional de Promoción Científica y Tecnológica, Argentina (to S.Q. and A.C.), Consejo Nacional de Investigaciones Científicas y Técnicas, CONICET-Argentina (to A.C. and S.Q.), the U.S. National Institutes of Health (to K.H.P.), and by the Secretaría de Ciencia y Técnica de la Universidad Nacional de Córdoba (SECYT-UNC-to S.Q.)

REFERENCES

  • Arimura N, Kaibuchi K. Neuronal polarity: from extracellular signals to intracellular mechanisms. Nat. Rev Neurosci. 2007;3:194–205. [PubMed]
  • Chiang SH, Baumann CA, Kanzaki M, Thurmond DC, Watson RT, Neudauer CL, Macara IG, Pessin JE, Saltiel AR. Insulin-stimulated GLUT4 translocation requires the CAP-dependent activation of TC10. Nature. 2001;410:944–948. [PubMed]
  • Cocucci E, Lorusso A, Naum Ongania G, Klajn A, Meldolesi J. Non-secretory exocytoses in the brain. J Physiol (Paris) 2006;99:140–145. [PubMed]
  • Craig AM, Banker G. Neuronal Polarity. Annu Rev Neurosci. 1989;17:267–310. [PubMed]
  • Craig AM, Wyborski RJ, Banker GA. Preferential addition of newly synthetized membrane protein at axonal growth cones. Nature. 1995;375:592–594. [PubMed]
  • Dequidt C, Danglot L, Alberts P, Galli T, Choquet D, Thoumine O. Fast turnover of L1 adhesions in neuronal growth cones involving both surface diffusion and exo/endocytosis of L1 molecules. Mol Biol Cell. 2007;8:3131–3143. [PMC free article] [PubMed]
  • Furterman AH, Banker GA. The economics of neurite outgrowth-the addition of new membrane to growing axons. Trends Neurosci. 1996;19:144–149. [PubMed]
  • Finger FP, Hughes TE, Novick P. Sec3p is a spatial landmark for polarized secretion in budding yeast. Cell. 1998;92:559–571. [PubMed]
  • Grindstaff KK, Yeaman C, Anandasabapathy N, Hsu SC, Rodriguez-Boulan E, Scheller RH, Nelson WJ. Sec6/8 complex is recruited to cell-cell contacts and specifies transport vesicle delivery to the basal-lateral membrane in epithelial cells. Cell. 1998;93:731–740. [PubMed]
  • Guo W, Roth D, Walch-Solimena C, Novick P. The exocyst is an effector for Sec4p, targeting secretory vesicles to sites of exocytosis. EMBO J. 1999;18:1071–1080. [PubMed]
  • Hazuka CD, Foletti DL, Hsu SC, Kee Y, Hopf FW, Scheller RH. The Sec6/8 complex is located at neurites outgrowth and axonal sinapse-assembly domains. J Neurosci. 1999;19:1324–1334. [PubMed]
  • Inoue M, Chang L, Hwang J, Chiang SH, Saltiel AR. The exocyst complex is required for targeting of Glut4 to the plasma membrane by insulin. Nature. 2003;422:629–633. [PubMed]
  • Laurino L, Wang XX, de la Houssaye BA, Sosa L, Dupraz S, Caceres A, Pfenninger KH, Quiroga S. PI3K activation by IGF-1 is essential for the regulation of membrane expansion at the nerve growth cone. J Cell Sci. 2005;118:3653–3662. [PubMed]
  • Lohse K, Helmke SM, Wood MR, Quiroga S, de la Houssaye BA, Miller VE, Negre-Aminou P, Pfenninger KH. Axonal origin and purity of growth cones isolated from fetal rat brain. Dev Brain Res. 1996;96:83–96. [PubMed]
  • Lockerbie RO, Miller VE, Pfenninger KH. Regulated plasmalemmal expansion in nerve growth cones. J Cell Biol. 1991;112:1215–1217. [PMC free article] [PubMed]
  • Mascotti F, Cáceres A, Pfenninger KH, Quiroga S. Expression and Distribution of IGF-1 Receptors Containing a β-Subunit Variant (βgc) in Developing Neurons. J Neurosci. 1997;4:1447–1459. [PubMed]
  • Ménager C, Arimura N, Fukata Y, Kaibuchi K. PIP3 is involved in neuronal polarization and axon formation. J Neurochem. 2004;89:109–118. [PubMed]
  • Murthy M, Garza D, Scheller RH, Schwarz TL. Mutations in the exocyst component Sec5 disrupt neuronal membrane traffic, but neurotransmitter release persists. Neuron. 2003;37:433–447. [PubMed]
  • Nishimura T, Yamaguchi T, Kato K, Yoshizawa M, Nabeshima Y, Ohno S, Hoshino M, Kaibuchi K. PAR-6 -PAR-3 mediates Cdc42-induced Rac activation through the Rac GEFs STEF/Tiam. Nat Cell Biol. 2005;7:270–277. [PubMed]
  • Paglini G, Kunda P, Quiroga S, Kosik K, Cáceres A. Suppression of radixin and moesin alters growth cone morphology, motility, and process formation in primary cultured neurons. J Cell Biol. 1998;143:443–455. [PMC free article] [PubMed]
  • Pfenninger KH, Maylíe-Pfenninger MF. Lectin labelling of sprouting neurons. II. Relative movement and appearance of glyconjugates during plasmalemmal expansion. J Cell Biol. 1981;89:547–559. [PMC free article] [PubMed]
  • Pfenninger KH, Ellis L, Johnson MP, Friedman LB, Somlo S. Nerve growth cones isolated from fetal rat brain: subcellular fractionation and characterization. Cell. 1983;35:573–584. [PubMed]
  • Pfenninger KH, Johnson MP. Membrane biog"nesis in the sprouting neuron. I. Selective transfer of newly synthetisized phospholipid into the growing neurite. J Cell Biol. 1983;97:1038–1042. [PMC free article] [PubMed]
  • Pfenninger KH, Friedman LB. Sites of plasmalemmal expansion in growth cones. Dev Brain Res. 1993;71:181–192. [PubMed]
  • Pfenninger KH, Laurino L, Peretti D, Wang X, Rosso S, Morfini G, Caceres A, Quiroga S. Regulation of membrane expansion at the nerve growth cone. J Cell Sci. 2003;116:1209–1217. [PubMed]
  • Pfenninger KH. Plasma membrane expansion: a neuron´s Herculean task. Nat. Rev. Neurosci. 2009;4:251–261. [PubMed]
  • Pommereit D, Wouters FS. An NGF-induced Exo70-TC10 complex locally antagonises Cdc42-mediated activation of N-WASP to modulate neurite outgrowth. J Cell Sci. 2007;120:2694–2705. [PubMed]
  • Quiroga S, Garofalo RS, Pfenninger KH. Insulin-like growth factor I receptors of fetal brain are enriched in nerve growth cones and contain a β-subunit variant. Proc Natl Acad Sci USA. 1995;92:4309–4312. [PubMed]
  • Rosso S, Bollati F, Bisbal M, Peretti D, Sumi T, Nakamura T, Quiroga S, Ferreira A, Cáceres A. LIMK1 regulates Golgi dynamics, traffic of Golgi-derived vesicles, and process extension in primary cultured neurons. Mol Biol Cell. 2004;15:3433–3449. [PMC free article] [PubMed]
  • Sans N, Prybylowski K, Petralia RS, Chang K, Wang YX, Racca C, Vicini S, Wenthold RJ. NMDA receptor trafficking through an interaction between PDZ proteins and the exocyst complex. Nat Cell Biol. 2003;5:520–530. [PubMed]
  • Shi SH, Jan LY, Jan YN. Hippocampal neuronal polarity specified by spatially localized mPar3/mPar6 and PI 3-kinase activity. Cell. 2003;112:63–75. [PubMed]
  • Sosa L, Dupraz S, Laurino L, Bollati F, Bisbal M, Cáceres A, Pfenninger KH, Quiroga S. IGF-1 receptor is essential for the establishment of hippocampal neuronal polarity. Nat Neurosci. 2006;8:993–995. [PubMed]
  • TerBush DR, Maurice T, Roth D, Novcik P. The Exocyst is a multiprotein complex required for exocitosis in Saccharomyces cerevisiae. EMBO J. 1996;15:6483–6494. [PubMed]
  • TerBush DR, Novick P. Sec6, Sec8, and Sec15 are components of a multisubunit complex which localizes to small bud tips in Saccharomyces cerevisiae. J Cell Biol. 1995;130:299–312. [PMC free article] [PubMed]
  • Vega IE, Hsu SC. The exocyst complex associates whit microtubules to mediate vesicle targeting and neurite outgrowth. J Neurosci. 2001;21:3839–3848. [PMC free article] [PubMed]
  • Xia XG, Zhou H, Ding H, Affar el B, Shi Y, Xu Z. An enhanced U6 promoter for synthesis of short hairpin RNA. Nucleic Acids Res. 2003;31:e100. [PMC free article] [PubMed]
  • Yeaman C, Grindstaff KK, Wright JR, Nelson WJ. Sec6/8 complex on trans-Golgi network and plasma membrane regulate late stages of exocytosis in mammalian cells. J Cell Biol. 2001;155:593–604. [PMC free article] [PubMed]
  • Yudowski GA, Puthenveedu MA, von Zastrow M. Distinct modes of regulated receptor insertion to the somatodendritic plasma membrane. Nat Neurosci. 2006;9:622–627. [PubMed]