PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Ann Neurol. Author manuscript; available in PMC 2010 December 1.
Published in final edited form as:
PMCID: PMC2801873
NIHMSID: NIHMS115260
Autism and other Neuropsychiatric Symptoms are Prevalent in Individuals with MECP2 Duplication Syndrome
Melissa B. Ramocki, M.D., Ph.D.,* Sarika U. Peters, Ph.D.,* Y. Jane Tavyev, M.D.,* Feng Zhang, Ph.D., Claudia M. B. Carvalho, Ph.D., Christian P. Schaaf, M.D., Ronald Richman, Ping Fang, Ph.D., Daniel G. Glaze, M.D., James R. Lupski, M.D., Ph.D., and Huda Y. Zoghbi, M.D.
Department of Pediatrics, Section of Child Neurology and Developmental Neuroscience (M.B.R., S.U.P., Y.J.T., D.G.G., H.Y.Z.) and Department of Pediatrics (J.R.L.), the Department of Molecular and Human Genetics (F.Z., C.M.B.C., C.P.S., P.F., J.R.L., H.Y.Z.), and the Department of Neuroscience (H.Y.Z.), Baylor College of Medicine, Houston, TX, 77030, Texas Children's Hospital (M.B.R., S.U.P., D.G.G., J.R.L., H.Y.Z.), Houston, TX, 77030, and the Howard Hughes Medical Institute (H.Y.Z., R.R.), Baylor College of Medicine, Houston, TX 77030.
*These three authors contributed equally to this work.
Address correspondence to: Huda Y. Zoghbi, M.D., One Baylor Plaza, MS 225, BCM-T807, Houston, Texas 77030 Email: hzoghbi/at/bcm.tmc.edu
Objective
There have been no objective assessments to determine whether boys with MECP2 duplication have autism or whether female carriers manifest phenotypes. This study characterizes the clinical and neuropsychiatric phenotypes of affected boys and carrier females.
Methods
Eight families (9 males and 9 females) with MECP2 duplication participated. A detailed history, physical examination, electroencephalogram, developmental evaluation, Autism Diagnostic Observation Schedule, and Autism Diagnostic Interview – Revised was performed for each boy. Carrier females completed the Symptom Checklist-90-R, Wechsler Abbreviated Scale of Intelligence, Broad Autism Phenotype Questionnaire, and detailed medical and mental health histories. Size and gene content of each duplication were determined by array-CGH. X-chromosome inactivation patterns were analyzed using leukocyte DNA. MECP2 and IRAK1 RNA levels were quantified from lymphoblast cell lines, and Western blots were performed to assess MeCP2 protein levels.
Results
All of the boys demonstrate mental retardation and autism. Poor expressive language, gaze avoidance, repetitive behaviors, anxiety, and atypical socialization were prevalent. Female carriers have psychiatric symptoms including generalized anxiety, depression, and compulsions that preceded the birth of their children. The majority exhibited features of the broad autism phenotype and had higher nonverbal compared to verbal reasoning skills.
Interpretation
Autism is a defining feature of the MECP2 duplication syndrome in boys. Females manifest phenotypes despite 100% skewing of X-inactivation and normal MECP2 RNA levels in peripheral blood. Analysis of the duplication size, MECP2 and IRAK1 RNA levels, and MeCP2 protein levels revealed that most of the traits in affected boys are likely due to the genomic region spanning MECP2 and IRAK1. The phenotypes observed in carrier females may be secondary to tissue-specific dosage alterations and require further study.
Since the discovery that mutations in the X-linked methyl-CpG-binding protein 2 gene (MECP2) cause Rett syndrome (RTT) in 1:10,000 girls1, MECP2 mutations were described in females with RTT variants, Angelman-like phenotypes, isolated autism or mental retardation, learning disabilities, attention disorders, as well as in males with classic RTT, fatal infantile encephalopathy, mental retardation with movement disorders and/or epilepsy, and early onset psychosis including schizophrenia2-7. A MECP2 duplication syndrome was predicted by the observation that mice engineered to overexpress MECP2 develop a progressive neurological disorder, stereotyped and repetitive movements, epilepsy, spasticity, hypoactivity, and early death8. Human MECP2 duplications were initially identified in a girl with atypical RTT due to preserved speech, a boy with severe mental retardation and RTT features, males with mental retardation and progressive spasticity, and in members of three families with X-linked mental retardation9-12. Additional males with MECP2 duplications were reported in the past few years with the following common phenotypes: infantile hypotonia, severe to profound mental retardation, poor speech development, recurrent infections, epilepsy, and progressive spasticity13-15. While most of the reported cases are inherited, de novo cases have been documented15, 16. Autistic features were noted in three boys13, however, no objective characterization of neuropsychiatric phenotypes has been performed in males with MECP2 duplication and no objective clinical or psychiatric characterization has been performed for female carriers of MECP2 duplication.
There is considerable clinical overlap in patients with classic RTT and autism; in fact some girls with RTT meet formal autism criteria1. Specifically, stereotypic hand/body movements, anxiety, and social avoidance are examples of overlapping behavioral features2. Forepaw stereotypies, anxiety, and abnormalities in social interaction are present in a mouse model of RTT17 and mice that overexpress MECP2 also demonstrate forepaw stereotypies and abnormal behaviors8. Therefore, we hypothesized that MECP2 gain of function may also lead to specific autism spectrum behaviors in humans. Furthermore, since many carrier females of X-linked disorders manifest milder disease symptoms than affected males18, and because data demonstrate that MECP2 is one of the most dosage-sensitive genes involved in neuronal functional integrity8, 19-21, we also hypothesized that carrier females may manifest mild symptoms. Elucidating the specific behaviors and neuropsychiatric endophenotypes associated with MeCP2 dysfunction may shed light into the pathogenesis of autism and related neuropsychiatric disorders and help define novel research paths.
SUBJECTS
Eight families including 9 males (subjects 4 and 5 are brothers) and 9 females (7 carrier mothers, 1 carrier maternal aunt who had an affected son who is deceased, and 1 carrier maternal grandmother) with MECP2 duplication identified through clinical quantitative DNA methods and BAC-based chromosomal microarray analysis were referred to participate in our study between 2006 and 2008. This study was approved by the institutional review board for Baylor College of Medicine and affiliated hospitals. Written and verbal informed consent was obtained from all participants and/or their caregivers. Subjects were admitted to the General Clinical Research Center at Texas Children's Hospital. For each boy, a detailed history, physical examination, electroencephalogram (EEG), cognitive/developmental evaluation (using the Bayley Scales of Infant Development – 3, and the Vineland Adaptive Behavior Scales – 2)22, Autism Diagnostic Observation Schedule (ADOS)23, and Autism Diagnostic Interview – Revised (ADI-R)24 were performed. Clinical histories were also obtained for deceased male relatives who presumably inherited a MECP2 duplication from their carrier mother (documented prior to death in one instance). Carrier females completed the Symptom Checklist-90-R25, the Wechsler Abbreviated Scale of Intelligence26, the Broad Autism Phenotype Questionnaire27, and detailed medical and mental health histories. Each subject was examined by a board certified neurologist with special qualification in child neurology (H.Y.Z.) and all psychological testing was performed by a psychologist with research reliability in the ADOS and ADI-R (S.P.). EEGs were performed by trained professionals in the Texas Children's Hospital EEG laboratory and interpreted by board certified pediatric neurophysiologists.
Duplication size and genome content
To determine the size, extent, and gene content for each rearrangement, we designed a tiling path oligonucleotide microarray spanning 4 Mb around the MECP2 region on Xq28. The custom 4×44k Agilent Technologies microarray was designed using the Agilent website (http://earray.chem.agilent.com/earray/). We selected 8,323 probes covering ChrX: 150,400,000−154,400,000 (NCBI build 35), including the MECP2 gene, which represents an average resolution of 1 probe per each 500 bp. Probe labeling and hybridization were performed following the Agilent Oligonucleotide Array-based CGH for Genomic DNA analysis, version 4.0 protocol, plus the 4×44k complementary protocol with modifications unique to the four-pack format. Briefly, 1.5 μg of a single genomic male/female reference and patient DNA were digested with Alu I (5 U) and Rsa I (5 U) (Promega) for 2 hr at 37°C. Digestions were verified by agarose gel electrophoresis. Labeling reactions with Cy5-dUTP (patient DNA) and Cy3-dUTP (reference DNA) were performed according to the Agilent Genomic DNA Labeling Kit Plus, #5188−5309. Individual dye-labeled reference and patient samples were purified using Microcon YM-30 filters (Millipore Corporation). DNA yield was determined using a NanoDrop ND-1000 UV-VIS spectrophotometer. Each dye-labeled patient and gender-matched reference DNA was combined with 5 μg human Cot-1 DNA (Invitrogen Corporation), Agilent Blocking Agent, and Agilent hybridization buffer (#5188−5220). These mixtures were denatured at 95°C for 3 min, preincubated at 37°C for 30 min, and hybridized to the array in a hybridization chamber for 40 hr at 65°C in a rotating oven (Agilent Technologies). Array slides were washed using Agilent Wash solutions 1 and 2 (#5188−5226), Acetonitrile (Sigma-Aldrich), and Stabilization and Drying Solution (#5185−5979), according to the manufacturer's instructions. Slides were scanned on a GenePix 4000B Microarray Scanner (Axon Instruments). Images were analyzed and data were extracted, background subtracted, and normalized using Agilent Feature Extraction Software A.7.5.1. These data were subsequently imported into array CGH analytics software v3.1.28 (Agilent Technologies). The genomic copy number was defined by analysis of the normalized log2 (Cy5/Cy3) ratio average of the CGH signal, amid a 5 kb window. Regions that reached a threshold of at least 0.6 were considered as gains consistent with duplication, whereas thresholds of at least 1.2 were considered as triplication.
Quantitative real-time rt-pcr
Total RNA was extracted from immortalized lymphoblast cell lines from affected and control males and carrier and control females using TRIzol reagent (Invitrogen Corporation, Carlsbad, CA), DNaseI treated, and purified using the Rneasy mini kit according to the manufacturer's protocol (Qiagen, Valencia, CA). cDNA was synthesized from 0.5 μg of RNA using the RT2 First Strand Kit (SuperArray Bioscience Corporation, Frederick, MD). Quantitative real-time PCR reactions were performed on 25 ng of cDNA using TaqMan master mix, MECP2 primers (forward primer 5’AGACCGTACTCCCCATCAAGA, reverse primer 5’CACTTCCTTGACCTCGATGCT, and probe 5’-FAM-ACCGTCTCCCGGGTCTTGCGBHQ), IRAK1 primers (forward primer 5’GGCCTCAGCGACTGGACAT, reverse primer 5’GAAGGACGTTGGAACTCTTGATG, and probe 5’-FAMCCCGGGCAATTCAGTTTCTACATCAGG-BHQ), and commercially available human GAPDH primers (Applied Biosystems, Foster City, CA). All RNA samples were analyzed in triplicate and normalized relative to GAPDH levels.
Production of MeCP2 antibody 0535
The N-terminal MeCP2 antigen used to produce antibody 0535 consisted of a 60 kDa degradation product from a full length GST-mMeCP2 fusion protein expressed in BL-21 cells. The 60 kDa fragment was purified using GSH beads followed by SDS gel purification. The band was cut out and the protein was eluted, dialyzed, freeze dried, and injected into New Zealand White rabbits per standard protocol. The estimated dilution for probing westerns containing 1 μg of acid extract from HEK293T cells transfected with MECP2 or 40 μg of SDS extract from wild-type or MECP2 308 (a mutation that truncates the protein after amino acid 308) mouse cerebellum was 1/25,000 using ECL detection.
Western blot analysis
Proteins were isolated via acid extraction from confluent cultures of each immortalized human lymphoblast cell line. Briefly, 15 ml of confluent culture were harvested by centrifugation, washed with washing buffer [1X PBS, 1 mM PMSF, 10 mM sodium butyrate, complete protease inhibitor cocktail (Roche)], resuspended in 1 ml extraction buffer (0.4 N H2SO4, 10 mM sodium butyrate), and incubated on a rotating shelf at 4° C for 60 minutes. After centrifugation, proteins were precipitated by the addition of precipitation buffer (4 mg/ml sodium deoxycholic acid in 100% trichloroacetic acid) for 30 minutes on ice. After centrifugation, the pellet was washed with acidified acetone (0.1% HCl in acetone), then with regular acetone. The pellet was resuspended in water. Determination of the protein concentration was performed using the BCA assay (Thermo Fisher Scientific). 5 μg of total protein from each sample were used for Western blotting. Sample buffer (1X NuPAGE LDS sample buffer, Invitrogen) was added and the samples were boiled for 10 minutes. Proteins were run on NuPAGE Novex 4−12% Bis-Tris Gels (Invitrogen) and then transferred to PVDF membrane [NuPAGE transfer buffer (Invitrogen), 20% methanol]. Immunodetection was performed using the primary antibodies anti-MeCP2 (MeCP2 antibody 0535; 1:10,000) and anti-Histone H3 (Millipore #06−755, 1:10,000) as a loading control. Secondary antibodies were conjugated to HRP and detected by chemiluminescence. MeCP2 and histone H3 protein levels were quantified using ImageJ software (National Institutes of Health), and the total MeCP2 protein was normalized to the level of histone H3 protein detected for each subject.
X-chromosome inactivation studies
X-inactivation studies were performed based on the protocol described by Allen et al. with modification28. Briefly, 100 ng of genomic leukocyte DNA from each female (DNA from males was not treated) was digested with and without the methylation-sensitive restriction enzyme HpaII (New England Biolabs). PCR primers flanking the androgen receptor CAGn repeat region were designed as follows: 5’ACCAGGTAGCCTGTGGGGCCTCTACGATGGGC3’ (forward) and 5’CCAGAGCGTGCGCGAAGTGATCCAGAACCCGG3’ (reverse), and 0.5 ng DNA from each sample was subjected to PCR amplification. PCR products were analyzed on an ABI 3100 instrument with GeneMapper software.
Clinical summary of boys
Clinical data were gathered for nine males with a MECP2 duplication; these males ranged in age from 3−15 years (refer to Table 1). Family pedigrees are shown in Figure 1. All boys manifested abnormal tone best characterized as global hypotonia with 89% exhibiting progressive lower extremity spasticity (the boy who did not was only 3 years at the time of exam). Choreiform movements characterized by intermittent, spontaneous writhing movements of the arms, hands, and fingers that at times also involved the head and tongue were present in 89%; tremor was notably absent. Frequent respiratory infections and/or recurrent pneumonia occur in 78% and all deceased male relatives with presumed MECP2 duplication (three maternal uncles and a maternal first cousin of subject 3; and the brother of subject 2) succumbed to respiratory infections. Each of these deceased male relatives had epilepsy and 44% of our male subjects have epilepsy. Clinically, their seizures are partial onset with or without secondary generalization or generalized. Subject 3 also manifests a rare reflex generalized epilepsy triggered by feeding and confirmed by continuous video EEG monitoring in the epilepsy monitoring unit. Other common problems include: cryptorchidism (33%), bruxism (67%), abnormal breathing patterns characterized by grunting, aerophagia, or snoring (56%), sleep difficulties (33%), constipation requiring medical management (56%), and moderate to severe drooling (78%).
Table 1
Table 1
Clinical summary of boys with MECP2 duplication
Figure 1
Figure 1
Pedigrees for eight of the families included in this study. The pedigree for subject one is not included since he was adopted. Maternal subject numbers are purposefully excluded to preserve anonymity. Standard pedigree symbols are used.
All nine boys had one or more abnormal EEGs which were characterized by mild to moderate slowing of the background EEG activity, slowing of the occipital dominant rhythm, and/or absence of the occipital dominant rhythm. Paroxysmal rhythmic slow (theta) activity was recorded in the posterior regions of 4 boys. Typically, these abnormal findings are considered indicative of a diffuse disturbance in brain function. Two of the boys had epileptiform patterns characterized by either multifocal spike discharges or generalized spike and slow wave activity (subjects 1 and 6). Clinical (atonic) and EEG seizure discharges (multifocal) were recorded in subject 1.
Three of nine boys (33%) experienced developmental regression substantiated by using the ADI-R. In subjects 1 and 7, regression correlated with seizure onset and was unaffected by anti-seizure medication. Regression was global in subject 1 and included a marked loss of hand use. Subject 7 experienced loss of ambulation, speech, and hand use with gain of hand wringing. Subject 8 lost hand use and the few words that he had learned.
All of the boys had brain magnetic resonance imaging (MRI) performed in the past. There were no unifying brain MRI findings. Review of images and/or neuroradiology reports revealed normal imaging studies or mild, non-specific abnormalities including white matter changes such as thin corpus callosum, mild cerebral volume loss, and choroid plexus cyst.
Results of psychological evaluation of males
Eight of nine males with the MECP2 duplication syndrome completed formal evaluation of their cognitive/developmental skills. All of the boys (100%) exhibited cognitive abilities that fell within the severe to profound range of mental retardation. Their abilities did not seem to be dependent upon age, although 2 of the boys (subjects 1 and 7) were much more functional prior to developmental regression. Relative weaknesses were noted in expressive language for all patients. Table 2 provides a comparison of expressive and receptive language delays with respect to developmental abilities.
Table 2
Table 2
Quantification of developmental and autism phenotypes in boys with MECP2 duplication
Six of nine boys (67%) had prior diagnoses of autism and, in two cases (subjects 1 and 7), this diagnosis was made prior to developmental regression. All nine subjects were re-evaluated for the current study for the presence of autism using the ADOS (8/9) and the ADI-R (9/9). Seven of eight boys (88%) exceeded cutoff criteria scores for autism on the ADOS, and the eighth boy exceeded cutoff criteria for autism spectrum disorder (refer to Table 2). All nine boys (100%) exceeded threshold scores for autism on the ADI-R. Specifically, all of the subjects exhibited significant difficulties using eye gaze to modulate social interactions. The majority of the boys exhibited gaze avoidance and at times would actively avoid social interaction. Most of the boys did not initiate social contact and, if they did so, it revolved around their areas of restricted interest or served the function of directing the examiner's behavior. The majority used another person's hand as a “tool” to communicate “for” them (by directly placing the person's hand on the desired object). Although most of the boys are nonverbal, those who speak use language in a repetitive manner. One boy with significant developmental regression (subject 7) spoke in phrases prior to regressing, but exhibited considerable echolalia and used repetitive phrases (often quoting words/phrases from favorite videos). All of the boys exhibited a limited range of facial expression, as well as limited shared enjoyment in interactions. It is important to note that many of the boys enjoy specific toys and activities, but there was not a sense of true reciprocity in social interactions. Six of nine boys (67%) exhibited significant anxiety in response to certain noises and/or objects and also exhibited sensory interests/aversions. Several of the boys exhibited difficulty with transitions and fixated on objects/activities of interest to them. All of the boys examined exhibited stereotypies and repetitive behaviors including prevalent midline hand movements that varied only slightly among the boys. Rocking, spinning, and self-injurious behavior (typically biting hands or fingers when excited) were also prevalent.
Duplication size, gene content, and MECP2 rna and protein levels
The genomic regions duplicated in the boys range from 0.32 Mb to 0.71 Mb in size. The smallest region of overlap (SRO) is 231 kb and includes the MECP2 gene (Figure 2). Similar to previous reports, the SRO also includes the interleukin-1 receptor-associated kinase 1 (IRAK1) locus and part of the polymorphic Opsin array. The phenotypic severity of the males does not correlate to duplication size, confirming previous reports13-15. In fact, the core phenotypes of the disorder (mental retardation, autism, hypotonia with progressive lower extremity spasticity, hand stereotypies, and choreiform movements) are very consistent among this group of males. Slightly more variable phenotypes such as epilepsy and recurrent respiratory infections are highly expressive in the presence of the duplication and may be modulated by genetic background. We quantified MECP2 and IRAK1 mRNA levels in all of the affected boys and in three male controls and observed that the cells from boys with MECP2 duplication expressed two to six-fold more MECP2 mRNA and two to seven-fold more IRAK1 mRNA than cells from control males (Figure 3A). The level of mRNA expression observed does not correlate with disease severity in the boys. There was no difference in MECP2 or IRAK1 mRNA expression levels between carrier and control females (Figure 3B). We also quantified MeCP2 protein levels in all of the affected boys and in two male controls and observed that the cells from boys with MECP2 duplication produced approximately 1.5−1.7-fold more MeCP2 protein than cells from control males (Figure 4A and B). These data further support the conclusion that both MECP2 and IRAK1 are dosage-responsive genes in the Xq28 duplication syndrome.
Figure 2
Figure 2
Genomic region duplicated in subjects with MECP2 duplications determined by oligonucleotide array CGH. The smallest region of overlap (SRO) includes the MECP2 and IRAK1 genes and covers 231 kb. Solid red bars represent oligonucleotide probes for which (more ...)
Figure 3
Figure 3
Quantification of MECP2 and IRAK1 mRNA levels as measured by quantitative real-time PCR and normalized to GAPDH. A. MECP2 mRNA levels are 2 to 6 fold higher and IRAK1 mRNA levels are 2 to 7 fold higher in boys with Xq28 duplication compared to control (more ...)
Figure 4
Figure 4
Analysis of MeCP2 protein levels as measured by Western blot and normalized to histone H3. A. Western blot demonstrating MeCP2 protein (upper half of blot, MW ~64 kDa) and histone H3 protein (lower half of blot, MW ~17 kDa) levels in boys (more ...)
Clinical summary of carrier females
Clinical data were gathered for nine female MECP2 duplication carriers ranging in age from 34−64 (refer to Table 3). Several common features were identified. Five of the women endured abnormal menstrual cycles (56%) with four of five of these women describing a lifelong history of irregular periods. The fifth woman described heavy menses. Three of the four women with irregular menstrual cycles experienced premature menopause (prior to age 40) and the fourth woman (age 34) is experiencing clinical symptoms of impending premature menopause (hot flashes, hair and skin changes). Endocrine and autoimmune disorders are also prevalent in these subjects. Two of the women have adult onset diabetes (subjects 11 and 16) and subject 10 was told by her physician that she is in a “pre-diabetic state.” Subject 11 is the mother of subjects 10 and 16 and all three of these women also have hypothyroidism. Interestingly, these women are represented in the group with abnormal menstrual cycles and premature menopause. A fourth woman carries the diagnoses of hypothyroidism, Sjogrens disease, and fibromyalgia.
Table 3
Table 3
Clinical summary of females with MECP2 duplication
Results of psychological evaluation of carrier females
Eight of the women completed a psychiatric history and the Symptom Checklist 90-R, seven subjects completed the Broad Autism Phenotype Questionnaire, and seven completed cognitive testing (refer to Table 3). The results revealed that 50% of the women were treated for depression prior to the birth of a child with MECP2 duplication. All eight women endorsed symptoms of anxiety; for 75%, anxiety was present prior to the birth of the affected child. Five of the women use psychiatric medications and a sixth subject requires a beta blocker. All of the women manifest compulsive behaviors (e.g. a strong need for structure, routine, cleaning, and ordering). Results of the Symptom Checklist 90-R revealed clinically important elevations in the following areas: somatization (63%), interpersonal sensitivity (63%), anxiety (63%), hostility (63%), psychoticism (75%), and global distress (63%). The Broad Autism Phenotype Questionnaire identified elevations in the areas of rigid personality (100%), pragmatic language deficits (57%), and aloof personality (43%). Four of seven subjects (57%) exceeded the overall cutoff score for the broad autism phenotype (BAP). The results of cognitive testing revealed a broad range of scores. Specifically, two subjects scored in the low average range, two scored in the average range, one scored in the high average range, and two scored in the superior range of intelligence. Of note is that 71% achieved significantly higher nonverbal as compared to verbal reasoning skills (p < 0.05). The clinical relevance of this finding is that these women also exhibited difficulties with language pragmatics (i.e. the social use of language).
Results of X-chromosome inactivation studies
Leukocyte DNA from nine carrier females was tested for X-chromosome inactivation (XCI) status. Eight of the females had nearly 100% skewing of XCI in peripheral blood and one sample was non-informative (Figure 5). The fact that all of the carrier females expressed wild-type levels of MECP2 and IRAK1 mRNA suggests that the abnormal duplication bearing X chromosome was preferentially inactivated in peripheral blood.
Figure 5
Figure 5
X-chromosome inactivation (XCI) patterns in females with MECP2 duplication. Panel A demonstrates control DNA with random XCI; Panel B demonstrates control DNA with 100% skewed XCI; The remaining panels demonstrate DNA from MECP2 duplication carriers with (more ...)
All nine boys with the MECP2 duplication syndrome exhibited features consistent with those observed in children with idiopathic autism including difficulties with eye gaze, limited shared enjoyment in interactions, limited range of facial expression, the use of another person's hand as a tool to communicate, several unusual sensory interests and aversions, and repetitive behaviors and interests. Anxiety was also prevalent. The language of the boys who speak consisted largely of repetitive word use. These behaviors cannot be fully accounted for by significant cognitive and language delays since typically developing infants acquire social communication milestones (e.g. a responsive social smile, gaze monitoring) that were not present in these boys. It is also important to note that these behaviors were quite prevalent, regardless of the functional level of the patient. For example, the higher functioning boys (subjects 1, 5, 7, and 8) exhibited significant symptoms of autism and their symptoms were even more prominent (related to anxiety, gaze avoidance, restricted interests, and use of repetitive language). In addition to autism and mental retardation, the majority of boys in our sample also manifest hypotonia with lower extremity spasticity, recurrent respiratory infections, hand sterotypies, choreiform movements, aerophagia, drooling, bruxism, and epilepsy.
All of the female MECP2 duplication carriers exhibited phenotypic changes despite favorable skewing of XCI. They exhibited psychiatric symptoms (anxiety, depression, compulsions) that preceded the birth of their children. They all exhibited less flexible personality traits, and the majority met formal criteria for the broad autism phenotype. Although cognitive abilities varied, most of the women exhibited higher nonverbal reasoning as compared to verbal reasoning skills.
In aggregate, phenotypic findings from the boys and the female carriers suggest that gain of MeCP2 function contributes to certain behaviors associated with autism and the BAP. This is evident with regard to repetitive behaviors in the boys and compulsions in the female carriers, anxiety, rigidity, and difficulties with the functional use of language for social purposes. The BAP is the milder expression of underlying genetic liability for autism and associated neuropsychiatric symptoms that are manifest in non-autistic relatives29. It is an intermediate phenotype that refers to personality and language characteristics that reflect the phenotypic expression of this genetic liability29. Utilizing family history and direct observational methods, researchers found that parents of children with autism are more likely to have inflexible personalities, to exhibit difficulty with transitions, to be aloof, blunt, anxious, and hypersensitive to criticism, and to have fewer high quality friendships compared to control parents of children with Down Syndrome30, 31. These characteristics parallel the social communication deficits and the repetitive/stereotypic behaviors observed in children with autism.
Our data also suggest that menstrual irregularities, premature menopause, and endocrine and/or autoimmune disease may be more prevalent in female duplication carriers. It is possible that MeCP2 contributes to these phenotypes via methylation sensitive estrogen or progesterone responsive elements. Alternatively, the IRAK1 protein has been postulated to have a role in the regulation of autoimmunity32 and may contribute to these phenotypes. Others have suggested that increased IRAK1 dosage may contribute to the recurrent infection phenotype in affected boys15, a hypothesis that warrants further investigation.
Clinically, the high prevalence of sterotyped and repetitive behaviors (commonly manifested by midline hand movements), breathing abnormalities, epilepsy, hypotonia, autism, mental retardation, and anxiety in our series suggests that Rett syndrome and the MECP2 duplication syndrome are more similar than previously suspected. Of note, the EEGs of the boys with MECP2 duplication were less abnormal than girls with RTT and MECP2 mutations. For example, by age three most girls with RTT have EEGs characterized by epileptiform abnormalities and background activity that is moderately to severely slow in contrast to these boys33. Longitudinal studies of the EEG in these boys may reveal a characteristic EEG pattern. Longitudinal studies have shown that girls with RTT undergo typical clinical and developmental changes with time; similar longitudinal studies of boys with MECP2 duplication will provide important prognostic information.
The fact that loss and gain of MeCP2 function lead to very similar and predominantly neurological syndromes indicates that tight regulation of MECP2 is critical for the appropriate development and maintenance of neuronal function21. Furthermore, the fact that female MECP2 duplication carriers manifest the BAP supports the hypothesis that MeCP2 participates in dosage-sensitive neuronal pathways which directly influence the phenotypic expression of autism spectrum behaviors. Interestingly, hemizygous male mice that express twice the endogenous level of Mecp2 have significant anxiety and manifest abnormal social interaction, suggesting that this transgenic mouse model reproduces the autism phenotype observed in the boys (Samaco and Zoghbi, unpublished data). The neurobiology of MeCP2 function suggests that the protein has an essential role in fine-tuning gene expression changes in response to neuronal activity. For example, phosphorylation of MeCP2 at S421 occurs in response to neuronal activity and is necessary for MeCP2 to modulate dendritic growth and spine maturation34, and MeCP2 regulates the expression of Bdnf, an activity dependent gene34-36. The Mecp2308/y Rett syndrome mouse model demonstrates exaggerated physiological responses to stress manifested by heightened anxiety and increased corticosterone levels37. The Crh gene is a direct target of MeCP2, and altered Crh expression occurs only in brain regions where it is normally expressed37. These data reinforce the hypothesis that MeCP2 is a modulator of neuronal function and suggest that failure of MeCP2 to appropriately modulate internal and external stimuli at the molecular level may underlie the BAP and autism phenotypes observed in our subjects.
The observation that MECP2 duplication may lead to neuropsychiatric symptoms in women despite nearly 100% skewing of XCI and wild-type expression levels in peripheral blood is interesting. Perhaps duplication of the IRAK1 gene, an important kinase in the Toll-like receptor signaling pathway32, results in selective survival of cells with wild-type XCI patterns in blood but not in brain. It is also possible that extreme skewing of X-inactivation itself contributes to the observed phenotypes. The women in our study may have some neurons expressing the duplicated allele throughout the brain, in specific brain regions or nuclei, or during specific developmental periods, and one can imagine that even small MECP2 dosage increases in certain brain regions may lead to mild changes in gene expression or synapse number and the mild neuropsychiatric and cognitive phenotypes observed. We cannot exclude the possibility that other additive environmental or genetic factors also contribute to the phenotypes observed in carrier females. Heterozygous, transgenic, female mice with MECP2 duplication express lower levels of MeCP2 protein than hemizygous males likely due to XCI, yet they still manifest neurological phenotypes8. Conditional knock-out of MECP2 from Sim1-expressing neurons in the mouse hypothalamus led to mice with abnormal responses to stress, abnormal aggressive behavior, hyperphagia, and obesity providing a precedent for the idea that altered MECP2 dosage in discrete brain regions can be sufficient to cause significant biological phenotypes38.
The data presented in this study reveal that the full extent of neuropsychiatric phenotypes resulting from MeCP2 dysfunction is not yet appreciated and awaits large-scale studies searching for non-conventional mutations in large cohorts of subjects with neuropsychiatric disorders and appropriate controls. Recent mouse data suggest that even a 50% reduction in MeCP2 dosage is sufficient to cause neurological phenotypes and predict that human patients with mild reductions in MeCP2 protein exist20. Subtle alteration of MeCP2 levels (decrease or increase) is likely to result from non-coding mutations that might alter transcription, mRNA stability, or translation. Some hypomorphic coding region mutations might also affect protein stability or protein-protein interactions. Given the detrimental developmental effects of MECP2 duplication, we predict that mutations that slightly enhance MeCP2 function will also cause neuropsychiatric phenotypes. The fact that autism is penetrant in 100% of boys in this cohort suggests that MECP2 duplication should be added to the several dozen other rare causes of syndromic autism, and suggests that MECP2 gain of function may be another excellent autism model. Males with the appropriate phenotype should be tested for MECP2 duplication, and since the duplication appears to be inherited frequently from carrier mothers, genetic counseling should be offered to the family.
Acknowledgements
We thank the women, children, and their families who participated in this study, Dr. Jeffrey Neul for visiting with subjects and their families and for helpful discussions, Alanna McCall for technical assistance, and Drs. Maria Chahrour and Sau Wai Cheung for helpful advice. This study was supported in part by NIH/NINDS grants 1R01 NS057819−01 (H.Y.Z.), T32 NS43124 and 1K08NS062711−01 (M.B.R.), NIH General Clinical Research Center grant RR000188, and Thrasher Research Fund award NR-0017 (C.M.B.C.). The content is solely the responsibility of the authors and does not necessarily represent the official views of NINDS or the National Institutes of Health.
Footnotes
Disclosure: Some of the authors are based in the Department of Molecular and Human Genetics at Baylor College of Medicine which offers extensive genetic laboratory testing including use of arrays for genomic copy number analysis and derives revenue from this activity.
1. Amir RE, Van den Veyver IB, Wan M, et al. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nature genetics. 1999;23:185–188. [PubMed]
2. Moretti P, Zoghbi HY. MeCP2 dysfunction in Rett syndrome and related disorders. Current opinion in genetics & development. 2006;16:276–281. [PubMed]
3. Carney RM, Wolpert CM, Ravan SA, et al. Identification of MeCP2 mutations in a series of females with autistic disorder. Pediatric neurology. 2003;28:205–211. [PubMed]
4. Couvert P, Bienvenu T, Aquaviva C, et al. MECP2 is highly mutated in X-linked mental retardation. Hum Mol Genet. 2001;10:941–946. [PubMed]
5. Meloni I, Bruttini M, Longo I, et al. A mutation in the rett syndrome gene, MECP2, causes X-linked mental retardation and progressive spasticity in males. American journal of human genetics. 2000;67:982–985. [PubMed]
6. Orrico A, Lam C, Galli L, et al. MECP2 mutation in male patients with non-specific X-linked mental retardation. FEBS letters. 2000;481:285–288. [PubMed]
7. Neul JL, Zoghbi HY. Rett syndrome: a prototypical neurodevelopmental disorder. Neuroscientist. 2004;10:118–128. [PubMed]
8. Collins AL, Levenson JM, Vilaythong AP, et al. Mild overexpression of MeCP2 causes a progressive neurological disorder in mice. Hum Mol Genet. 2004;13:2679–2689. [PubMed]
9. Ariani F, Mari F, Pescucci C, et al. Real-time quantitative PCR as a routine method for screening large rearrangements in Rett syndrome: Report of one case of MECP2 deletion and one case of MECP2 duplication. Hum Mutat. 2004;24:172–177. [PubMed]
10. Meins M, Lehmann J, Gerresheim F, et al. Submicroscopic duplication in Xq28 causes increased expression of the MECP2 gene in a boy with severe mental retardation and features of Rett syndrome. Journal of medical genetics. 2005;42:e12. [PMC free article] [PubMed]
11. Van Esch H, Bauters M, Ignatius J, et al. Duplication of the MECP2 region is a frequent cause of severe mental retardation and progressive neurological symptoms in males. American journal of human genetics. 2005;77:442–453. [PubMed]
12. Lugtenberg D, de Brouwer AP, Kleefstra T, et al. Chromosomal copy number changes in patients with non-syndromic X linked mental retardation detected by array CGH. Journal of medical genetics. 2006;43:362–370. [PMC free article] [PubMed]
13. del Gaudio D, Fang P, Scaglia F, et al. Increased MECP2 gene copy number as the result of genomic duplication in neurodevelopmentally delayed males. Genet Med. 2006;8:784–792. [PubMed]
14. Friez MJ, Jones JR, Clarkson K, et al. Recurrent infections, hypotonia, and mental retardation caused by duplication of MECP2 and adjacent region in Xq28. Pediatrics. 2006;118:e1687–1695. [PubMed]
15. Smyk M, Obersztyn E, Nowakowska B, et al. Different-sized duplications of Xq28, including MECP2, in three males with mental retardation, absent or delayed speech, and recurrent infections. Am J Med Genet B Neuropsychiatr Genet. 2007 [PubMed]
16. Clayton-Smith J, Walters S, Hobson E, et al. Xq28 duplication presenting with intestinal and bladder dysfunction and a distinctive facial appearance. Eur J Hum Genet. 2008
17. Shahbazian M, Young J, Yuva-Paylor L, et al. Mice with truncated MeCP2 recapitulate many Rett syndrome features and display hyperacetylation of histone H3. Neuron. 2002;35:243–254. [PubMed]
18. Dobyns WB. The pattern of inheritance of X-linked traits is not dominant or recessive, just X-linked. Acta Paediatr Suppl. 2006;95:11–15. [PubMed]
19. Chao H-C ZH, Rosenmund C. MeCP2 controls excitatory synaptic strength by regulating glutamatergic synapse number. Neuron. 2007:55. [PMC free article] [PubMed]
20. Samaco RC, Fryer JD, Ren J, et al. A partial loss of function allele of Methyl-CpG-Binding Protein predicts a human neurodevelopmental syndrome. Hum Mol Genet. 2008 [PMC free article] [PubMed]
21. Ramocki MB, Zoghbi HY. Failure of neuronal homeostasis results in common neuropsychiatric phenotypes. Nature. 2008;455:912–918. [PMC free article] [PubMed]
22. Bayley N. Bayley Scales of Infant Development – Third Edition. Psychological Corporation; San Antonio, TX: 2006.
23. Lord C, Rutter M, DiLavore PC, Risi S. Autism Diagnostic Observation Schedule. Western Psychological Corporation; Los Angeles, CA:
24. LeCouteur A, Lord C, Rutter M. Autism Diagnostic Interview – Revised. Western Psychological Corporation; Los Angeles, CA: 2005.
25. DeRogatis L. Symptom Checklist-90-R. Pearson Assessments; Minneapolis, MN: 1993.
26. Wechsler D. Wechsler Abbreviated Scale of Intelligence. Psychological Corporation; San Antonio, TX: 1999.
27. Hurley RS, Losh M, Parlier M, et al. The broad autism phenotype questionnaire. Journal of autism and developmental disorders. 2007;37:1679–1690. [PubMed]
28. Allen RC, Zoghbi HY, Moseley AB, et al. Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X chromosome inactivation. American journal of human genetics. 1992;51:1229–1239. [PubMed]
29. Losh M, Piven J. Social-cognition and the broad autism phenotype: identifying genetically meaningful phenotypes. Journal of child psychology and psychiatry, and allied disciplines. 2007;48:105–112. [PubMed]
30. Piven J, Palmer P. Psychiatric disorder and the broad autism phenotype: evidence from a family study of multiple-incidence autism families. The American journal of psychiatry. 1999;156:557–563. [PubMed]
31. Bolton PF, Pickles A, Murphy M, Rutter M. Autism, affective and other psychiatric disorders: patterns of familial aggregation. Psychological medicine. 1998;28:385–395. [PubMed]
32. Gottipati S, Rao NL, Fung-Leung WP. IRAK1: a critical signaling mediator of innate immunity. Cellular signalling. 2008;20:269–276. [PubMed]
33. Glaze DG. Neurophysiology of Rett syndrome. Journal of child neurology. 2005;20:740–746. [PubMed]
34. Zhou Z, Hong EJ, Cohen S, et al. Brain-specific phosphorylation of MeCP2 regulates activity-dependent Bdnf transcription, dendritic growth, and spine maturation. Neuron. 2006;52:255–269. [PubMed]
35. Martinowich K, Hattori D, Wu H, et al. DNA methylation-related chromatin remodeling in activity-dependent BDNF gene regulation. Science (New York, N.Y. 2003;302:890–893. [PubMed]
36. Chahrour M, Jung SY, Shaw C, et al. MeCP2, a key contributor to neurological disease, activates and represses transcription. Science (New York, N.Y. 2008;320:1224–1229. [PMC free article] [PubMed]
37. McGill BE, Bundle SF, Yaylaoglu MB, et al. Enhanced anxiety and stress-induced corticosterone release are associated with increased Crh expression in a mouse model of Rett syndrome. Proceedings of the National Academy of Sciences of the United States of America. 2006;103:18267–18272. [PubMed]
38. Fyffe SL, Neul JL, Samaco RC, et al. Deletion of Mecp2 in Sim1-expressing neurons reveals a critical role for MeCP2 in feeding behavior, aggression, and the response to stress. Neuron. 2008;59:947–958. [PMC free article] [PubMed]