PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jbacterPermissionsJournals.ASM.orgJournalJB ArticleJournal InfoAuthorsReviewers
 
J Bacteriol. 2010 January; 192(1): 346–355.
Published online 2009 October 23. doi:  10.1128/JB.01038-09
PMCID: PMC2798260

Structure and Regulation of the gab Gene Cluster, Involved in the γ-Aminobutyric Acid Shunt, Are Controlled by a σ54 Factor in Bacillus thuringiensis[down-pointing small open triangle]

Abstract

The structure and regulation of the gab gene cluster, involved in γ-aminobutyric acid (GABA) shunt, were studied by characterizing gabT and gabD genes cloned from Bacillus thuringiensis. Deletions of the gabT and gabD genes in B. thuringiensis strain HD-73 did not affect the growth of mutant strains in rich culture media, but the growth of a gabT deletion mutant strain was reduced in basic media (containing 0.2% GABA). Genome analysis indicates that the structure of the gab gene cluster in B. thuringiensis HD-73 is different from that in Escherichia coli and Bacillus subtilis but is common in strains of the Bacillus cereus group. This suggests that the gene cluster involved in GABA shunt is specific to the B. cereus group. Based on reverse transcription-PCR and transcriptional fusion analysis, we confirmed that the gabT and gabD genes belong to different transcriptional units, while the gabD and gabR genes form an operon. We also demonstrated that the gabR gene plays a positive regulatory role in gabD and gabT expression. The GabR protein may be a σ54-dependent transcriptional activator, according to a conserved domain search in the NCBI database, and it is highly conserved in the B. cereus group. The −24/−12 consensus sequence of a promoter upstream from gabT suggests that the promoter can be recognized by a σ54 factor. Further analysis of the genetic complementation studies also suggests that the expression of the gabT gene is controlled by a σ54 factor. Thus, the expression of the gab cluster is regulated by a σ54 factor by way of the transcription activator GabR.

γ-Aminobutyric acid (GABA) is a four-carbon, nonprotein amino acid that is ubiquitous in most prokaryotic and eukaryotic organisms. GABA is produced by the cytosolic enzyme glutamate decarboxylase and is degraded by the enzymes γ-aminobutyrate aminotransferase (GABA AT; EC 2.6.1.19) and succinate semialdehyde dehydrogenase (SSADH; EC 1.2.1.16). The action of these three enzymes combined defines a short pathway known as the GABA shunt, which can channel glutamate into the tricarboxylic acid (TCA) cycle, bypassing two steps of that cycle (10).

The GABA shunt has distinct physiological functions in different organisms. In mammals, the GABA shunt is associated with the functions of the inhibitory neurotransmitter GABA in regulating ion channels through GABA receptors (24). In plants, the GABA shunt is involved in pH regulation, nitrogen storage, plant development, and defense, as well as being a compatible osmolyte and an alternative pathway for glutamate utilization (12, 20, 30, 44). Recent findings suggest that GABA has a role as a signal molecule in plant development as well (9, 13, 41). The study of the GABA shunt in animals and plants is still very active (2, 14, 20, 36), but the biological functions of the GABA shunt and its metabolites in bacteria, particularly Bacillus sp., are less clear. GABA was found to act as a germinant for Bacillus megaterium spores (21). Moreover, the GABA shunt has been confirmed to have some relationship to the formation of crystals and spores in Bacillus thuringiensis by enzymatic analyses (5, 32, 46).

The genes involved in the GABA degradation pathway usually exist in the form of a gab gene cluster in bacteria (28). But the structure of the gab cluster varies in organisms. For example, in Bacillus subtilis, two genes, gabT (encoding γ-aminobutyrate aminotransferase), and gabD (encoding succinate semialdehyde dehydrogenase), form an operon, while transcription is regulated by a divergent gene, gabR (8). In Escherichia coli, the csiD-ygaF-gabDTP gene cluster, which is involved in GABA metabolism, forms a complex operon controlled by the σS factor (6, 33, 40). In the Bacillus cereus group, the gabT and gabD genes are separated by a gene annotated as a sigma54 (also known as sigL, or σ54)-dependent transcriptional regulator gene (15, 22). This suggested that the regulatory mechanism of the GABA shunt in the B. cereus group might be different from that in other bacteria. Until now, little research has been done on the structure and transcription regulation of the gab gene cluster in the B. cereus group, and there have been no reports of studies on the GABA shunt at the DNA level.

Sigma factors are subunits of bacterial RNA polymerase holoenzymes responsible for recognition of promoters. Based on structural and functional criteria, the different sigma factors identified in bacteria can be grouped into two classes. Many sigma factors belong to the σ70 class, the major sigma factor which is involved in expression of most genes during exponential growth. It directs the RNA polymerase holoenzyme to a specific class of promoter sequence with different consensuses in the −35 and −10 regions. Among the sigma family members, σ54 is a unique factor (27), which differs both in amino acid sequence and in transcription mechanism from the σ70 class. It recognizes particular promoters with a consensus sequence localized at positions −24/−12 from the transcription start site, and it requires activator proteins (11) to initiate transcription. These activators, referred to as σ54-associated activators, share a conserved central domain, which is already used to identify new protein members of this family. The first σ54 factor described for Gram-positive bacteria is encoded by sigL in B. subtilis (16). We found that the regulator gene of the GABA shunt contains a −24/−12 σ54 factor-recognized site in B. thuringiensis, suggesting that the σ54 factor may regulate the GABA shunt in B. thuringiensis.

In a previous work, we cloned and characterized two genes, gabT and gabD, from B. thuringiensis (47). In this paper, we focus on analysis of the structure and regulation of the gab gene cluster involved in the GABA shunt in B. thuringiensis. We report that gabT and gabD are not cotranscribed, and the results suggest that a σ54 factor controls the expression of gabT by allowing the transcription of the gabR gene encoding the transcriptional activator GabR.

MATERIALS AND METHODS

Bacterial strains, plasmids, and media.

The bacterial strains and plasmids used in this study are listed in Table Table1.1. E. coli JM110 was used for cloning, while SCS110 was used to produce nonmethylated plasmid DNA for B. thuringiensis transformation (45).

TABLE 1.
Strains and plasmids used in this study

E. coli was incubated at 37°C in Luria-Bertani (LB) medium (1% NaCl, 1% tryptone, and 0.5% yeast extract). B. thuringiensis strains were grown at 30°C in peptone-beef extract (PB) medium (0.5% peptone, 0.3% beef extract, pH 7.2) or in basal medium (BM) supplemented with 0.2% (wt/vol) GABA as the sole nitrogen source (31). Antibiotic concentrations for bacterial selection were as follows: ampicillin, 100 μg/ml (for E. coli); erythromycin, 6 μg/ml (for B. thuringiensis); and kanamycin, 50 μg/ml (for B. thuringiensis). X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside) was included in the medium at a final concentration of 20 μg/ml for detection of β-galactosidase activity on solid agar plates.

Taq DNA polymerase and KOD DNA polymerase were purchased from New England Biolabs Ltd. (Beijing, China), and restriction enzymes were purchased from Takara Biotechnology Corporation (Dalian, China). T4 DNA ligase was bought from Invitrogen Inc. (Beijing, China). PCR product purification kits were purchased from TianGen Inc. (Beijing, China).

GABA, succinic semialdehyde (15% [vol/vol] aqueous solution), pyrophosphate, tetrapotassium pyrophosphate, and β-mercaptoethanol were purchased from Sigma. α-Ketoglutarate, NAD+, and NADP+ were purchased from Roche. l-Glutathione (reduced) was purchased from Biosharp, Japan. Other chemicals were from Beijing KeHaoDa Biotechnology Co., Ltd.

DNA manipulation techniques.

Methods for plasmid isolation, agarose gel electrophoresis, use of restriction and DNA modification enzymes, DNA ligation, PCR, and electroporation of E. coli cells were as described by Sambrook et al. (37). Isolation of DNA and transformation of B. thuringiensis cells by plasmid DNA were performed as described previously (26). All primers used in this study are listed in Table Table2.2. All cloned PCR-generated fragments were verified by sequencing. A DIG High Prime DNA labeling and detection starter kit (Boehringer Mannheim) (for chemiluminescence detection with CSPD [disodium 3-(4-methoxyspiro{l,2-dioxetane-3,2′-(5′-chloro)tricyclo[3.3.1.13.7]decan}-4-yl)phe- nyl phosphate]) was used for labeling of DNA and detection by Southern blotting, according to protocols provided by the manufacturer, Roche Diagnostics Ltd. (Shanghai, China).

TABLE 2.
Sequences of oligonucleotide primers used in this study

Enzyme assays. (i) GABA AT activity assay.

The bacteria were cultured in Schaeffer's sporulation medium (SM) at 30°C (39), harvested by centrifugation, and washed twice with 10 mM NaCl-10 mM sodium phosphate (pH 7.0). The cells were resuspended in 20 mM sodium phosphate buffer containing 0.1 mM pyridoxal-5-phosphate (PLP), 5 mM EDTA, 1 mM phenylmethylsulfonyl fluoride (PMSF) (pH 7.0), and 10% (vol/vol) glycerol and lysed by Fast Prep (4°C; intensity, 4.5; time, 40 s), provided by the manufacturer (Biospec Products, Inc., Bartlesville, OK). Cell debris was removed by centrifugation (16,000 × g, 10 min, 4°C). We then added 20 to 40 μl of supernatant (from lysis of B. thuringiensis cells) to a glass with 1 ml Bio-Rad protein kit dilution solution (1/4), calculated the optical density at 595 nm (OD595), and assayed for protein concentration. GABA AT activity in the supernatant was determined using a modified method of continuous spectrophotometric rate determination as described by Bartsch et al. (6).

(ii) SSADH activity assay.

The bacteria were cultured and collected as described above. The cells were resuspended in 100 mM sodium phosphate buffer containing 10% (vol/vol) glycerol, 1 mM EDTA, 1 mM dithiothreitol (DTT), and 1 mM PMSF (pH 7.0) and disrupted by Fast Prep (4°C; intensity, 4.5; time, 40 s). Cell debris was removed by centrifugation for 30 min at 16,000 × g and was used in the enzyme assay. Protein concentration was determined as described above. The NAD+/NADP+-dependent SSADH activity assay was carried out by measuring the reduction of NAD/NADP to NADH/NADPH with a spectrophotometer at 340 nm (6).

(iii) β-Galactosidase assays.

B. thuringiensis strains containing lacZ transcriptional fusions were cultured in SM at 30°C and 220 rpm (39). Samples of 2.0 ml were taken at 1-h intervals until late sporulation. Cells were harvested by centrifugation in a 2-ml tube (for fast prep) for 1 min at 10,000 × g, and the supernatant was eliminated. We then added 500 μl buffer Z (with 0.5 mM β-mercaptoethanol) to the sediments at 4°C. Cell lysis and protein assay were performed as described above. The β-galactosidase specific activities were determined as previously described and expressed as Miller units per milligram of protein (29). The values reported represent averages from at least three independent assays.

Cloning of gab gene cluster region and computer analyses.

All of the primers used for this study were designed according to the available genome sequences of B. thuringiensis serovar konkukian strain 97-27 (22). DNA and protein homology analyses were conducted with the standard alignment program Clustal W, and the analysis of their phylogenetic relationships was performed using the program MEGA (molecular evolutionary genetics analysis) 3.1 (25).

A 6,232-bp PCR product corresponding to part of the gab gene cluster was synthesized using B. thuringiensis HD-73 chromosomal DNA as the template and primers hpF and gabDR and was inserted into pMD18-T. The resulting plasmid, pMD18-HD, was verified by sequencing. The sequence of the PCR product was analyzed by BLASTN search of the National Center for Biotechnology Information (NCBI) database.

Construction of gabT, gabD, and gabR deletion mutants.

The DNA fragments corresponding to downstream and upstream regions of the gabT gene were amplified by PCR, using chromosomal DNA from B. thuringiensis HD-73 as the template and gabT-a/gabT-d and gabT-b/gabT-c as primers (Table (Table2),2), respectively. The corresponding DNA fragments were fused by overlapping PCR, using gabT-a and gabT-b as the primers. The PCR products then were digested with BamHI-EcoRI. The digested fragments were purified and ligated with the temperature-sensitive suicide plasmid pMAD (4), which was treated with the same enzymes, to give recombined plasmid pMADΩDgabT. The recombinant plasmid was transformed into host strains by electroporation at 11 kV/cm, 1,000 V, and 25 μF. In-frame deletion of the gene in B. thuringiensis was carried out following a modification of a previously described procedure (4). One verified transformant was cultured at 39°C to 41°C. Colonies with no erythromycin resistance were selected, and one mutant strain, HD(ΔgabT), was verified by PCR and Southern blotting.

The primers gabD-a/gabD-d/gabD-b/gabD-c and gabR-a/gabR-d/gabR-b/gabR-c were used to construct gabD and gabR deletion mutation cassettes. These were integrated into pMAD to generate pMADΩDgabD and pMADΩDgabR, respectively. The corresponding deletion mutants, HD(ΔgabD) and HD(ΔgabR), were selected and confirmed by PCR and Southern blotting.

Genetic complementation of gabT, gabD, and gabR deletion mutants.

The oligonucleotide primers gabTF/gabTR and gabDF/gabDR were used to amplify the gabT and gabD genes, respectively. The amplified and BamHI-SalI-digested gabT or gabD gene was inserted into SalI- and BamHI-digested plasmid pSTK containing a cry3A promoter (23). The resulting plasmids, pSTKΩHFgabT and pSTKΩHFgabD, were introduced into the gabT and gabD deletion mutants, respectively. The genetic complementation strains HD(ΔgabT::gabT) and HD(ΔgabD::gabD) were obtained by PCR identification.

The gabR gene with its own promoter fragment was cloned with the specific primers HFgabRF and HFgabRR and then integrated into shuttle vector pHT315 (3) to generate pHTHFgabR. The genetically complemented mutant HD(ΔgabR::gabR) was obtained by introducing pHTHFgabR into a gabR deletion mutant.

Construction of sigL disruption mutant.

The disruption strategy of insertional inactivation via double crossover was selected to study the function of sigL. All primers were designed according to the sequences of sigL from B. thuringiensis 97-27 and the kanamycin resistance gene (Kan) from pDG780 (34). Primers sigL-a and sigL-c were used to amplify the 540-bp upstream fragment of sigL (fragment A), primers sigL-b and sigL-d were used to amplify the 462-bp downstream fragment of sigL (fragment B) from B. thuringiensis HD-73, and primers Km-a and Km-b were used to amplify Kan (1,473 bp) from pDG780. Fragment A and Kan were ligated together by overlapping PCR using primers sigL-a and Km-b. The amplification product was then integrated with fragment B by another round of overlapping PCR, using sigL-a and sigL-b. The resulting fragment, containing sigL::Kan (2,475 bp), was inserted into the BamHI-EcoRI sites of vector pMAD to generate pMADΩsigL::Kan. The recombinant plasmid was then electroporated into HD-73. The confirmed transformant was inoculated onto LB containing kanamycin and erythromycin at 30°C and then incubated at 40°C. The transformants were screened for a Kanr Erms phenotype and identified using PCR, and one mutant strain, HD(ΔsigL), was confirmed by Southern blotting.

Complementation of sigL disruption mutant.

The primers sigL-F and sigL-b were used to amplify the sigL gene together with its upstream putative promoter fragment (2,048 bp) from HD-73 genomic DNA. After digestion with BamHI and EcoRI, the PCR product was ligated into the BamHI-EcoRI sites of pHT315 to give pHTHFsigL. The complemented mutant, HD(ΔsigL::sigL), was obtained by introducing pHTHFsigL into the sigL mutant.

Construction of gabT and gabR promoter fusions.

The putative promoter fragment gabTp (687 bp) was cloned from B. thuringiensis HD-73 genomic DNA by using the specific primers gabTp-F (with 5′ HindIII site) and gabTp-R (with 3′ BamHI site), designed according to the genomic sequence of B. thuringiensis 97-27. The HindIII-BamHI fragment of gabTp was then integrated into the vector pHT304-18Z, harboring a promoterless lacZ gene (1). The recombinant plasmid pHTgabTp was introduced into HD-73 and the sigL and gabR mutants. The corresponding strains, HD(gabTp-lacZ), HDΔsigL(gabTp-lacZ), and HDΔgabR(gabTp-lacZ), were isolated based on resistance to erythromycin and were confirmed by PCR identification.

Primers gabRp-F and gabRp-R were used to construct a gabR promoter fusion. The 633-bp putative gabRp fragment was cloned from HD-73 and integrated into pHT304-18Z to generate pHTgabRp. The resulting plasmid, pHTgabRp, was introduced into HD-73 and the sigL and gabR mutants. The corresponding strains, HD(gabRp-lacZ), HDΔsigL(gabRp-lacZ), and HDΔgabR(gabRp-lacZ), were selected by erythromycin resistance and PCR identification.

RNA isolation and reverse transcription-PCR (RT-PCR) of gab gene cluster.

RNA was extracted using TRIzol reagent (Invitrogen, San Diego, CA) as described in the manual. Residual genomic DNA was removed by treatment with RNase-free DNase I (TaKaRa, Tokyo, Japan) in the presence of RNase inhibitor (40 U; TaKaRa, Tokyo, Japan) for 30 min at 37°C. Following this step, RNA was purified with phenol-chloroform. The purity and concentration of RNA were determined by spectrophotometry (Eppendorf, Hamburg, Germany).

Total RNA (500 ng) was reverse transcribed for 60 min at 50°C, using Superscript III reverse transcriptase (Invitrogen, San Diego, CA) according to the manufacturer's instructions. The following primer sets were used to quantify expression of the gab gene cluster: gabD, RT-gabDR1/RT-gabDF1; gabR, RT-gabRR1/RT-gabRF1; gabT, RT-gabTF1/RT-gabTR1; and 16S rRNA gene, 16SrRNA5/16SrRNA3 (Table (Table2).2). The level of expression was normalized with 16S rRNA gene expression. After the reverse transcription step, cycling conditions for amplification were as follows: a single 5-min step at 94°C, followed by 30 cycles at 94°C for 1 min, 54°C (gabD, gabR, and gabT) or 52°C (16S rRNA gene) for 1 min, and 72°C for 2 min. A final elongation step was performed at 72°C for 10 min. The amplicons were separated in a 1.2% agarose gel. To exclude the possibility of DNA contamination, control samples were subjected to amplification without the prior reverse transcription step.

RESULTS

Sequence analysis of gab gene cluster.

The 6,232-bp (GenBank accession no. EU009521) DNA fragment including the gab gene cluster from B. thuringiensis HD-73 was cloned and sequenced by Sangon Biological Engineering Technology & Service Co., Ltd. (Shanghai, China). The results of sequence alignment analysis indicated that there were five proteins encoded by five open reading frames (ORFs) in this fragment: a hypothetical protein (orf1), phosphoglycolate phosphatase (orf2), γ-aminobutyrate aminotransferase (orf3; named gabT), a sigma54-dependent transcriptional activator (orf4; named gabR), and succinate semialdehyde dehydrogenase (NADP+) (orf5; named gabD) (Fig. (Fig.1).1). According to genomic sequence comparison, we found that the genetic structure of the gab cluster involved in the GABA shunt in B. thuringiensis is quite different from those in B. subtilis and E. coli but is conserved in the B. cereus group. The gabT and gabD genes were separated by a gabR gene, annotated as a sigma54-dependent transcriptional activator gene (named GabR), and the gabR gene of B. thuringiensis HD-73 showed significant identity to that of B. cereus 14579 (11), with similarity scores reaching 98%. In addition, there is a stem-loop structure within the intergenic spacer between the gabT and gabR genes (Fig. (Fig.1).1). This putative transcription terminator suggests that the gabT and gabD genes are not cotranscribed.

FIG. 1.
Nucleotide sequence of gab gene cluster in B. thuringiensis HD-73. There are five ORFs, and their annotations are shown in the 6,232-bp sequence, in which the elided sequences are indicated by dots. The boldly underlined regions indicate putative transcriptional ...

Characterization of gabT and gabD null mutants.

To determine the functions of gabT and gabD of B. thuringiensis HD-73, gabT and gabD deletion mutants were obtained by means of gene knockouts and their genetic complementation strains were also constructed. Deletion of the gabT or gabD gene did not affect the growth of the mutant strains in rich culture medium (PB) (Fig. (Fig.2A),2A), but in basic medium (BM containing 0.2% GABA), the growth of gabT deletion mutant strains was negatively affected (Fig. (Fig.2B).2B). This suggested that gabT deletion resulted in blockage of the GABA shunt, which affected bacterial growth in basic medium. Deletion of gabD had no significant effect on the growth of mutant strains in either rich or basic medium (Fig. (Fig.2).2). Another pathway might compensate for the absent function of the gabD gene product.

FIG. 2.
Growth curves of host, mutant, and genetic complementation strains in PB medium (A) and BM + 0.2% GABA (B). (A) Growth of mutant strains HD(ΔgabT) ([filled square]), HD(ΔgabD) ([filled triangle]), HD(ΔgabR) ([filled lozenge]), and HD(Δ ...

The gabT deletion led to the loss of GABA AT activity, and SSADH activity was also severely impaired in the HD(ΔgabT) strain (Fig. 3A and B). In the gabD deletion mutant, the activity of SSADH (NADP+) was almost lost, but the activity of GABA AT was still present (Fig. 3A and B). However, SSADH (NAD+) activity was detected in this mutant. In the wild-type strain, the activity of SSADH (NAD+) was lower than that of SSADH (NADP+), but in mutant strains HD(ΔgabT) and HD(ΔgabD), the activities of SSADH (NAD+) were all higher than those of SSADH (NADP+) (Fig. (Fig.3C).3C). These results showed that another gene with NAD+-dependent SSADH activity is present in B. thuringiensis HD-73.

FIG. 3.
Enzymatic analysis of GABA AT and SSADH, whose activity is dependent on NAD+/NADP+, in gabT and gabD deletion mutants. (A) Activity of GABA AT in HD(ΔgabT) ([filled square]) and HD(ΔgabD) ([filled triangle]); (B) activity of SSADH (NADP ...

Transcriptional analysis of the gab gene cluster.

In order to investigate the transcriptional unit, a series of primers were designed according to the gab cluster sequence in B. thuringiensis HD-73 to detect the transcripts of orf2-gabT, gabT, gabT-gabR, gabR, gabR-gabD, gabD, and gabD-downstream (Table (Table2;2; Fig. Fig.4A).4A). RT-PCR was carried out on total RNA extracted every 3 hours from cultures grown in basic medium (BM + 0.2% GABA). The transcripts of orf2-gabT, gabT, gabT-gabR, gabR, gabR-gabD, gabD, and gabD-downstream were reverse transcribed and amplified by PCR, but no part of the polycistronic transcripts of orf2-gabT, gabT-gabR, and gabD-downstream was detected (Fig. (Fig.4B).4B). The data suggested that the gabT gene was transcribed monocistronically, whereas gabR and gabD were transcribed together as one unit. The stem-loop-like structure within the intergenic spacer between gabT and gabR may stop readthrough transcription, resulting in single transcription of gabT.

FIG. 4.
Analysis of gab gene cluster structure in B. thuringiensis HD-73. (A) Proposed genetic structure of the gab gene cluster region. The upper part of the figure shows the five ORFs (from left to right) in this region. The thin arrows denote the positions ...

To further study the transcriptional mechanism of the gab cluster, a β-galactosidase activity assay was carried out to determine gabRp and gabTp promoter activities by the way of reporter gene fusion expression. We cloned the upstream regions of gabR and gabT and constructed the gabRp::lacZ and gabTp::lacZ reporter gene fusions, respectively (Fig. (Fig.11 and and4A).4A). In the HD(gabRp-lacZ) strain and the HD(gabTp-lacZ) strain, β-galactosidase activity could also be detected (Fig. 5A and B). Assay of β-galactosidase activity demonstrated that both gabRp (GenBank accession no. EF659465) and gabTp (GenBank accession no. EF659466) had promoter activity. These results of RT-PCR and β-galactosidase assays indicated that both gabT and gabR were transcribed by their own promoters and that gabT and gabD belonged to two different transcriptional units.

FIG. 5.
Characterization of promoter activities of upstream sequences of gabT and gabR in B. thuringiensis HD-73. pHTgabTp and pHTgabRp, which contain transcriptional fusions of upstream sequences of gabT and gabR with lacZ, were introduced into host strain HD-73 ...

Regulation of gabT and gabD by gabR.

To determine the function of gabR of B. thuringiensis HD-73, gabR deletion mutants and their genetic complementation strains were constructed. To demonstrate the effect of gabR deletion on expression of the gabT and gabD genes, we assayed the activities of GABA AT and SSADH in the host strain HD-73, the mutant strain HD(ΔgabR), and the genetic complementation strain HD(ΔgabR::gabR). SSADH (NADP+) activity was drastically depressed in HD(ΔgabR) compared with that in HD-73, and it was restored in HD(ΔgabR::gabR) (Fig. (Fig.6A).6A). This indicated that gabR played a positive regulatory role in the expression of gabD. GABA AT activity was also impaired in the gabR deletion mutant and was basically restored in HD(ΔgabR::gabR) (Fig. (Fig.6B).6B). The activity of SSADH (NAD+) was not markedly affected in the gabR deletion strain (Fig. (Fig.6C),6C), meaning that the gabR gene could not control the expression of another compensatory gabD gene.

FIG. 6.
Enzymatic analysis of GABA AT and SSADH, whose activity is dependent on NAD+/NADP+, in gabR and sigL deletion mutants. (A) Activity of SSADH (NADP+) in deletion mutants of gabR ([filled lozenge]) and sigL (•) and their genetic ...

The recombinant plasmid pHTgabTp (containing the gabTp-lacZ transcriptional fusion) was transformed into the HD(ΔgabR) mutant strain. β-Galactosidase activity in HDΔgabR(gabTp-lacZ) was almost abolished compared with that in the host strain HD(gabTp-lacZ) (Fig. (Fig.5B).5B). This indicated that the transcriptional activity of gabTp can be affected by the deletion of gabR. Based on these results, the gabR gene plays a very important role in regulating the expression of the gabT and gabD genes.

There was promoter transcriptional activity found in the host strain HD(gabRp-lacZ). The β-galactosidase activity in the gabR gene deletion strain HDΔgabR (gabRp-lacZ) was dramatically lower than that in HD(gabRp-lacZ) (Fig. (Fig.5A).5A). This suggests that deletion of the gabR gene can influence the transcriptional activity of its own promoter.

Sigma54-dependent regulation.

The annotation of gab gene cluster sequences indicated that the gabR gene encoded one kind of sigma54-dependent transcriptional activator (GabR). According to the putative amino acid sequence of GabR from HD-73, the result of a conserved domain search in NCBI showed that there were two conserved domains in the GabR protein. The amino-terminal domain was a PAS domain, and the carboxy-terminal sequence was a σ54 interaction domain. The conserved domain architecture of GabR was very similar to that of the σ54-dependent transcriptional activator RocR found in B. subtilis (42).

According to the cloned sequence of the putative gabT promoter (GenBank accession no. EF659466), we found that the conserved sequence of gabTp was TTGGCATACATTTTGCAATA. The two regulatory regions (underlined) were very conservative and similar to the distinctive sequences of σ54-dependent promoters, which are easily identified in all known σ54-dependent promoters (17, 27, 35, 42) (see the supplemental material). These results suggested that gabT expression may be regulated by a σ54 factor via the GabR transcriptional activator protein.

The sigL gene (the σ54 factor in B. thuringiensis HD-73) was disrupted by inserting the kanamycin resistance gene (Kanr) into the site at position 540 of sigL. The activities of GABA AT and SSADH (NADP+) were dramatically decreased in the HD(ΔsigL) mutant, but they were significantly enhanced when the sigL gene was overexpressed in HD(ΔsigL::sigL) (Fig. 6A and B). This means that sigL can regulate the expression of gabT and gabD. The recombinant plasmid pHTgabTp was also introduced into the HD(ΔsigL) mutant strain. β-Galactosidase activity in HDΔsigL(gabTp-lacZ) was nearly abolished compared with that in the host strain HD(gabTp-lacZ) (Fig. (Fig.5B).5B). These results indicated that gabT expression is controlled by a σ54 factor. In the same way, we found that the β-galactosidase activity in HDΔsigL(gabRp-lacZ) (containing the gabRp-lacZ transcriptional fusion) was dramatically reduced compared with that in the host strain HD(gabRp-lacZ) (Fig. (Fig.5A).5A). This result showed that the disruption of sigL could affect the gabR promoter activity. This meant that GabR may be a kind of sigma54-dependent transcriptional activator. We also found that the activity of SSADH (NAD+) was not markedly affected in the sigL deletion strain (Fig. (Fig.6C),6C), meaning that the sigL gene could not control the expression of another gabD gene as well.

DISCUSSION

Our results suggested that the structure of the gab gene cluster in B. thuringiensis HD-73 is different from those studied in E. coli and B. subtilis. The genes gabT, gabR, and gabD form the gab gene cluster, and gabT and gabD belong to different transcriptional units, while gabD and gabR form an operon. This suggests that the regulatory mechanism of the GABA shunt in the B. cereus group might be different from those in other bacteria.

Due to its unique structure, regulation of the gab cluster was also found to be quite different from that observed in B. subtilis. In B. thuringiensis HD-73, we confirmed that the gabR gene positively regulated the expression of the gabT and gabD genes. However, in B. subtilis, the regulatory pattern of the gab cluster was different. The gabD and gabT genes form a GABA-inducible operon. A divergent gene, gabR, proved to encode a protein (GabR) that belongs to the novel MocR/GabR family of chimeric proteins and acts as a transcriptional regulator of the gabTD operon and its own gene (8). Neither sigma54-associated activators nor sigma54-dependent genes have been reported so far in B. thuringiensis. In this study, we found that gabR played a very important role in regulating the gab cluster. Also, the conserved domain architecture of GabR in HD-73 was different from that in B. subtilis (8) but very similar to that of the RocR protein (one kind of sigma54-dependent transcriptional activator) found in B. subtilis (42). In addition, deletion of the gabR gene could affect the transcriptional activity of its own promoter. This indicated that the expression of gabR can be regulated by its own promoter. On the other hand, we found that the putative −12/−24 conservative sequence in the gabR promoter region is GTGGCTAGGATGGTTGCAGAA, which is similar to the published conservative regions of the sigma54-dependent promoter (11, 17, 27, 35), but the length of conservative space (10 bp in general) from −24 to −12 is slightly different (11 bp in the gabR promoter). This meant that the expression of gabR was also regulated by a σ54 factor. This was confirmed in our study showing that the disruption of sigL could affect the gabR promoter activity (Fig. (Fig.5A).5A). The complex structure of the gabR promoter suggested that its transcriptional mechanism might be more complex. Thus, mapping the transcription start points of gabR and gabT will be helpful to state with certainty that the putative −12/−24 sequences correspond to actual promoters.

σ54 is a unique alternative sigma factor which differs from the members of the σ70 family both in amino acid sequence and in transcription mechanism (27). σ54 recognizes a conserved −24/−12 promoter sequence, and the activation of the σ54-polymerase holoenzyme requires specialized bacterial enhancer-binding proteins, which contain a highly conserved activation domain that interacts with σ54 for transcriptional activation (11). In this study, we demonstrated that a σ54 factor could regulate the expression of the gab cluster involved in the GABA shunt. However, in E. coli, the regulatory pattern of the gab cluster was much more complicated. The csiD-ygaF-gabDTP region in the E. coli genome represents a cluster of σS-controlled genes. gabDTP expression is σS dependent and multiple stress induced (28). These findings indicate that the GABA shunt is regulated by different sigma factors in the two strains, that is, σS in E. coli and σ54 in B. thuringiensis. No previous reports on the function of the σ54 factor in the GABA shunt in B. thuringiensis have been found. We primarily confirmed the role of σ54 in the GABA shunt in B. thuringiensis, but its regulation mechanism with regard to the GABA shunt remains to be confirmed. σ54 recognizes the particular −24/−12 consensus sequence of the gabT promoter and requires the activator protein GabR to initiate transcription of the gabT gene. Although GabR is autoregulatory, its transcription is likely to be mediated by two different mechanisms. There must be constitutive expression of the σA promoter that permits a low level of gabR transcription under all conditions. σ54 then works with activated GabR to stimulate additional expression of gabR-gabD and to turn on gabT.

We also found that the growth of the gabD deletion mutant was not affected in comparison with the wild-type strain HD-73, while the growth of a gabT deletion mutant was impaired in BM+GABA medium. Furthermore, the gabD deletion mutant showed no SSADH activity dependent on NADP+ but depended on NAD+ (Fig. 3B and C). Therefore, we propose that another gabD gene was able to complement the function of the deleted gabD gene in the B. thuringiensis strain. In bacteria, there are two forms of succinic semialdehyde dehydrogenases that vary in their cofactor preference. One enzyme, which is specific for NADP+, is involved in the degradation of γ-aminobutyrate. The second enzyme is dependent on NAD+ and functions in the degradation of p-hydroxyphenylacetate. The enzyme appears to be encoded by a discrete regulatory unit and is induced by succinic semialdehyde itself (18, 38). In B. subtilis, there is only one such NAD+-dependent enzyme. The corresponding gene, gabD, seems to be subject to more complex regulation than gabT and may have an additional function in the utilization of succinic semialdehyde by a pathway(s) unrelated to GabT-dependent GABA utilization (7). The SSADH in Mycobacterium tuberculosis is an NADP+-dependent enzyme that may be involved in antioxidant defense (43). The function of this novel SSADH dependent on NAD+ in B. thuringiensis remains to be addressed. In addition, we found that the gabT mutant is defective in SSADH activity. This was an unexpected effect of gabT mutation on gabD expression. One possibility is that succinic semialdehyde produced by GABA degradation induced the expression of gabR as a kind of activator. Whether succinic semialdehyde as a metabolite can activate GabR or not will be addressed in our next work.

Overall, the present work demonstrates the structure and regulation of a gab gene cluster in B. thuringiensis. A model summarizing the structure and regulatory patterns of the gab gene cluster in B. thuringiensis HD-73 is proposed in Fig. Fig.7.7. The three genes, gabT, gabR, and gabD, were demonstrated to form a gab gene cluster involved in the GABA shunt. The GABA AT encoded by gabT could convert GABA into succinic semialdehyde, and the latter was further degraded to semialdehyde by SSADH, encoded by gabD. There were two transcriptional units in the gab gene cluster, in which gabT was separately transcribed, while gabR and gabD were cotranscribed and formed an operon. Moreover, gabR played a positive role in the regulation of expression of the gab gene cluster. gabT expression was also under the control of a σ54 factor. Thus, we reasoned that the σ54 factor regulated the expression of gabT by way of the GabR protein, which further regulated the expression of the gab cluster as a transcriptional activator. Future work, possibly through in vitro transcription analyses, is needed to study the role of the DNA-binding function of GabR in transcriptional activation and the mechanism of recruitment of GabR to the gabT promoter region, which will provide insight into this novel form of sigma54-dependent transcriptional activation.

FIG. 7.
Schematic presentation of the expression and regulatory pattern of the gab gene cluster in B. thuringiensis HD-73. The hollow arrows (from left to right) indicate the gabT, gabR, and gabD genes in turn. gabTp and gabRp mean the putative promoter regions ...

Supplementary Material

[Supplemental material]

Acknowledgments

We are very grateful to Abraham L. Sonenshein (Department of Microbiology, Tufts University School of Medicine) for helpful suggestions and critical revision of the manuscript.

This work was supported by grants from the Major State Basic Research Development Program of China (973 Program) (no. 2009CB118902) and the National High Technology Research and Development Program of China (863 Program) (no. 2008AA02Z112).

Footnotes

[down-pointing small open triangle]Published ahead of print on 23 October 2009.

Supplemental material for this article may be found at http://jb.asm.org/.

REFERENCES

1. Agaisse, H., and D. Lereclus. 1994. Structural and functional analysis of the promoter region involved in full expression of the cryIIIA toxin gene of Bacillus thuringiensis. Mol. Microbiol. 13:97-107. [PubMed]
2. Akihiro, T., S. Koike, R. Tani, T. Tominaga, S. Watanabe, Y. Iijima, K. Aoki, D. Shibata, H. Ashihara, C. Matsukura, K. Akama, T. Fujimura, and H. Ezura. 2008. Biochemical mechanism on GABA accumulation during fruit development in tomato. Plant Cell Physiol. 49:1378-1389. [PubMed]
3. Arantes, O., and D. Lereclus. 1991. Construction of cloning vectors for Bacillus thuringiensis. Gene 108:115-119. [PubMed]
4. Arnaud, M., A. Chastanet, and M. D. Barbouille. 2004. New vector for efficient allelic replacement in naturally nontransformable, low-GC-content, gram-positive bacteria. Appl. Environ. Microbiol. 70:6887-6891. [PMC free article] [PubMed]
5. Aronson, J. N., D. P. Borris, J. F. Doerner, and E. Akers. 1975. γ-Aminobutyric acid pathway and modified tricarboxylic acid cycle activity during growth and sporulation of Bacillus thuringiensis. Appl. Microbiol. 30:489-492. [PMC free article] [PubMed]
6. Bartsch, K., A. von Johnn-Marteville, and A. Schulz. 1990. Molecular analysis of two genes of the Escherichia coli gab cluster: nucleotide sequence of the glutamate:succinic semialdehyde transaminase gene (gabT) and characterization of the succinic semialdehyde dehydrogenase gene (gabD). J. Bacteriol. 172:7035-7042. [PMC free article] [PubMed]
7. Belitsky, B. R. 2002. Biosynthesis of amino acids of the glutamate and aspartate families, alanine, and polyamines, p. 203-231. In A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and its closest relatives: from genes to cells. ASM Press, Washington, DC.
8. Belitsky, B. R., and A. L. Sonenshein. 2002. GabR, a member of a novel protein family, regulates utilization of γ-aminobutyrate in Bacillus subtilis. Mol. Microbiol. 45:569-583. [PubMed]
9. Bouché, N., B. Lacombe, and H. Fromm. 2003. GABA signaling: a conserved and ubiquitous mechanism. Trends Cell Biol. 13:607-610. [PubMed]
10. Bown, A. W., and B. J. Shelp. 1997. The metabolism and function of γ-aminobutyric acid. Plant Physiol. 115:1-5. [PubMed]
11. Buck, M., M. T. Gallegos, D. J. Studholme, Y. Guo, and J. D. Gralla. 2000. The bacterial enhancer-dependent sigma (54) (sigma (N)) transcription factor. J. Bacteriol. 182:4129-4136. [PMC free article] [PubMed]
12. Carapito, R., D. Hatsch, S. Vorwerk, E. Petkovski, J. M. Jeltsch, and V. Phalip. 2008. Gene expression in Fusarium graminearum grown on plant cell wall. Fungal Genet. Biol. 45:738-748. [PubMed]
13. Chevrot, R., R. Rosen, E. Haudecoeur, A. Cirou, B. J. Shelp, E. Ron, and D. Faure. 2006. GABA controls the level of quorum-sensing signal in Agrobacterium tumefaciens. Proc. Natl. Acad. Sci. USA 103:7460-7464. [PubMed]
14. Clark, S. M., R. Di Leo, P. K. Dhanoa, O. R. Van Cauwenberghe, R. T. Mullen, and B. J. Shelp. 2009. Biochemical characterization, mitochondrial localization, expression, and potential functions for an Arabidopsis γ-aminobutyrate transaminase that utilizes both pyruvate and glyoxylate. J. Exp. Bot. 60(6):1743-1757. [PMC free article] [PubMed]
15. Daffonchio, D., N. Raddadi, M. Merabishvili, A. Cherif, L. Carmagnola, L. Brusetti, A. Rizzi, N. Chanishvili, P. Visca, R. Sharp, and S. Borin. 2006. Strategy for identification of Bacillus cereus and Bacillus thuringiensis strains closely related to Bacillus anthracis. Appl. Environ. Microbiol. 72:1295-1301. [PMC free article] [PubMed]
16. Débarbouillé, M., I. Martin-Verstraete, F. Kunst, and G. Rapoport. 1991. The Bacillus subtilis sigL gene encodes an equivalent of sigma54 from gram-negative bacteria. Proc. Natl. Acad. Sci. USA 88:9092-9096. [PubMed]
17. Débarbouillé, M., R. Gardan, M. Arnaud, and G. Rapoport. 1999. Role of bkdR, a transcriptional activator of the sigL-dependent isoleucine and valine degradation pathway in Bacillus subtilis. J. Bacteriol. 181:2059-2066. [PMC free article] [PubMed]
18. Donnelly, M. I., and R. A. Cooper. 1981. Two succinic semialdehyde dehydrogenases are induced when Escherichia coli K-12 is grown on gamma-aminobutyrate. J. Bacteriol. 145:1425-1427. [PMC free article] [PubMed]
19. Du, C., and K. W. Nickerson. 1996. Bacillus thuringiensis HD-73 spores have surface-localized Cry1Ac toxin: physiological and pathogenic consequences. Appl. Environ. Microbiol. 62:3722-3726. [PMC free article] [PubMed]
20. Fait, A., H. Fromm, D. Walter, G. Galili, and A. R. Fernie. 2008. Highway or byway: the metabolic role of the GABA shunt in plants. Trends Plant Sci. 13:14-19. [PubMed]
21. Foerster, H. F. 1971. γ-Aminobutyric acid as a required germinant for mutant spores of Bacillus megaterium. J. Bacteriol. 108:817-823. [PMC free article] [PubMed]
22. Han, C. S., G. Xie, J. F. Challacombe, M. R. Altherr, S. S. Bhotika, D. Bruce, C. S. Campbell, M. L. Campbell, J. Chen, O. Chertkov, C. Cleland, M. Dimitrijevic, N. A. Doggett, J. J. Fawcett, T. Glavina, L. A. Goodwin, K. K. Hill, P. Hitchcock, P. J. Jackson, P. Keim, A. R. Kewalramani, J. Longmire, S. Lucas, S. Malfatti, K. McMurry, L. J. Meincke, M. Misra, B. L. Moseman, M. Mundt, A. C. Munk, R. T. Okinaka, B. Parson-Quintana, L. P. Reilly, P. Richardson, D. L. Robinson, E. Rubin, E. Saunders, R. Tapia, J. G. Tesmer, N. Thayer, L. S. Thompson, H. Tice, L. O. Ticknor, P. L. Wills, T. S. Brettin, and P. Gilna. 2006. Pathogenomic sequence analysis of Bacillus cereus and Bacillus thuringiensis isolates closely related to Bacillus anthracis. J. Bacteriol. 188:3382-3390. [PMC free article] [PubMed]
23. Hyun-Woo, P., B. Ge, L. S. Bauer, and B. A. Federici. 1998. Optimization of Cry3A yields in Bacillus thuringiensis by use of sporulation-dependent promoters in combination with the STAB-SD mRNA sequence. Appl. Environ. Microbiol. 64:3932-3938. [PMC free article] [PubMed]
24. Kriegstein, A. R. 2005. GABA puts the brake on stem cells. Nat. Neurosci. 8:1132-1133. [PubMed]
25. Kumar, S., K. Tamura, and M. Nei. 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinform. 5:150-163. [PubMed]
26. Lereclus, D., O. Arantes, J. Chaufaux, and M. M. Lecadet. 1989. Transformation and expression of a cloned δ-endotoxin gene in Bacillus thuringiensis. FEMS Microbiol. Lett. 60:211-217. [PubMed]
27. Merrick, M. J. 1993. In a class of its own—the RNA polymerase sigma factor sigma54 (sigma N). Mol. Microbiol. 10:903-909. [PubMed]
28. Metzner, M., J. Germer, and R. Hengge. 2004. Multiple stress signal integration in the regulation of the complex σS-dependent csiD-ygaF-gabDTP operon in Escherichia coli. Mol. Microbiol. 51:799-811. [PubMed]
29. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
30. Miyashita, Y., and A. G. Good. 2008. Contribution of the GABA shunt in hypoxia-induced alanine accumulation in roots of Arabidopsis thaliana. Plant Cell Physiol. 49:92-102. [PubMed]
31. Nickerson, K. W., and L. A. Bulla. 1974. Physiology of spore-forming bacteria associated with insects: minimal nutritional requirements for growth, sporulation, and parasporal crystal formation of Bacillus thuringiensis. Appl. Microbiol. 28:124-128. [PMC free article] [PubMed]
32. Nickerson, K. W., J. DePinto, and L. A. Bulla. 1974. Sporulation of Bacillus thuringiensis without concurrent derepression of the tricarboxylic acid cycle. J. Bacteriol. 117:321-323. [PMC free article] [PubMed]
33. Niegemann, E., A. Schulz, and K. Bartsch. 1993. Molecular organization of the Escherichia coli gab cluster: nucleotide sequence of the structural genes gabD and gabP and expression of the GABA permease gene. Arch. Microbiol. 160:454-460. [PubMed]
34. Peng, Q., L. Zhu, F. P. Song, J. Zhang, J. G. Gao, and D. F. Huang. 2008. Characteristics of sigL mutant in Bacillus thuringiensis HD-73. Acta Microbiol. Sinica 48(9):1147-1153. [PubMed]
35. Reitzer, L., and B. L. Schneider. 2001. Metabolic context and possible physiological themes of σ54-dependent genes in Escherichia coli. Microbiol. Mol. Biol. Rev. 65:422-444. [PMC free article] [PubMed]
36. Rothacker, B., and T. Ilg. 2008. Functional characterization of a Drosophila melanogaster succinic semialdehyde dehydrogenase and a non-specific aldehyde dehydrogenase. Insect Biochem. Mol. Biol. 38:354-366. [PubMed]
37. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
38. Sanchez, M., M. A. Alvarez, R. Balana, and A. Garrido-Pertierra. 1988. Properties and functions of two succinic-semialdehyde dehydrogenases from Pseudomonas putida. Biochim. Biophys. Acta 953:249-257. [PubMed]
39. Schaeffer, P., J. Millet, and J. P. Aubert. 1965. Catabolic repression of bacterial sporulation. Proc. Natl. Acad. Sci. USA 54(3):704-711. [PubMed]
40. Schneider, B. L., S. Ruback, A. K. Kiupakis, H. Kasbarian, C. Pybus, and L. Reitzer. 2002. The Escherichia coli gabDTPC operon: specific gamma-aminobutyrate catabolism and nonspecific induction. J. Bacteriol. 184:6976-6986. [PMC free article] [PubMed]
41. Shelp, B. J., A. W. Bown, and D. Faure. 2006. Extracellular gammaaminobutyrate mediates communication between plants and other organisms. Plant Physiol. 142:1350-1352. [PubMed]
42. Studholme, D. J., and R. Dixon. 2003. Domain architectures of σ54-dependent transcriptional activators. J. Bacteriol. 185:1757-1767. [PMC free article] [PubMed]
43. Tian, J., R. Bryk, M. Itoh, M. Suematsu, and C. Nathan. 2005. Variant tricarboxylic acid cycle in Mycobacterium tuberculosis: identification of α-ketoglutarate decarboxylase. Proc. Natl. Acad. Sci. USA 102:10670-10675. [PubMed]
44. Wang, C., H. B. Zhang, L. H. Wang, and L. H. Zhang. 2006. Succinic semialdehyde couples stress response to quorum-sensing signal decay in Agrobacterium tumefaciens. Mol. Microbiol. 62:45-56. [PubMed]
45. Wang, G. J., J. Zhang, F. P. Song, J. Wu, S. L. Feng, and D. F. Huang. 2006. Engineered Bacillus thuringiensis G033A with broad insecticidal activity against lepidopteran and coleopteran pests. Appl. Microbiol. Biotechnol. 72:924-930. [PubMed]
46. Yousten, A. A., and M. H. Rogoff. 1969. Metabolism of Bacillus thuringiensis in relation to spore and crystal formation. J. Bacteriol. 100:1229-1236. [PMC free article] [PubMed]
47. Zhu, L., F. P. Song, J. Zhang, and D. F. Huang. 2007. Cloning, expression and phylogenetic analysis of two GABA shunt-related proteins from Bacillus thuringiensis. Microbiology 34(6):1031-1036. (In Chinese.)

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)