PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jbacterPermissionsJournals.ASM.orgJournalJB ArticleJournal InfoAuthorsReviewers
 
J Bacteriol. 2010 January; 192(1): 134–144.
Published online 2009 October 23. doi:  10.1128/JB.00822-09
PMCID: PMC2798245

Molecular Basis for the Role of Staphylococcus aureus Penicillin Binding Protein 4 in Antimicrobial Resistance[down-pointing small open triangle]

Abstract

Penicillin binding proteins (PBPs) are membrane-associated proteins that catalyze the final step of murein biosynthesis. These proteins function as either transpeptidases or carboxypeptidases and in a few cases demonstrate transglycosylase activity. Both transpeptidase and carboxypeptidase activities of PBPs occur at the d-Ala-d-Ala terminus of a murein precursor containing a disaccharide pentapeptide comprising N-acetylglucosamine and N-acetyl-muramic acid-l-Ala-d-Glu-l-Lys-d-Ala-d-Ala. β-Lactam antibiotics inhibit these enzymes by competing with the pentapeptide precursor for binding to the active site of the enzyme. Here we describe the crystal structure, biochemical characteristics, and expression profile of PBP4, a low-molecular-mass PBP from Staphylococcus aureus strain COL. The crystal structures of PBP4-antibiotic complexes reported here were determined by molecular replacement, using the atomic coordinates deposited by the New York Structural Genomics Consortium. While the pbp4 gene is not essential for the viability of S. aureus, the knockout phenotype of this gene is characterized by a marked reduction in cross-linked muropeptide and increased vancomycin resistance. Unlike other PBPs, we note that expression of PBP4 was not substantially altered under different experimental conditions, nor did it change across representative hospital- or community-associated strains of S. aureus that were examined. In vitro data on purified recombinant S. aureus PBP4 suggest that it is a β-lactamase and is not trapped as an acyl intermediate with β-lactam antibiotics. Put together, the expression analysis and biochemical features of PBP4 provide a framework for understanding the function of this protein in S. aureus and its role in antimicrobial resistance.

Penicillin binding proteins (PBPs) are critical components of the cell wall synthesis machinery in bacteria. These membrane-associated proteins are broadly classified as low-molecular-mass (LMM) PBPs that are monofunctional d,d-carboxypeptidase enzymes or multimodular high-molecular-mass (HMM) PBPs with multiple functional roles. PBPs, in general, are anchored to the cytoplasmic membrane by a noncleavable pseudo-signal peptide. In the case of the HMM PBPs, the cytoplasmic C-terminal domain binds penicillin and catalyzes peptidoglycan cross-linking, whereas the juxtamembrane N-terminal domain participates in transglycosylation (12). The catalytic penicillin-binding (PB) module also occurs as part of penicillin sensor transducers, such as Staphylococcus aureus MecR and Bacillus licheniformis BlaR (15). The transpeptidase activity in HMM PBPs is based on a conserved lysine residue located in the so-called catalytic S-X-X-K motif, whereas the other conserved S-X-N and K(H)-T(S)-G motifs govern carboxypeptidase activity and bind penicillin (20). The carboxypeptidase domain of PBPs is the target for β-lactam antibiotics in susceptible staphylococci (with penicillin MICs as low as 1 μg/ml).

The transpeptidase activity of the PBPs occurs at the d-Ala-d-Ala terminus of a precursor disaccharide pentapeptide comprising N-acetylglucosamine and N-acetyl-muramic acid-l-Ala-d-Ala-l-Lys-d-Ala-d-Ala. This reaction is initiated by acylation involving a nucleophilic attack by the active-site serine on the penultimate d-Ala residue to form an acyl-enzyme complex. The C-terminal d-Ala is subsequently released from the peptide chain, followed by deacylation. In the case of HMM PBPs, deacylation occurs when an amino group on a second peptide substrate acts as an acceptor, resulting in a peptide cross-link between two adjacent peptidoglycan strands. The carboxypeptidase activity of LMM PBPs follows a similar reaction scheme, except that the acceptor in this case is a water molecule. β-Lactam antibiotics mimic the substrates of the PBPs. However, unlike the natural substrate, the β-lactam-PBP acyl adduct is stable and results in irreversible inhibition of PBP function. The β-lactam-PBP acyl adduct has been characterized extensively, with over 50 protein-antibiotic complexes reported to date (37). Thus, in contrast to the nonessential LMM PBPs, HMM PBPs constitute lethal targets for β-lactam antibiotics (6).

Staphylococcus aureus is a gram-positive coccus and is one of the leading causes of high morbidity and mortality associated with both community- and hospital-associated infections (42, 46). This coccus shows extensive genomic variation, with over 22% of the genome dedicated to dispensable regions. A genome-scale analysis of a clinical strain of S. aureus is of particular interest in this context, wherein the conversion of a susceptible strain of S. aureus to a multidrug-resistant phenotype was shown to involve just 35 mutations in 13 loci, achieved within 3 months (36). Of the five PBPs in S. aureus, an acquired PBP, PBP2a, is the most extensively examined, as it was noted to be a specific marker for methicillin-resistant S. aureus (MRSA) strains. Among the intrinsic PBPs, PBP1 has been shown to play a key role in cell growth and division (2). PBP2 is a dual-function enzyme with both transglycosylase and transpeptidase activities, and inhibition of this protein leads to restrained peptidoglycan elongation and subsequent leakage of cytoplasmic contents due to cell lysis (34, 40). Inactivation of PBP3 neither changes the muropeptide composition of the cell wall nor significantly decreases the rate of autolysis. However, cells of abnormal size and shape and with disoriented septa are produced when bacteria with inactivated PBP3 are grown with sub-MIC levels of methicillin (29).

S. aureus PBP4 is a carboxypeptidase and is needed for the secondary cross-linking of peptidoglycan (19). However, it is not essential for cell growth under laboratory conditions, because mutants of S. aureus defective in PBP4 are viable (48). Overexpression of PBP4 was noted to result in an increase in β-lactam resistance and in greater cross-linking of the peptidoglycan (18). S. aureus PBP4 is similar to other LMM PBPs and is grouped within the superfamily of penicillin-susceptible and penicillin-interacting enzymes. However, homologues of PBP4 have a different phenotype in other species (1, 15). For example, a mutation of PBP4 in Pseudomonas aeruginosa triggers an AmpR-dependent overproduction of the chromosomal β-lactamase AmpC. The P. aeruginosa PBP4 mutant also activates CreBC, a two-component regulator, thereby mediating β-lactam resistance (33). Indeed, S. aureus PBP4 has been suggested to have different functions in strains with different genetic backgrounds (26). However, based on in vitro and genetic data, S. aureus PBP4 is primarily a transpeptidase and has little d,d-carboxypeptidase activity. This is also supported by the observation that increased carboxypeptidase activity decreases cell wall cross-linking due to loss of the free d-Ala-d-Ala termini necessary for transpeptidation (10). In this context, it is pertinent that pbp4 gene knockout strains of S. aureus were more resistant to the glycopeptide antibiotic vancomycin (46).

Here we present the biochemical and structural characteristics of PBP4 from S. aureus strain COL. S. aureus PBP4 is a β-lactamase. A comparison of the crystal structure of S. aureus PBP4 in complex with antibiotic with that of its Escherichia coli homologue, PBP5, provides a conformational and biochemical rationale for the β-lactamase activity of PBP4. Monitoring the expression of PBP4 in the MRSA strain COL and representative clinical strains of S. aureus suggested that the expression level of PBP4 does not fluctuate substantially across these strains. Together, these data on the structure, expression, activity, and regulation of PBP4 provide a framework for understanding the function of this protein in S. aureus and its role in antimicrobial resistance.

MATERIALS AND METHODS

Cloning, expression, and purification of S. aureus PBP4.

The gene encoding PBP4 was PCR amplified from the genomic DNA of Staphylococcus aureus COL, using the primers CGGCTAGCTATGCACAAGCTACTAACA and GCGGATCCTTACTGATGAACTTCTACAGT. The PCR product was cloned between the NheI and BamHI sites (bold italics) of the E. coli expression vector pET28a (Novagen, Inc.). This plasmid encoding PBP4 was further transformed into E. coli BL21(DE3) cells. The E. coli culture was grown to an optical density at 600 nm (OD600) of 0.5 at 37°C. Protein expression was induced with isopropyl-β-d-thiogalactopyranoside (IPTG; 0.3 mM final concentration). Postinduction, the cells were grown at 17°C for 12 h. After harvesting of the cells by centrifugation at 6,000 rpm for 10 min, they were lysed by sonication in a lysis buffer (50 mM Tris-HCl, pH 8, 250 mM NaCl, and 1 mM phenylmethylsulfonyl fluoride). The lysate was further centrifuged at 15,000 rpm, and the supernatant from this stage was incubated with nickel-nitrilotriacetic acid (Ni2+-NTA) affinity beads (Sigma-Aldrich Co.) for 2 h at 4°C. The recombinant protein was eluted by an imidazole gradient with concentrations ranging from 0 mM to 250 mM. The purity of the recombinant protein was examined by SDS-PAGE and mass spectrometry.

Crystallization and structure determination of PBP4-antibiotic complexes.

PBP4 was crystallized by the hanging-drop vapor diffusion method at 20°C. The crystallization conditions included 22% polyethylene glycol 3350 (PEG 3350) with 200 mM ammonium sulfate in 100 mM citrate buffer at pH 5.6. Crystals appeared after a month of setting up the crystallization trays at a protein concentration of 8 mg/ml in a buffer containing 50 mM Tris-HCl-300 mM NaCl at pH 8.0. Hampton crystallization screens were used to obtain initial crystallization conditions. Increasing the pH and concentration of polyethylene glycol led to faster crystal growth. These crystals were fragile and diffracted to low resolution. Different strategies were tried in order to improve crystal quality. Epitaxial seeding helped in increasing the size of the crystal, but the crystals again did not diffract beyond a 5-Å resolution. Subsequently, the crystallization drop was further streaked with a rabbit hair dipped in seed solution (3). This seed solution was obtained by washing the crystals in mother liquor, which was then gently mixed to obtain fine micronuclei. Different dilutions of seed solutions were tried. Seed stocks which were diluted >100-fold gave the best results. This procedure, though rather elaborate, gave good-diffraction-quality crystals within a week after streak seeding in crystallization solution containing 24% polyethylene glycol and 240 mM ammonium sulfate in Bis-Tris buffer at pH 6.5.

The crystals of PBP4-antibiotic complexes were obtained by soaking single PBP4 crystals in precipitant solution containing 0.6 mM ampicillin or cefotaxime for ca. 40 min. After incubation, the crystals were flash-frozen in a cryoprotectant solution containing 15% glycerol and 0.4 mM of the antibiotic. Diffraction data were collected at the BM-14U beamline of the ESRF, Grenoble, France. The diffraction data were integrated using iMOSFLM (41) and scaled using SCALA (9). Phase information was obtained by molecular replacement (MR), performed using PHASER (30, 45), with the structure of S. aureus PBP4 as a search model (RCSB [Research Collaboratory for Structural Bioinformatics] code 1TVF). The model was further refined using REFMAC (35) and examined for its consistency with the electron density, using Coot (7). The ligand(s) was incorporated into the model at the final stages of refinement. The library files for ampicillin and cefotaxime were obtained from the PRODRG server (http://davapc1.bioch.dundee.ac.uk/prodrg).

Assay for carboxypeptidase activity of PBP4.

The catalytic activity of PBP4 was monitored in a 12-μl reaction volume with 12 μg of protein at different concentrations of the model substrate Ac2-l-Lys-d-Ala-d-Ala. Inhibition by β-lactam antibiotics was monitored at different concentrations of the inhibitor, while the substrate and enzyme concentrations were kept constant. The reaction mixture contained the substrate (prepared in Tris-HCl buffer [100 mM; pH 8.0]) followed by addition of d-amino acid oxidase (DAO; 0.015 unit), flavin adenine dinucleotide (FAD; 1.67 mg/ml), and PBP4 (230 μM). The reaction mixture was incubated at 25°C for 20 min, after which 2,4-dinitrophenylhydrazine (DNPH; 0.25 g/liter in 1 M HCl) was added (14, 16). This solution was further incubated at 37°C for 10 min and was subsequently neutralized by the addition of NaOH (1.5 M). Product formation was monitored by an increase in the absorbance at 420 nm. The molar extinction coefficient of pyruvate 2,4-dinitrophenylhydrazone used in this calculation was 16,000 M−1 cm−1. All enzyme assays were done in quadruplicate. The carboxypeptidase activity was monitored in the presence of two inhibitors, cefotaxime and ampicillin, as well as an activator, sodium 2,2-dimethyl-2-silapentane-5-sulfonate (DSS) (7).

Assay for β-lactamase activity of PBP4.

Nitrocefin is a chromogenic β-lactamase substrate that undergoes a change in its color from yellow (λmax = 390 nm at pH 7.0) to red (λmax = 486 nm at pH 7.0) upon the hydrolysis of the amide bond in the β-lactam ring. Spectrophotometric assays were carried out by measuring changes in absorbance at 486 nm (38). The molar extinction coefficient of hydrolyzed nitrocefin at 486 nm is 20,500 M−1 cm−1. Briefly, 12 μg of PBP4 was added, and the absorbance was recorded at 486 nm. Subsequent changes in the absorbance were monitored for 15 min at intervals of 15 s at 25°C. This experiment was performed with different concentrations of nitrocefin (100 μM to 800 μM).

Characterization and growth of clinical strains of S. aureus. (i) Isolates.

MRSA isolates used in this study belong to different SCCmec types and are from our collection. The S. aureus COL (SCCmec type I) strain was a gift from Hermenia de Lancastre, Rockefeller University, NY.

(ii) Growth.

S. aureus cells were grown in brain heart infusion (BHI) medium (Hi Media Co.) at 37°C for 24 h.

(iii) MIC.

The MICs of oxacillin, ampicillin, and cefotaxime were determined by the broth dilution method in Mueller-Hinton broth after 24 h of incubation at 37°C in microtiter plates.

(iv) Determination of SCCmec types of clinical isolates.

SCCmec types were identified by determining the mec complex and cassette chromosome recombinase (ccr) complex types, using multiplex PCR with standard procedures (21, 22, 23).

(v) Generation of vancomycin-resistant (vR) COL.

COL was grown in BHI medium overnight without antibiotic and was streaked on a petri dish of 125-mm diameter containing a gradient of 0 to 6 μg of vancomycin/ml. The gradient plate was incubated at 37°C. Colonies growing on the highest concentration of vancomycin were picked and grown in a broth containing a similar vancomycin concentration. The mutants were passaged for several weeks until they reached a stable vancomycin MIC of 4 μg/ml.

(vi) Influence of antimicrobials and activators on growth of vancomycin-resistant MRSA.

Vancomycin-resistant COL generated by serial passage as described above was grown for 3 h in BHI medium before the addition of ampicillin or cefotaxime (1× MIC) and then was further grown for 2 h. DSS (sodium 2,2-dimethyl-2-silapentane-5-sulfonate) was used as an enhancer of carboxypeptidase activity (8). It was added at a concentration of 1.54 mM during 3 h of growth before induction with ampicillin or cefotaxime. Isolates grown under different conditions were streaked on a gradient plate containing 0 to 6 μg of vancomycin. RNAs and cDNAs of the same isolates were prepared.

(vii) Expression analysis of PBPs, using real-time PCR.

Five MRSA clinical isolates, COL, N-105, 0-189, M-37, and GR-1, belonging to SCCmec cassette types I, II, III, IV, and V, respectively, were chosen to study the expression levels of all the PBPs by real-time PCR with the primers listed in Table Table1.1. Type I to III SCCmec cassettes were present in hospital-associated MRSA (HA-MRSA), and type IV and V cassettes were present in community-associated MRSA (CA-MRSA). The MICs for oxacillin ranged from 3 to 200 μg/μl for these isolates. All of the isolates were grown in BHI broth to exponential phase (OD600 of 0.8). Real-time PCR was performed for all samples, using a DyNAmo SYBR Green qPCR kit from Finnzymes, Finland, with the procedures suggested by the manufacturer. RNA was extracted using an RNeasy Mini kit from Qiagen, and cDNA was prepared using a Quantitect reverse transcriptase kit according to the manufacturer's instructions. The same procedure was used to evaluate the induction of PBP4 expression in the presence of the β-lactam antibiotics ampicillin and cefotaxime in a vancomycin-resistant COL isolate.

TABLE 1.
Primers used in expression analysis

Protein structure accession numbers.

The atomic coordinates and structure factors for PBP4 have been deposited in the Protein Data Bank under the accession codes 3HUN (ampicillin-bound PBP4) and 3HUM (PBP4-cefotaxime complex).

RESULTS

Crystal structure of PBP4 and its complexes with ampicillin and cefotaxime.

The structure of S. aureus PBP4 (RCSB code 1TVF) solved by the New York Structural Genomics Consortium was used as a model for molecular replacement. The ligands were incorporated into the model at the final stages of refinement into the difference electron density map. Since we noted that the PBP4 structure has not been described elsewhere, we describe the conformational features of this protein and compare it with its homologues in more detail here. Crystals of PBP4 were obtained using the hanging-drop vapor diffusion method in 24% polyethylene glycol and 240 mM ammonium sulfate in Bis-Tris buffer at pH 6.5. Attempts to cocrystallize the protein with antibiotic molecules were not successful. The PBP4-ligand complexes were thus obtained by incubating PBP4 crystals with antibiotics. Prolonged exposure to the antibiotic solution caused cracking of the crystals. Optimization of the incubation conditions yielded diffraction-quality crystals of the antibiotic complexes. Unambiguous electron density was seen for residues 25 to 382 in the cases of both the ampicillin and cefotaxime complexes. These structures were determined at 2 Å and 2.3 Å, respectively (Fig. (Fig.1).1). The data collection and refinement statistics are reported in Table Table22.

FIG. 1.
Structural features of S. aureus PBP4. (A) Sequence conservation of PBP4 is shown in the context of the crystal structure. This figure was drawn using Consurf (27). Of the two domains in S. aureus PBP4, the β-lactamase domain at the N terminus ...
TABLE 2.
Data collection and refinement statistics for PBP4-antibiotic complexes

S. aureus PBP4 has two domains. The N-terminal domain has a β-lactamase/transpeptidase fold and is classified in the α+β family of proteins. This domain comprises a five-stranded antiparallel β-sheet sandwiched between two helical clusters. One helical cluster has seven helices and a single-turn helix. The second helical cluster has two helices. PBP4 has an all-β domain at the C terminus. This domain, a sandwich of two antiparallel β-sheets, is also seen in a few carboxypeptidases, such as the PBP4-like protein from Staphylococcus haemolyticus, Enterococcus faecalis d-alanyl-d-alanine carboxypeptidase, and E. coli PBP5 (37). The functional role of this C-terminal domain remains to be determined.

PBPs and other penicillin-interacting enzymes (for example, class A β-lactamases) are characterized by a set of conserved motifs that are clustered in their respective active sites (13). These motifs include the Ser-X-X-Lys (SXXK) tetrad that contains the serine nucleophile, the Ser-X-Asn (SXN) triad, and the Lys-Thr(Ser)-Gly (KTG) triad. In all serine-based PBPs and β-lactamases of known structure, these motifs adopt a strikingly similar conformation, to the extent that the active site of one PBP or β-lactamase can look very much like another. The active site in the case of PBP4 is also formed by the arrangement of SXXK, SXN, and KTG motifs at the interface of an antiparallel β-sheet and the larger α-helical cluster of the N-terminal domain. The SXXK motif is present in an α-helix, the SXN motif is in a loop, and the KTG motif is present in a β-strand. Along with these motifs, two loops, incorporating Pro179 to Glu183 and Leu112 to Asn117, form the boundaries of the active site. Class A β-lactamases have an additional motif, Glu-X-X-X-Asn (EXXXN), present on the so-called Ω loop, that is responsible for the high rates of deacylation (38). The location of this EXXXN motif vis-à-vis the three conserved motifs, viz, SXXK, SXN, and KTG, is similar in E. coli TEM-1 and the β-lactamases from S. aureus and Streptomyces albus.

The structure of S. aureus PBP4 superposes well on that of its E. coli homologue, PBP5, with a root mean square deviation (RMSD) of 1.8 Å. Predictably, the regions that differ most are the loops. A notable similarity between E. coli PBP5 and S. aureus PBP4 lies in the polypeptide segment from Asp74 to Phe90 (E. coli PBP5 sequence) that covers the active site and contains conserved serine residues that are required for the stability of the active-site serine residue in the SXN motif (28). The segment from Thr101 to Gln124 in S. aureus PBP4 also has two conserved serine residues, similar to the E. coli enzyme. It has been demonstrated experimentally that this loop from residues 74 to 90 in E. coli PBP5 plays a major role in deacylation (5, 28). Another conformational similarity lies in the loop spanning Phe147 to Gly157, present near the active site in E. coli PBP5. This loop, which is similar to the Ω loop of class A β-lactamase (5), is present in S. aureus PBP4 (Gly181 to Glu199). The presence of this Ω-like loop, which is essential for the rapid hydrolysis of the acyl-enzyme complex in β-lactamases, suggests that S. aureus PBP4 has characteristic conformational features of a β-lactamase. An offshoot of this is that several mechanistic interpretations of the activity of PBP4 can be inferred from the well-characterized E. coli enzyme (5, 28, 37). Thus, Lys78 of S. aureus PBP4 (Lys47 in E. coli) is expected to assist in acid-base catalysis involving the acylation and deacylation steps (44). The dissimilarities between the S. aureus and E. coli PBP homologues are localized mainly in two segments wherein coils in S. aureus PBP4 (His234 to Tyr239 and Asn242 to Met250) are replaced by a strand and a helix in E. coli PBP5 (Fig. (Fig.22).

FIG. 2.
Comparison of active sites of S. aureus PBP4 (A) and E. coli PBP5 (B). In these stereoview images, the residues in the conserved SXXK, SXN, and KTG motifs are highlighted.

Additional electron density in 2Fo-Fc and Fo-Fc maps was observed near the active site for both the ampicillin and cefotaxime complexes of PBP4. An inspection of the electron density map revealed that in contrast to our expectation, PBP4 did not form an acyl-enzyme intermediate with the β-lactam antibiotic (Fig. (Fig.3).3). Indeed, we could not detect the covalently bound species by mass spectrometry, even after prolonged incubation with ampicillin or cefotaxime, the two antibiotics used in this study. Subsequent efforts to detect the free antibiotic before and after incubation with PBP4 revealed the presence of the hydrolyzed species (Fig. (Fig.3).3). Thus, both ampicillin and cefotaxime were modeled in their hydrolyzed form in the electron density maps of the PBP4-antibiotic complexes. In the cefotaxime-PBP4 complex, no electron density could be seen for the acetate group attached to the six-membered ring (shown in Fig. Fig.3B3B as species III). The hydrolyzed β-lactam antibiotic in both cases is surrounded by residues Ser75 of the SXXK motif, Ser139 of the SXN motif, Phe241, Thr260, and Gly261 of the KTG motif, and Glu297 from the EXXXN motif. In the case of the cefotaxime complex, we noted two additional interactions, involving the aromatic residues Phe243 and Tyr268. The residues surrounding the antibiotic molecules are mainly hydrophilic, except for Phe and Tyr. An interesting observation is that the conserved Glu297 from the EXXXN motif is located at a distance of ca. 3 Å from the antibiotic in both the ampicillin and cefotaxime PBP4 complexes. The structure of PBP4 with ampicillin superposes well with that of the PBP4-cefotaxime complex, with a root mean square deviation of 0.26 Å, further confirming that ligand binding did not induce substantial differences in the structure of PBP4 in these antibiotic complexes.

FIG. 3.
PBP4 hydrolyzes β-lactam antibiotics. (A) (i) An (mFo-DFc) electron density map shows the presence of hydrolyzed ampicillin at the active site of PBP4. Residues present at a distance of <3.5 Å from the active site are shown. (ii) ...

Carboxypeptidase activity of S. aureus PBP4.

The carboxypeptidase activity of PBP4 was monitored using the substrate analogue Ac2-l-Lys-d-Ala-d-Ala (16). This assay involved the detection of the terminal d-Ala released from the substrate by the activity of PBP4. The assay thus involved the oxidation of d-alanine by d-amino acid oxidase to pyruvate, H2O2, and NH3, followed by the colorimetric estimation of pyruvate by use of 2,4-dinitrophenylhydrazine (DNPH) (14). This reaction could be monitored by noting the change in the absorption at 420 nm (or, optionally, at 515 nm). The enzyme kinetics (Fig. (Fig.4)4) of PBP4 adopts a classical Michaelis-Menten profile, with the catalytic constant Km being 2.43 ± 0.45 mM, Vmax being 0.005 ± 0.0003 mM min−1 g−1, and kcat/Km being 0.0157 ± 0.0012 s−1 mM−1. The activity assay was also performed at different concentrations of ampicillin and cefotaxime. The inhibitory effect was marginal; for example, the calculated kcat/Km in the presence of ampicillin was 0.0072 s−1 mM−1. We also examined if the carboxypeptidase activity could be modulated in the presence of known effectors. DSS, a standard reference in nuclear magnetic resonance (NMR) experiments, was noted to function as an activator of carboxypeptidase A (8). We examined the effect of DSS on the activity of PBP4 and noted that the carboxypeptidase activity of PBP4 could be modulated by DSS. In the presence of DSS, the Km was 0.412 ± 0.12 mM, whereas the kcat/Km was 0.052 s−1 mM−1.

FIG. 4.
Catalytic activity of PBP4. (A) Catalytic parameters for the β-lactamase activity of PBP4 were determined using nitrocefin. These are as follows: Km = 100.95 ± 31.3 μM, Vmax = 0.0056 μmol min−1 mg ...

β-Lactamase activity of S. aureus PBP4.

The ability of S. aureus PBP4 to hydrolyze β-lactam antibiotics was monitored using an assay based on a chromogenic cephalosporin, nitrocefin (38). Nitrocefin has a highly reactive β-lactam ring which changes color when cleaved by β-lactamases. Intact nitrocefin has an absorption maximum at 390 nm, whereas the hydrolyzed form shows an absorption maximum at 486 nm. The enzymatic parameters for PBP4 were calculated based on the increase in the absorption at 486 nm. These were as follows: Km = 100.95 ± 31.3 μM, Vmax = 0.0056 μmol/min/mg, and kcat = 2.43 × 10−7 min−1 (Fig. (Fig.44).

Expression profile of S. aureus PBP4 upon exposure to β-lactam antibiotics.

PBP4, although not essential for viability, is associated with low-level resistance. Increased levels of PBP4 have been shown to be correlated with β-lactam resistance, whereas decreased levels of this PBP coincide with vancomycin resistance. Inactivation of the overproduced PBP4 was demonstrated to increase β-lactam susceptibility and to decrease the MIC for vancomycin-resistant isolates (43). Most studies to date have demonstrated an increase in the level of PBP4 when S. aureus isolates are grown in the presence of β-lactam antibiotics. Recently, Memmi et al. showed that a mutation in PBP4 in strains MW2 and USA300 (CA-MRSA) led to a significant decrease in high-level resistance to the penicillinase-stable antibiotics oxacillin and nafcillin (31). The loss of PBP4 was also found to severely affect the transcription of PBP2 in cells after induction with oxacillin, thus leading to a significant decrease in peptidoglycan cross-linking. They also observed that mecA expression remained unchanged in PBP4 mutants and that constitutive expression of PBP2A did not contribute to oxacillin resistance in CA-MRSA in the absence of PBP4. Thus, from this study, PBP4 was noted as an important factor in β-lactam resistance in CA-MRSA but not in HA-MRSA isolates.

In order to understand the role of PBP4 in clinical MRSA isolates, we selected three HA-MRSA and two CA-MRSA isolates to quantify all the PBPs simultaneously, using real-time PCR (Fig. (Fig.5;5; Table Table3).3). In multiple experiments conducted in our laboratory, we did not see significant differences in the levels of PBP1, PBP2, PBP3, and PBP4 between the five isolates grown to the exponential growth phase, although there were distinct changes in the level of PBP2a. We subsequently analyzed the expression profile of PBP4 in MRSA isolate COL, mimicking the in vivo conditions of antibiotic treatment used on a patient with bacterial endocarditis. The conditions we tested were similar to those adopted in the genome-scale analysis of MRSA (36). S. aureus COL was passaged to form an intermediate vancomycin-resistant (vR) strain and was examined in the presence of ampicillin or cefotaxime (as described in Materials and Methods). PBP4 levels and the MIC for vancomycin were determined under different conditions. Vancomycin-resistant COL was also grown in the presence of DSS (a carboxypeptidase activator) to test the effect of the increase in the carboxypeptidase activity of PBP4 on the MIC for vancomycin. As seen from the profiles in the gradient plates (Fig. (Fig.5A),5A), there was no difference in the MIC level for vancomycin in either the COL vR isolate or the vR+ampicillin, vR+cefotaxime, and vR+DSS conditions. These observations thus differ from earlier reports that changes in PBP4 level could be correlated with changes in antibiotic resistance. A plausible explanation for this finding could be due to the choice of strains (based on SCCmec types) or to differences in the genetic backgrounds of the clinical strains that were examined. These results nonetheless serve to demonstrate the complexity in the adaptive mechanism for resistance to β-lactam antibiotics.

FIG. 5.
Bacterial growth and expression profile of PBP4. (A) S. aureus COL cultures were grown on a gradient plate in the presence of vancomycin (row A), vancomycin and DSS (row B), vancomycin and ampicillin (row C), vancomycin, DSS, and ampicillin (row D), vancomycin ...
TABLE 3.
S. aureus clinical isolates examined in this study

DISCUSSION

The complex interplay of the balance between peptidoglycan synthesis and hydrolysis presents a formidable challenge for antimicrobial design. Inhibition of carboxypeptidase activity, for example, leads to a thickening of the cell wall and changes in the peptidoglycan layer. The free d-Ala-d-Ala dipeptide segments on the cell surface present multiple targets for the glycopeptide antibiotics vancomycin and teicoplanin, thereby effectively sequestering these drugs from reaching their cellular targets in the cytoplasm. Therapy with β-lactams thus appears to lead to a compromised S. aureus strain that is more likely to be resistant to vancomycin.

Extensive analysis of the resistance of S. aureus to β-lactam antimicrobials points mostly to an acquired low-affinity PBP, PBP2a, due to the insertion of a mobile genetic element, SCCmec, where SCC stands for staphylococcal cassette chromosome and mec is the gene encoding PBP2a (17, 24). SCCmec ranges in size from 21 to 67 kb and integrates into the orfX locus close to the origin of replication, between the spa gene that encodes protein A and purA, which is required for adenine biosynthesis (39). It is a novel mobile genetic element distinct from integrons, transposons, pathogenicity islands, and bacteriophage-like mobile elements (32), and it is marked by inverted repeats of 27 bp at its termini (22). There are seven major types of SCCmec (types I to VII) in MRSA clones. Methicillin-resistant strains have been proposed to have evolved independently several times, as opposed to being a derivative of a single ancestral strain (11). In spite of this polymorphism in the SCC element, the gene for PBP2a is remarkably conserved (21, 23).

In the case of mec-independent borderline MRSA, also referred to as moderately resistant S. aureus (MODSA), acquisition of penicillin resistance is attributed in part to structural modifications affecting penicillin binding of multiple PBPs and involves the nonessential LMM PBP, PBP4 (4). Overproduction of PBP4 has been reported to increase β-lactam resistance in S. aureus (18). It was envisaged that structural features that enable a PBP to perform essential transpeptidase reactions may impose a constraint on how rapidly it can deacylate the penicillin adduct (47). PBP4, which has both carboxypeptidase and transpeptidase activities in vitro, was thought to function as a nonessential transpeptidase in vivo (12, 25). It was hypothesized that by virtue of being an efficient carboxypeptidase over a transpeptidase, PBP4 plays a major role in conferring non-mecA-associated borderline methicillin resistance in S. aureus. The crystal structure of PBP4 now helps to rationalize this observation (Fig. (Fig.2).2). To further examine if the catalytic rate constants that we report here were severely limited by the choice of a nonnatural substrate, we proceeded to compile the reported catalytic activities of all PBPs (data not shown). However, the wide fluctuation in the catalytic rate constants reported for PBPs from different species precludes the possibility of comparative analysis on this score. Nonetheless, the results of the activity assay performed in vitro clearly demonstrate that PBP4 can perform β-lactamase activity.

Although PBP4 was shown to play a crucial role in borderline methicillin resistance and, more recently, in influencing antibiotic resistance in CA-MRSA, our data based on local strains of CA-MRSA reported here are not consistent with this suggestion. While it is likely that our observation that the level of PBP4 does not correlate with increased resistance could be due to not having examined many isolates of CA-MRSA, an equally plausible reason could be that polymorphisms in the PBP4 proteins of Indian CA-MRSA isolates cause this feature. In the light of the in vitro data showing that PBP4 is a more efficient deacylase than other PBPs and is, in effect, a β-lactamase, it is likely that the β-lactam antibiotics examined were perhaps hydrolyzed rapidly, without sufficient time for the induction of PBP4.

To summarize, the biochemical characteristics and conformational features of the active site of PBP4 suggest that this protein is a β-lactamase. This conclusion is supported by several lines of evidence, including mass spectra showing hydrolyzed β-lactam antibiotics, electron density at the active site of PBP4 that can best be interpreted as a hydrolyzed antibiotic, and a nitrocefin-based assay for β-lactamase activity. This implies that the active site of this enzyme can remain free even in the presence of β-lactam antibiotics. Since inhibition of this enzyme leads to increased vancomycin resistance, the biochemical features of PBP4 offer the possibility of modulating the function of this enzyme by activators so as to prolong the efficacy of glycopeptide antimicrobials such as vancomycin.

Acknowledgments

This work was supported by a grant from the Sir Dorabji Tata Centre for Research in Tropical Diseases, Bangalore, India. The X-ray facility for macromolecular crystallography is supported by grants from the Department of Science and Technology and the Department of Biotechnology, Government of India. B.G. is an International Senior Research Fellow of the Wellcome Trust, United Kingdom.

We gratefully acknowledge Sandeep Srivastava for his help in the crystallization experiments. We acknowledge D. Raghunath, Principal Executive, SDTC, for his encouragement.

Footnotes

[down-pointing small open triangle]Published ahead of print on 23 October 2009.

REFERENCES

1. Ambler, R. P., A. F. Coulson, J. M. Frere, J. M. Ghuysen, B. Joris, M. Forsman, R. C. Levesque, G. Tiraby, and S. G. Waley. 1991. A standard numbering scheme for the class A beta-lactamases. Biochem. J. 276:269-270. [PubMed]
2. Beise, F., H. Labischinski, and H. Bradaczek. 1988. On the relationships between molecular conformation, affinity towards penicillin-binding proteins, and biological activity of penicillin G-sulfoxide. Z. Naturforsch. C 43:656-664. [PubMed]
3. Bergfors, T. 1999. Protein crystallization: techniques, strategies, and tips. International University Line, La Jolla, CA.
4. Chambers, H. F., M. J. Sachdeva, and C. J. Hackbarth. 1994. Kinetics of penicillin binding to penicillin-binding proteins of Staphylococcus aureus. Biochem. J. 301:139-144. [PubMed]
5. Davies, C., S. W. White, and R. A. Nicholas. 2001. Crystal structure of a deacylation-defective mutant of penicillin-binding protein 5 at 2.3-A resolution. J. Biol. Chem. 276:616-623. [PubMed]
6. Denome, S. A., P. K. Elf, T. A. Henderson, D. E. Nelson, and K. D. Young. 1999. Escherichia coli mutants lacking all possible combinations of eight penicillin binding proteins: viability, characteristics, and implications for peptidoglycan synthesis. J. Bacteriol. 181:3981-3993. [PMC free article] [PubMed]
7. Emsley, P., and K. Cowtan. 2004. Coot: model-building tools for molecular graphics. Acta Crystallogr. D 60:2126-2132. [PubMed]
8. Epstein, M., and G. Navon. 1969. DSS as an activator of carboxypeptidase A. Biochem. Biophys. Res. Commun. 36:126-130. [PubMed]
9. Evans, P. 2006. Scaling and assessment of data quality. Acta Crystallogr. D 62:72-82. [PubMed]
10. Finan, J. E., G. L. Archer, M. J. Pucci, and M. W. Climo. 2001. Role of penicillin-binding protein 4 in expression of vancomycin resistance among clinical isolates of oxacillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 45:3070-3075. [PMC free article] [PubMed]
11. Fitzgerald, J. R., D. E. Sturdevant, S. M. Mackie, S. R. Gill, and J. M. Musser. 2001. Evolutionary genomics of Staphylococcus aureus: insights into the origin of methicillin-resistant strains and the toxic shock syndrome epidemic. Proc. Natl. Acad. Sci. USA 98:8821-8826. [PubMed]
12. Ghuysen, J. M. 1991. Serine beta-lactamases and penicillin-binding proteins. Annu. Rev. Microbiol. 45:37-67. [PubMed]
13. Goffin, C., and J. M. Ghuysen. 1998. Multimodular penicillin-binding proteins: an enigmatic family of orthologs and paralogs. Microbiol. Mol. Biol. Rev. 62:1079-1093. [PMC free article] [PubMed]
14. Gordon, E. A., and M. B. Diane. 2003. Modified method for the determination of pyruvic acid with dinitrophenylhydrazine in the assessment of onion pungency. J. Sci. Food Agric. 89:1210-1213.
15. Granier, B., M. Jamin, M. Adam, M. Galleni, B. Lakaye, W. Zorzi, J. Grandchamps, J. M. Wilkin, C. Fraipont, B. Joris, C. Duez, M. Nguyen-Disteche, J. Coyetteme, L. Leyh-Bouille, J. Dusart, L. Christiaens, J. M. Frere, and J. M. Ghuysen. 1994. Serine-type d-Ala-d-Ala peptidases and penicillin-binding proteins. Methods Enzymol. 244:249-266. [PubMed]
16. Gutheil, W. G., M. E. Stefanova, and R. A. Nicholas. 2000. Fluorescent coupled enzyme assays for d-alanine: application to penicillin-binding protein and vancomycin activity assays. Anal. Biochem. 287:196-202. [PubMed]
17. Hartman, B. J., and A. Tomasz. 1984. Low-affinity penicillin-binding protein associated with beta-lactam resistance in Staphylococcus aureus. J. Bacteriol. 158:513-516. [PMC free article] [PubMed]
18. Henze, U. U., and B. Berger-Bachi. 1996. Penicillin-binding protein 4 overproduction increases beta-lactam resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 40:2121-2125. [PMC free article] [PubMed]
19. Henze, U. U., and B. Berger-Bachi. 1995. Staphylococcus aureus penicillin-binding protein 4 and intrinsic beta-lactam resistance. Antimicrob. Agents Chemother. 39:2415-2422. [PMC free article] [PubMed]
20. Herzberg, O., and J. Moult. 1987. Bacterial resistance to beta-lactam antibiotics: crystal structure of beta-lactamase from Staphylococcus aureus PC1 at 2.5 Å resolution. Science 236:694-701. [PubMed]
21. Ito, T., Y. Katayama, K. Asada, N. Mori, K. Tsutsumimoto, C. Tiensasitorn, and K. Hiramatsu. 2001. Structural comparison of three types of staphylococcal cassette chromosome mec integrated in the chromosome in methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 45:1323-1336. [PMC free article] [PubMed]
22. Ito, T., Y. Katayama, and K. Hiramatsu. 1999. Cloning and nucleotide sequence determination of the entire mec DNA of pre-methicillin-resistant Staphylococcus aureus N315. Antimicrob. Agents Chemother. 43:1449-1458. [PMC free article] [PubMed]
23. Ito, T., K. Okuma, X. X. Ma, H. Yuzawa, and K. Hiramatsu. 2003. Insights on antibiotic resistance of Staphylococcus aureus from its whole genome: genomic island SCC. Drug Resist. Updat. 6:41-52. [PubMed]
24. Katayama, Y., T. Ito, and K. Hiramatsu. 2000. A new class of genetic element, staphylococcus cassette chromosome mec, encodes methicillin resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 44:1549-1555. [PMC free article] [PubMed]
25. Kozarich, J. W., and J. L. Strominger. 1978. A membrane enzyme from Staphylococcus aureus which catalyzes transpeptidase, carboxypeptidase, and penicillinase activities. J. Biol. Chem. 253:1272-1278. [PubMed]
26. Labischinski, H. 1992. Consequences of the interaction of beta-lactam antibiotics with penicillin binding proteins from sensitive and resistant Staphylococcus aureus strains. Med. Microbiol. Immunol. 181:241-265. [PubMed]
27. Landau, M., I. Mayrose, Y. Rosenberg, F. Glaser, E. Martz, T. Pupko, and N. Ben-Tal. 2005. ConSurf 2005: the projection of evolutionary conservation scores of residues on protein structures. Nucleic Acids Res. 33:W299-W302. [PMC free article] [PubMed]
28. Malhotra, K. T., and R. A. Nicholas. 1992. Substitution of lysine 213 with arginine in penicillin-binding protein 5 of Escherichia coli abolishes d-alanine carboxypeptidase activity without affecting penicillin binding. J. Biol. Chem. 267:11386-11391. [PubMed]
29. Marin, M. 2002. Methicillin resistant Staphylococcus. Medicina (Buenos Aires) 62(Suppl. 2):30-35. [PubMed]
30. McCoy, A. J., R. W. Grosse-Kunstleve, L. C. Storoni, and R. J. Read. 2005. Likelihood-enhanced fast translation functions. Acta Crystallogr. D 61:458-464. [PubMed]
31. Memmi, G., S. R. Filipe, M. G. Pinho, Z. Fu, and A. Cheung. 2008. Staphylococcus aureus PBP4 is essential for beta-lactam resistance in community-acquired methicillin-resistant strains. Antimicrob. Agents Chemother. 52:3955-3966. [PMC free article] [PubMed]
32. Morris, G. M., D. S. Goodsell, R. S. Halliday, R. Huey, W. E. Hart, R. K. Belew, and A. J. Olson. 1998. Automated docking using a Lamarckian genetic algorithm and empirical binding free energy function. J. Comput. Chem. 19:1639-1662.
33. Moya, B., A. Dotsch, C. Juan, J. Blazquez, L. Zamorano, S. Haussler, and A. Oliver. 2009. Beta-lactam resistance response triggered by inactivation of a nonessential penicillin-binding protein. PLoS Pathog. 5:e1000353. [PMC free article] [PubMed]
34. Murakami, K., T. Fujimura, and M. Doi. 1994. Nucleotide sequence of the structural gene for the penicillin-binding protein 2 of Staphylococcus aureus and the presence of a homologous gene in other staphylococci. FEMS Microbiol. Lett. 117:131-136. [PubMed]
35. Murshudov, G. N., A. A. Vagin, and E. J. Dodson. 1997. Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr. D 53:240-255. [PubMed]
36. Mwangi, M. M., S. W. Wu, Y. Zhou, K. Sieradzki, H. de Lencastre, P. Richardson, D. Bruce, E. Rubin, E. Myers, E. D. Siggia, and A. Tomasz. 2007. Tracking the in vivo evolution of multidrug resistance in Staphylococcus aureus by whole-genome sequencing. Proc. Natl. Acad. Sci. USA 104:9451-9456. [PubMed]
37. Nicholas, R. A., S. Krings, J. Tomberg, G. Nicola, and C. Davies. 2003. Crystal structure of wild-type penicillin-binding protein 5 from Escherichia coli: implications for deacylation of the acyl-enzyme complex. J. Biol. Chem. 278:52826-52833. [PubMed]
38. Papanicolaou, G. A., and A. A. Medeiros. 1990. Discrimination of extended-spectrum β-lactamases by a novel nitrocefin competition assay. Antimicrob. Agents Chemother. 34:2184-2192. [PMC free article] [PubMed]
39. Patel, A. H., T. J. Foster, and P. A. Pattee. 1989. Physical and genetic mapping of the protein A gene in the chromosome of Staphylococcus aureus 8325-4. J. Gen. Microbiol. 135:1799-1807. [PubMed]
40. Pinho, M. G., H. de Lencastre, and A. Tomasz. 1998. Transcriptional analysis of the Staphylococcus aureus penicillin binding protein 2 gene. J. Bacteriol. 180:6077-6081. [PMC free article] [PubMed]
41. Powell, H. R. 1999. The Rossmann Fourier autoindexing algorithm in MOSFLM. Acta Crystallogr. D 55:1690-1695. [PubMed]
42. Schleifer, K. 1986. Taxonomy of coagulase-negative staphylococci, p. 11-26. In P. A. Mardt and K. H. Schleifer (ed.), Coagulase-negative staphylococci. Almqvist and Wiksell International, Stockholm, Sweden.
43. Sieradzki, K., R. B. Roberts, D. Serur, J. Hargrave, and A. Tomasz. 1999. Heterogeneously vancomycin-resistant Staphylococcus epidermidis strain causing recurrent peritonitis in a dialysis patient during vancomycin therapy. J. Clin. Microbiol. 37:39-44. [PMC free article] [PubMed]
44. Stefanova, M. E., C. Davies, R. A. Nicholas, and W. G. Gutheil. 2002. pH, inhibitor, and substrate specificity studies on Escherichia coli penicillin-binding protein 5. Biochim. Biophys. Acta 1597:292-300. [PubMed]
45. Storoni, L. C., A. J. McCoy, and R. J. Read. 2004. Likelihood-enhanced fast rotation functions. Acta Crystallogr. D 60:432-438. [PubMed]
46. Walsh, T. R., and R. A. Howe. 2002. The prevalence and mechanisms of vancomycin resistance in Staphylococcus aureus. Annu. Rev. Microbiol. 56:657-675. [PubMed]
47. Waxman, D. J., and J. L. Strominger. 1983. Penicillin-binding proteins and the mechanism of action of beta-lactam antibiotics. Annu. Rev. Biochem. 52:825-869. [PubMed]
48. Wyke, A. W., J. B. Ward, M. V. Hayes, and N. A. Curtis. 1981. A role in vivo for penicillin-binding protein-4 of Staphylococcus aureus. Eur. J. Biochem. 119:389-393. [PubMed]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)