PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Cancer Res. Author manuscript; available in PMC 2010 December 15.
Published in final edited form as:
PMCID: PMC2795008
NIHMSID: NIHMS155235

Reduced tumor necrosis factor receptor-associated death domain expression is associated with prostate cancer progression

Abstract

By using LNCaP and its derivative cell lines, we first observed an association between TNF-α resistance and hormone independence. Moreover, we found that the expression of tumor necrosis factor receptor-associated death domain (TRADD) was reduced in androgen deprivation independent (AI) cells compared to that in androgen deprivation dependent (AD) cells. TRADD is a crucial transducer for TNF-α-induced NF-κB activation. Knocking-down TRADD expression in LNCaP cells impaired TNF-α-induced NF-κB activation and AR repression, while overexpression of TRADD in C4-2B cells restored their sensitivity to TNF-α. Finally, we found that androgen deprivation reduces TRADD expression in vitro and in vivo, suggesting androgen deprivation therapy may promote the development of TNF-α resistance by reducing TRADD expression during prostate cancer progression.

Introduction

Prostate cancer is the most common malignancy and one of the leading causes of cancer death in North American men. Initially, most prostate cancers are responsive to androgen deprivation therapy, which is achieved by chemical or surgical castration. However, these cancers relapse eventually and ultimately progress to castration-recurrent disease that is resistant to not only hormone-deprivation therapy but also other systemic chemotherapy (1, 2). None-the-less, androgen receptor (AR) signaling remains critical for castration recurrent prostate cancers (3, 4).

The tumor necrosis factor α (TNF-α) pathway is also aberrantly regulated during prostate cancer progression (5). TNF-α is a pleiotropic cytokine that exerts a variety of functions in inflammation, immunity, cell differentiation, cell proliferation, and paradoxically, cell death (6). TNF-α is produced primarily by immune cells. However, it is also produced by numerous other cell types, including epithelial cells of human prostate cancer (7). TNF-α binds to the TNF-α-receptor (TNFR1), leading to phosphorylation, ubiquitination and proteasome-mediated degradation of the inhibitor of κB (IκB), which binds to and inhibits nuclear factor-κB (NF-κB) activation by forming a complex in the cytoplasm. Degradation of IκB results in the release of NF-κB, which then translocates to the nucleus. In nucleus, NF-κB regulates the transcription of target genes, which promote cell proliferation or inflammatory responses. In most cells, TNF-α activates Caspase-8 and induces apoptosis only when NF-κB activation is hampered (8). However, in prostate cancer LNCaP cells, even NF-κB signaling is activated, TNF-α can still induce cell death in a dose-dependent manner (9). This apparent discrepancy may be explained by the negative regulation of androgen receptor expression and activity by NF-κB (10, 11). Interestingly, AI prostate cancer cells are mostly resistant to TNF-α while AD cells are sensitive to it, suggesting an association between androgen deprivation and TNF-α susceptibility (12). However, it remains unclear how prostate cancer cells lose their sensitivity to TNF-α as they progress.

Tumor necrosis factor receptor-associated death domain (TRADD) was one of the first identified TNF-R1 associated proteins (13). TRADD contains a C-terminal death domain that is 23% identical to the death domain of TNFR1 and can directly interact with TNFR1 (13). The N-terminus of TRADD interacts with the TNFR-associated factors TRAF1 (14), TRAF2 (15) and TRAF3 (16). Thus, TRADD mediates TNF-R1-induced apoptosis as well as NF-κB activation (13). Recent knockout studies also revealed TRADD-mediated functions in Toll-like receptor signaling and antiviral immune responses (17, 18).

In the current manuscript, we report an association between reduced TRADD expression and TNF-α resistance in AI prostate cancer cell lines. Our data demonstrate that TRADD is critical for TNF-α-induced NF-κB activation and AR suppression in prostate cancer. Furthermore, we show that androgen deprivation decreases TRADD expression in vitro and in vivo, suggesting that prostate cancer cells may lose their TNF-α sensitivity after androgen deprivation therapy.

Materials and Methods

Materials

LNCaP were purchased from the American Type Tissue Collection (Manassas, VA). C4, C4-2 and C4-2B cells were purchased from ViroMed laboratories (Minnetonka, MN).

pcDNA wt TRADD and TRADDΔ301 were gifts from Dr. T. Tsuruo (University of Tokyo, Tokyo, Japan). pcDNA IκBα SS/AA was a gift from Dr. D. D. Billadeau (Mayo Clinic, Rochester, MN). siRNA-A (no target siRNA), RIP siRNA (h2) and TRADD siRNA were purchased from Santa Cruz Biotech.

The following antibodies were used in this study: Anti- AR (p21) (Millipore); anti-PSA (c-19), anti-ERK2 and anti-RIP1(k-20) (Santa Cruz Biotech); anti-phospho-IκBα (ser32/36) (5A5), anti-Lamin A/C and anti-α-Tubulin (Cell Signaling); anti-TRADD, anti-IκBα and anti-NF-κB p65 (BD Transduction Lab); anti-FADD (BD Pharmingen); anti-TNF-α neutralizing and anti-TNF-R1 (R&D Systems).

Recombinant human TNF-α was purchased from CHEMICON. Dutasteride was obtained from GlaxoSmithKline. Methyltrienolone (R1881) was purchased from DuPont.

RNA isolation, amplication and qRT-PCR

Total RNA from cultured cells was isolated by Trizol® (Invitrogen) according to the manufacturer's instructions. cDNA was prepared from 5 μg total RNA using the SuperScript III first strand synthesis system (Invitrogen) following the manufacturer's instructions.

Tissues obtained at prostatectomy were frozen in Optimal Cutting Temperature (OCT) (Tissue Tek OCT, Sakura Finetek, Torrance, CA). Frozen prostate samples embedded in OCT were used for separate laser capture microdissection (LCM) of stroma, benign and malignant epithelium as indicated. Approximately 2000-3000 cells per sample were collected using the Arcturus Veritas™ LCM System (Mountain View, CA), and used for isolation of total RNA followed by two rounds of linear amplification as we have previously described (19, 20). Primers specific for genes of interest were designed using the NCBI web-based primer design tool Primer-BLAST 1. First strand cDNA templates were generated from 1 μg of amplified RNA using 1 μg of random primers (Invitrogen) and SuperScript II reverse transcriptase (Invitrogen).

qRT-PCR was performed with SYBR green PCR Master Mix (Applied Biosystems) on an Applied Biosystems System Sequence Detector 7700HT. All reactions were assessed for quality by examination of both amplification and dissociation curves. Samples were normalized using GAPDH or RPL13A.

Primer sequences used in this study are the following: AR Fwd: GGAACAGCAACCTTCACAGC; AR Rev: CTTTAAGGTCAGCGGAGCAG; TRADD Fwd: CGCATACCTGTTTGTGGAGTC; TRADD Rev: CGGTGGATCTTCAGCAATCTG; RPL13A Fwd CCTGGAGGAGAAGAGGAAAGAGA RPL13A Rev TTGAGGACCTCTGTGTATTTGTCAA. Human GAPDH primers were purchased from Applied Biosystems.

Cell lysate preparation and Western blotting assays

Whole-cell lysates were prepared in RIPA buffer with a complete protease inhibitor cocktail (Santa Cruz Biotech). Nuclear and cytoplasmic protein fractions were prepared with a Nuclear Extraction Kit according to the manufacture's instructions (Millipore). Equal amounts of protein (30–80 μg) were loaded onto 10% NuPage Bis-Tris gels (Invitrogen), and electrophoresis was performed according to the manufacturer's instructions. Proteins were blotted onto nitrocellulose membranes. Blots were probed with antibodies to evaluate protein expression.

Transfection and luciferase assay

Transfections by electroporation were performed as described previously (21). For luciferase assays, cells were harvested and lysed 2-3 days after transfections. Firefly luciferase and Renilla luciferase activities in cell lysates were determined using a dual luciferase reporter assay (Promega, Madison, WI). Relative luciferase units (RLU) were calculated as indicators of transcriptional activity.

Cell viability assay

Cells were seeded in 96-well tissue culture plates at a density of 3000 or 5000 cells per well and treated as indicated. Cell viability was assessed with the Cell Titer 96 Aquous One solution cell proliferation assay (Promega, Madison, WI) according to the manufacturer's instructions.

Clinical protocols

All procedures involving human subjects were approved by Institutional Review Boards of participating institutions; all subjects signed written informed consent. Prostate tissue samples were obtained from a clinical trial evaluating Dutasteride (GlaxoSmithKline, Research Triangle Park, NC) prior to radical prostatectomy (RP) as previously described (22). Eighty-one men aged 45-80 years with clinically localized PCa (T1c-T2b), Gleason scores <7, and serum PSA 2.5-10 ng/dL were randomized to immediate RP (n=25) or four months of Dutasteride 0.5 mg (n=26) or 3.5 mg (n=24) orally daily preceding RP. Prostate tissue samples were also obtained from a recently completed clinical trial of neoadjuvant castration therapy prior to prostatectomy. Fifteen men aged 18 or older with clinically localized PCa (T1c-T2b), Gleason scores <7 and serum PSA <20 ng/dl were randomized to three weeks of castration with either leuprolide and Bicalutamide (7.5 mg injection and 50mg orally daily, respectively; n=7) or castration with transdermal estradiol (0.6mg every 3 days; n=8). Untreated prostate tissue samples were obtained from men undergoing standard radical prostatectomy as described previously (23).

Prostate cancer xenograft tumors and immunohistochemistry staining

AD and AI versions of LuCaP 23.1 and LuCaP 35 prostate cancer xenografts were generously provided by Dr. Robert L. Vessella (University of Washington, Seattle, WA). Tumors were propagated in SCID mice as described (24). Formalin-fixed, paraffin-embedded tissues were cut into 5μm sections, deparaffinized, and rehydrated in a graded series of ethanol dilutions. Immunohistochemistry was performed with the IHC select® Immunoperoxidase Secondary Detection System (Millipore) according to the manufacturer's instructions.

Results

TNF-α reduces prostate cancer cell viability through inhibition of AR expression and activity

Although elevated TNF-α has been documented in prostate cancers (7), the effects of TNF-α on prostate cancer cells still mainly remain unclear. Thus, we investigated the effect of TNF-α on the viability of LNCaP cells. The results showed that TNF-α reduced LNCaP cell viability in a dose-dependent manner (Fig. 1A). Given the fact that TNF-α activates NF-κB in LNCaP cells, it is paradoxical that TNF-α reduces LNCaP cell viability. Mizokami et al. (7) first reported that TNF-α represses AR expression in LNCaP cells and suggested that this might be the underlying mechanism by which TNF-α inhibits prostate cancer cell growth and survival. To confirm the effect of TNF-α on AR expression, we examined AR expression by Western blotting after treating LNCaP cells with different doses of TNF-α. As expected, TNF-α reduced AR and PSA (Prostate Specific Antigen) expression in a dose-dependent manner (Fig. 1B). To confirm that AR reduction was indeed caused by TNF-α, we used a TNF-α specific antibody to neutralize TNF-α. TNF-α neutralizing antibody totally abolished the TNF-α induced reduction of IκBα, AR and PSA expression (Fig.1C left). Real time qRT-PCR also showed that the TNF-α neutralizing antibody blocked the TNF-α-induced reduction of AR at mRNA level (Fig.1C right). To assess whether TNF-α-induced down-regulation of AR leads to a suppression of AR transcriptional activity, we used a PSA promoter-driven luciferase reporter to monitor AR transcriptional activity. R1881, a synthetic androgen, greatly induced AR transcriptional activity but co-treatment with TNF-α significantly suppressed androgen-induced AR transactivation (Fig. 1D), indicating that TNF-α negatively regulates AR transcriptional activity.

Figure 1
TNF-α reduces prostate cancer cell viability through AR suppression

TNF-α-induced AR repression requires NF-κB activation

Because NF-κB has been suggested to mediate TNF-α-induced AR repression (11), we blocked NF-κB activation with an IκBα super suppressor (pcDNA-IκBαSS/AA-HA) to test whether TNF-α-induced AR suppression requires NF-κB activation (25). TNF-α-induced reduction of AR and PSA expression was totally blocked by IκBα super suppressor (Supplementary Fig. 1), suggesting that NF-κB is required for TNF-α-induced down-regulation AR expression and activity.

AD and AI prostate cancer cells deferentially respond to TNF-α

To determine whether TNF-sensitivity is altered during prostate cancer progression, we utilized a prostate cancer cell line progression model. The model is comprised of LNCaP, C4, C4-2 and C4-2B cell lines (26-28). LNCaP cells are sensitive to androgen deprivation and have limited metastatic ability. On the other hand, C4, C4-2 and C4-2B are resistant to androgen deprivation and display more aggressive phenotypes. In many respects, the development of these AI cell lines recapitulates the progression of prostate cancer in vivo. Consistent with previous reports (9, 11), C4-2 and C4-2B are mostly resistant to TNF-α (Fig. 2A). In contrast to a nearly 50% reduction in LNCaP cells, TNF-α only reduced C4-2 and C4-2B cell viability by less than 20%, suggesting prostate cancers may develop TNF-α resistance as they progress.

Figure 2
AD and AI prostate cancer cells deferentially respond to TNF-α

We then asked whether TNF-α-induced AR suppression is absent or limited in AI cell lines. We treated LNCaP and C4-2 cells with or without 20ng/ml TNF-α and evaluated the expression of AR and PSA. In contrast to that in LNCaP cells, TNF-α-induced AR and PSA reduction was almost absent in C4-2 cells (Fig. 2B left). A TNF-α dose-response assay indicated that even as high as 50ng/ml TNF-α still did not significantly reduce AR or PSA expression in C4-2B cells (Fig. 2B right), confirming the resistance to TNF-α in AI cells. Given the critical role of NF-κB in TNF-α-induced AR repression, we speculated that NF-κB activation induced by TNF-α might be blocked or reduced in AI cells. Therefore, we compared the phosphorylation levels of IκBα in LNCaP and C4-2B cells after 1 hour treatment with 20ng/ml TNF-α. Consistent with the results of the NF-κB luciferase assay, TNF-α-induced phosphorylation of IκBα at serine 32 and serine 36 was significantly decreased (59%) in C4-2B cells compared to that in LNCaP cells (Fig. 2C). Accordingly, the reduction of total IκBα in LNCaP cells (51%, 2nd lane vs. 1st lane) was higher than that in C4-2B cells (34%, 4th lane vs. 3rd lane). We then compared TNF-α-induced NF-κB activity between these cell lines by a reporter-luciferase assay. Consistent with the results of IκBα phosphorylation, TNF-α strongly induces NF-κB activation in LNCaP cells. Although TNF-α-induced NF-κB activation was not totally blocked in C4-2 and C4-2B cells, the amplitude of NF-κB activation was much lower than that in LNCaP cells (Fig. 2D), suggesting TNF-α/NF-κB signaling pathway is impaired in AI cells. Collectively, these studies indicate that the TNF-α resistance in AI cells might be due to the impairment of the TNF-α/NF-κB signaling pathway.

TRADD expression level is correlated with TNF-α sensitivity in AD and AI prostate cancer cells

To explore the underlying mechanism by which AI cells develop increased resistance to TNF-α, we next examined the expression of TNFR1 in AD and AI cells. Consistent with previous studies (11, 29), TNFR1 expression was comparable at the protein level in all these cell lines (Fig. 3A). We then examined the expression of other important signal transducers in the TNF-α signaling pathway including TRADD, FADD (FAS-associated death domain) and RIP1 (receptor-interacting protein 1). Interestingly, TRADD expression was significantly decreased in C4-2 and C4-2B cells compared to LNCaP cells, while RIP1 and FADD levels were comparable (Fig.3A). To evaluate the mRNA level of TRADD, we designed a pair of TRADD specific primers for real-time qRT-PCR assays. As shown in Fig. 3B, overexpressing TRADD increased both protein and mRNA levels of TRADD, while knocking-down TRADD reduced both, suggesting these primers are specific for TRADD. Using these primers, we then compared TRADD mRNA levels among these cell lines. Consistent with the protein level, the mRNA level of TRADD declined from LNCaP to C4-2B (Fig. 3C), suggesting a transcriptional regulation on TRADD during prostate cancer progression.

Figure 3
TRADD expression level is correlated with TNF-α sensitivity

TRADD is critical for TNF-α-induced NF-κB activation and AR suppression

To test whether TRADD plays a critical role in TNF-α-induced NF-κB activation and AR suppression, we knocked-down TRADD expression by TRADD siRNA in LNCaP cells. In TRADD competent LNCaP cells, TNF-α treatment resulted in a strong IκBα phosphorylation, which consequentially reduced its expression (Fig. 2C and Fig. 4A). However, in TRADD knocked-down cells, the TNF-induced IκBα phosphorylation was inhibited significantly (56% reduction). Accordingly, the total IκBα reduction was not as significant as that in TRADD competent cells (Fig. 4A), suggesting that NF-κB activation is impaired in TRADD deficient cells. To further confirm the role of TRADD in TNF-α-induced NF-κB activation, we evaluated NF-κB activity with a luciferase reporter assay. As shown in Fig. 4B, TNF-α-induced NF-κB activity was greatly inhibited in TRADD deficient cells, demonstrating that TRADD is important for TNF-α-induced NF-κB activation.

Figure 4
TRADD is critical for TNF-α-induced NF-κB activation and AR suppression

However, knocking-down TRADD did not completely block TNF-α-induced IκBα phosphorylation and NF-κB activation. It might be due to limited efficiency of TRADD siRNA. More importantly, recent studies on TRADD knockout mice suggest that a strict dependence on TRADD for TNF-α-induced NF-κB activation is cell-type specific (30). In cells with very low level of RIP1, such as fibroblasts, TRADD deficiency almost completely abolishes TNFR1-mediated signaling. However, in cells with abundant RIP1 expression, such as macrophages, RIP1 is sufficient to mediate TNFR1 signaling in the absence of TRADD (17, 18). As shown in Fig.3A, prostate cancer cells express abundant RIP1. Therefore, it is likely that RIP1 enables TNF-α to activate NF-κB at some level even in absence of TRADD.

To determine whether TRADD is critical for the effects of TNF-α on AR suppression, we next evaluated the AR expression and activity after knocking-down TRADD in LNCaP cells. As expected, knocking-down TRADD almost abolished the AR reduction induced by TNF-α (Fig. 4C). Accordingly, PSA reduction was also abolished in TRADD deficient cells. Furthermore, we evaluated the nuclear AR levels in TRADD competent and deficient cells. LNCaP were cultured in medium containing 9% charcoal-stripped serum (CSS) and treated with or without androgens and TNF-α. Nuclear AR levels were assessed as indicators for AR activity. As expected, androgens greatly increased nuclear AR levels in cells transfected with control siRNA, but co-treatment with TNF-α significantly reduced the nuclear AR accumulation induced by androgens (Fig. 4D). However, in cells transfected with TRADD siRNA, TNF-α did not significantly reduce nuclear AR levels. To further confirm that TRADD is important for TNF-α-induced AR suppression, we performed immunofluorescence staining with an AR-specific monoclonal antibody to visualize AR expression and localization. As shown in supplemental Fig. 2, AR was localized primarily within the cytoplasm in the absence of androgens. Androgen treatment resulted in increased AR expression and also translocation of AR into the nucleus. Co-treatment with TNF-α significantly suppressed androgen-induced AR translocation in TRADD competent cells but not in TRADD deficient cells, which is consistent with what we observed by nuclear AR Western blotting.

Collectively, these data suggest that TRADD plays a critical role in TNF-α-induced NF-κB activation and AR suppression. Interestingly, the TNF-α response pattern in TRADD knock-down LNCaP cells was very similar to that in C4-2B cells, implying that TNF-α resistance in AI cells may be due to loss of TRADD expression.

Ectopic expression of TRADD restores the TNF-α-induced AR repression in AI cells

To confirm that the reduced TRADD expression in AI cells contributes to the resistance to TNF-α-induced AR repression, we tested whether overexpression of TRADD in C4-2B cells could restore their TNF-α sensitivity. Because TRADD signals not only NF-κB activation but also cell apoptosis (13), we used two different TRADD constructs: wild type TRADD and TRADDΔ301. In the latter construct, 12 amino acids at the c-terminal end were deleted (31). Deletion of the C-terminal 12 amino acids abolishes its apoptosis-inducing ability but does not abolish the ability to activate NF-κB (13). As expected, overexpression of either wt-TRADD or TRADDΔ301 in C4-2B cells potentiated TNF-α to activate NF-κB (Fig. 5A), confirming that TRADD mediated activation is independent of apoptosis. Similarly, ectopic expression of either wt-TRADD or TRADDΔ301 both enabled TNF-α to repress AR and PSA expression (Fig. 5B), suggesting that NF-κB activation, instead of apoptotic signals, mediates TNF-α-induced AR repression. Furthermore, ectopic expression of either wt-TRADD or TRADDΔ301 both re-sensitized C4-2B cells to TNF-α treatment (Fig. 5C). Because TRADDΔ301 lost its ability to directly induce apoptosis (31), the reduction of cell viability is most likely due to AR repression instead of TNF-α-induced apoptosis.

Figure 5
Ectopic expression of TRADD restores the TNF-α-induced AR suppression in AI cells

Androgen deprivation suppresses TRADD expression in vitro and in vivo

The next issue we addressed is to determine the mechanism underlying the reduced TRADD expression in AI cell lines. Because these cell lines were developed under selective pressure of androgen deprivation, we questioned whether androgen deprivation affects TRADD expression. We investigated the TRADD expression in cells cultured in hormone-free medium and found removal of hormone significantly reduced TRADD expression in LNCaP cells. Likewise, treatment with the anti-androgen Bicalutamide or the SRD5A inhibitor Dutasteride also significantly decreased TRADD expression (Fig. 6A left), suggesting that androgens are required to maintain a high level of TRADD expression. Conversely, treatment with 1nM R1881 for 48 hours greatly increased TRADD expression, which could be blocked by Bicalutamide (Fig. 6A right).

Figure 6
Androgen deprivation reduces TRADD expression in intro and in vivo

To determine whether TRADD expression is affected by androgen deprivation in vivo, we evaluated TRADD expression in prostate tissue samples from a neoadjuvant clinical trial of Dutasteride. As expected, following 4 months of Dutasteride treatment, tissue dihydrotestosterone (DHT) levels were significantly lower than that found in untreated prostates, with concomitant increases in tissue testosterone. However, TRADD transcript levels were not significantly different between prostate epithelial cells acquired from untreated and Dutasteride treated prostate tissue samples (Supplemental Fig. 3). As documented previously, although Dutasteride lowers DHT levels, there are concomitant higher levels of testosterone. Thus, the lack of a Dutasteride effect on TRADD in vivo might be due to high levels of testosterone. We next measured TRADD expression in radical prostatectomy samples resected from men treated with standard androgen deprivation therapy with the LHRH agonist Luprolide and the anti-androgen Bicalutamide, or with high doses of estradiol (E2). Compared to transcript levels measured in benign untreated prostate epithelium, TRADD transcript levels in both benign (p<0.001) and neoplastic epithelium (p<0.04) treated with Luprolide + Bicalutamide or E2 were significantly lower than TRADD levels in untreated benign epithelium (Fig. 6B), confirming a critical role of androgen on TRADD expression. Interestingly, we also observed that in either the Luprolide + Bicalutamide or the E2 group levels of TRADD transcripts in benign epithelium was lower than that in neoplastic epithelium (Fig. 6B), suggesting that TRADD is differentially expressed between normal and cancerous prostate tissues.

Aberrant TRADD expression is associated with prostate cancer progression

To further assess the expression of TRADD in human prostate cancers, we used laser capture microdissection to acquire benign and cancerous prostate epithelial cells from 14 individuals with localized prostate adenocarcinoma. We quantitated TRADD transcripts by qRT-PCR using the RPL13 mRNA as a reference control. Compared to benign epithelium, the expression of TRADD was significantly lower in cancerous epithelium (p=0.0138) (Fig. 6C).

Data from LNCaP cell line model suggested that TRADD expression might be altered as prostate cancers progress. To test whether TRADD expression is decreased during prostate cancer progression in vivo, we utilized the LuCaP 23.1 and LuCaP 35 prostatae cancer xenograft models. LuCaP 23.1 and 35 tumors grow in intact immunocompromised mice and serve as a model for prostate cancer progression (32, 33). Both original LuCaP 23.1 and 35 tumors regressed after castration but eventually recurred and became AI tumors. TRADD immunohistochemistry staining show that the original LuCaP 23.1 and LuCaP 35 tumors (AD tumors) express relatively high level of TRADD, but castration recurrent LuCaP 23.1 AI and LuCaP 35 AI tumors express very little TRADD (Fig. 6D and data not shown). Thus, both cell line and xenograft models strongly suggest that TRADD expression might be reduced as prostate cancer progresses.

Discussion

It is well established that both androgen/AR and TNF-α/NFκB signaling pathways are important for prostate cancer growth. The mutual inhibition between these two pathways has been documented (34-36). Consistent with these studies, we demonstrated that TNF-α induces AR suppression in prostate cancer cells via NF-κB, which may mediate TNF-α-induced reduction in cell viability. Unlike in many other cell types, activation of NF-κB by TNF-α in prostate cells does not promote cell proliferation. Conversely, it has a proapoptotic effect (37). The mechanisms underlying this phenomenon are largely unknown. One potential mechanism is that NF-κB induces DR4 expression, which promotes TRAIL-induced cell death in prostate cancer cells (38). Our data suggest that TNF-α-induced AR suppression may be another important underlying mechanism.

In contrast to our finding, some other studies suggested that AR and NF-κB might enhance each other's activity (39, 40). In a recent report, Jin et al. (41) observed that constitutive activation of NF-κB in prostate cancer xenografts (in which IκBα was knocked down) is correlated with increased AR expression and their data implied that NF-κB RelA increases AR expression and contributes to prostate cancer progression. Chen and Sawyers (42) identified four NF-κB binding sites in the PSA core enhancer and demonstrated that these sites are directly bound by NF-κB and activate PSA expression in the absence of androgen, suggesting that constitutively activate NF-κB might contribute to prostate cancer progression. However, Cinar et al. (43) soon reported a fifth NF-κB binding site in the core of the PSA promoter, which is suppressive to AR transcriptional activity. Binding of p65, but not p50, to this site represses, instead of activates, AR-mediated PSA transcription. Collectively, the precise effect of TNF-α/NF-κB on AR activity still remains unclear and it is likely dependent on the specific cellular milieu.

The correlation between androgen deprivation resistance and TNF-α resistance in prostate cells has been documented (11, 12). Ko et al. reported that increased B-Myb (a NF-κB coregulator) expression in AI cells affects the inhibitory effect of NF-κB on the AR promoter, providing a potential mechanism for TNF-α resistance in AI prostate cancer cells (11). In our study, we found an association between reduced TRADD expression and TNF-α resistance in prostate cancer cell lines. We also demonstrated that TRADD plays an important role in mediating TNF-α-inducing AR suppression and that loss of TRADD expression is associated with TNF-α resistance. Finally, we provided evidence that androgen deprivation leads to a reduction of TRADD both in vivo and in vitro. Considering the critical role of TRADD in TNF-α-mediated signaling, we speculate that androgen deprivation therapy contributes to the development of TNF-α resistance during prostate cancer progression. Therefore, our findings provide a potential mechanism by which prostate cancer develops TNF-α resistance after androgen deprivation therapy.

Supplementary Material

Acknowledgments

We are grateful for Drs. T. Tsuruo, R. L. Vessella and D. D. Billadeau for kindly providing experimental materials. We also would like to thank Roger Coleman for assistance with analyses.

This work was supported in part by grants from NCI (CA125747, CA 121277 and CA091956), the T. J. Martell foundation and the Pacific Northwest Prostate Cancer SPORE P50CA97186.

References

1. Klein KA, Reiter RE, Redula J, et al. Progression of metastatic human prostate cancer to androgen independence in immunodeficient SCID mice. Nat Med. 1997;3:402–8. [PubMed]
2. Debes JD, Tindall DJ. Mechanisms of androgen-refractory prostate cancer. N Engl J Med. 2004;351:1488–90. [PubMed]
3. Feldman BJ, Feldman D. The development of androgen-independent prostate cancer. Nat Rev Cancer. 2001;1:34–45. [PubMed]
4. Zegarra-Moro OL, Schmidt LJ, Huang H, Tindall DJ. Disruption of androgen receptor function inhibits proliferation of androgen-refractory prostate cancer cells. Cancer Res. 2002;62:1008–13. [PubMed]
5. Royuela M, Rodriguez-Berriguete G, Fraile B, Paniagua R. TNF-alpha/IL-1/NF-kappaB transduction pathway in human cancer prostate. Histol Histopathol. 2008;23:1279–90. [PubMed]
6. Wajant H, Pfizenmaier K, Scheurich P. Tumor necrosis factor signaling. Cell Death Differ. 2003;10:45–65. [PubMed]
7. Mizokami A, Gotoh A, Yamada H, Keller ET, Matsumoto T. Tumor necrosis factor-alpha represses androgen sensitivity in the LNCaP prostate cancer cell line. J Urol. 2000;164:800–5. [PubMed]
8. Van Antwerp DJ, Martin SJ, Kafri T, Green DR, Verma IM. Suppression of TNF-alpha-induced apoptosis by NF-kappaB. Science. 1996;274:787–9. [PubMed]
9. Chopra DP, Menard RE, Januszewski J, Mattingly RR. TNF-alpha-mediated apoptosis in normal human prostate epithelial cells and tumor cell lines. Cancer Lett. 2004;203:145–54. [PubMed]
10. Supakar PC, Jung MH, Song CS, Chatterjee B, Roy AK. Nuclear factor kappa B functions as a negative regulator for the rat androgen receptor gene and NF-kappa B activity increases during the age-dependent desensitization of the liver. J Biol Chem. 1995;270:837–42. [PubMed]
11. Ko S, Shi L, Kim S, Song CS, Chatterjee B. Interplay of nuclear factor-kappaB and B-myb in the negative regulation of androgen receptor expression by tumor necrosis factor alpha. Mol Endocrinol. 2008;22:273–86. [PubMed]
12. Zhao X, van Steenbrugge GJ, Schroder FH. Differential sensitivity of hormone-responsive and unresponsive human prostate cancer cells (LNCaP) to tumor necrosis factor. Urol Res. 1992;20:193–7. [PubMed]
13. Hsu H, Xiong J, Goeddel DV. The TNF receptor 1-associated protein TRADD signals cell death and NF-kappa B activation. Cell. 1995;81:495–504. [PubMed]
14. Arch RH, Gedrich RW, Thompson CB. Tumor necrosis factor receptor-associated factors (TRAFs)--a family of adapter proteins that regulates life and death. Genes Dev. 1998;12:2821–30. [PubMed]
15. Park YC, Ye H, Hsia C, et al. A novel mechanism of TRAF signaling revealed by structural and functional analyses of the TRADD-TRAF2 interaction. Cell. 2000;101:777–87. [PubMed]
16. Michallet MC, Meylan E, Ermolaeva MA, et al. TRADD protein is an essential component of the RIG-like helicase antiviral pathway. Immunity. 2008;28:651–61. [PubMed]
17. Ermolaeva MA, Michallet MC, Papadopoulou N, et al. Function of TRADD in tumor necrosis factor receptor 1 signaling and in TRIF-dependent inflammatory responses. Nat Immunol. 2008;9:1037–46. [PubMed]
18. Pobezinskaya YL, Kim YS, Choksi S, et al. The function of TRADD in signaling through tumor necrosis factor receptor 1 and TRIF-dependent Toll-like receptors. Nat Immunol. 2008;9:1047–54. [PMC free article] [PubMed]
19. Nelson PS, Clegg N, Arnold H, et al. The program of androgen-responsive genes in neoplastic prostate epithelium. Proc Natl Acad Sci U S A. 2002;99:11890–5. [PubMed]
20. Pritchard CC, Hsu L, Delrow J, Nelson PS. Project normal: defining normal variance in mouse gene expression. Proc Natl Acad Sci U S A. 2001;98:13266–71. [PubMed]
21. Huang H, Cheville JC, Pan Y, Roche PC, Schmidt LJ, Tindall DJ. PTEN induces chemosensitivity in PTEN-mutated prostate cancer cells by suppression of Bcl-2 expression. J Biol Chem. 2001;276:38830–6. [PubMed]
22. Gleave M, Qian J, Andreou C, et al. The effects of the dual 5alpha-reductase inhibitor dutasteride on localized prostate cancer--results from a 4-month pre-radical prostatectomy study. Prostate. 2006;66:1674–85. [PubMed]
23. True L, Coleman I, Hawley S, et al. A molecular correlate to the Gleason grading system for prostate adenocarcinoma. Proc Natl Acad Sci U S A. 2006;103:10991–6. [PubMed]
24. Dehm SM, Schmidt LJ, Heemers HV, Vessella RL, Tindall DJ. Splicing of a novel androgen receptor exon generates a constitutively active androgen receptor that mediates prostate cancer therapy resistance. Cancer Res. 2008;68:5469–77. [PMC free article] [PubMed]
25. Wang CY, Mayo MW, Baldwin AS., Jr TNF- and cancer therapy-induced apoptosis: potentiation by inhibition of NF-kappaB. Science. 1996;274:784–7. [PubMed]
26. Horoszewicz JS, Leong SS, Chu TM, et al. The LNCaP cell line--a new model for studies on human prostatic carcinoma. Prog Clin Biol Res. 1980;37:115–32. [PubMed]
27. Wu HC, Hsieh JT, Gleave ME, Brown NM, Pathak S, Chung LW. Derivation of androgen-independent human LNCaP prostatic cancer cell sublines: role of bone stromal cells. Int J Cancer. 1994;57:406–12. [PubMed]
28. Thalmann GN, Sikes RA, Wu TT, et al. LNCaP progression model of human prostate cancer: androgen-independence and osseous metastasis. Prostate. 2000 Jul 1;44(2):91–103. 44. [PubMed]
29. Nakajima Y, DelliPizzi AM, Mallouh C, Ferreri NR. TNF-mediated cytotoxicity and resistance in human prostate cancer cell lines. Prostate. 1996;29:296–302. [PubMed]
30. Natoli G, Austenaa LM. A birthday gift for TRADD. Nat Immunol. 2008;9:1015–6. [PubMed]
31. Rokudai S, Fujita N, Kitahara O, Nakamura Y, Tsuruo T. Involvement of FKHR-dependent TRADD expression in chemotherapeutic drug-induced apoptosis. Mol Cell Biol. 2002;22:8695–708. [PMC free article] [PubMed]
32. Ellis WJ, Vessella RL, Buhler KR, et al. Characterization of a novel androgen-sensitive, prostate-specific antigen-producing prostatic carcinoma xenograft: LuCaP 23. Clin Cancer Res. 1996;2:1039–48. [PubMed]
33. Corey E, Quinn JE, Buhler KR, et al. LuCaP 35: a new model of prostate cancer progression to androgen independence. Prostate. 2003;55:239–46. [PubMed]
34. Altuwaijri S, Lin HK, Chuang KH, et al. Interruption of nuclear factor kappaB signaling by the androgen receptor facilitates 12-O-tetradecanoylphorbolacetate-induced apoptosis in androgen-sensitive prostate cancer LNCaP cells. Cancer Res. 2003;63:7106–12. [PubMed]
35. Norata GD, Tibolla G, Seccomandi PM, Poletti A, Catapano AL. Dihydrotestosterone decreases tumor necrosis factor-alpha and lipopolysaccharide-induced inflammatory response in human endothelial cells. J Clin Endocrinol Metab. 2006;91:546–54. [PubMed]
36. Nelius T, Filleur S, Yemelyanov A, et al. Androgen receptor targets NFkappaB and TSP1 to suppress prostate tumor growth in vivo. Int J Cancer. 2007;121:999–1008. [PMC free article] [PubMed]
37. Beg AA, Baltimore D. An essential role for NF-kappaB in preventing TNF-alpha-induced cell death. Science. 1996;274:782–4. [PubMed]
38. Jin F, Liu X, Zhou Z, et al. Activation of nuclear factor-kappaB contributes to induction of death receptors and apoptosis by the synthetic retinoid CD437 in DU145 human prostate cancer cells. Cancer Res. 2005;65:6354–63. [PubMed]
39. Death AK, McGrath KC, Sader MA, et al. Dihydrotestosterone promotes vascular cell adhesion molecule-1 expression in male human endothelial cells via a nuclear factor-kappaB-dependent pathway. Endocrinology. 2004;145:1889–97. [PubMed]
40. Lee SO, Lou W, Nadiminty N, Lin X, Gao AC. Requirement for NF-(kappa)B in interleukin-4-induced androgen receptor activation in prostate cancer cells. Prostate. 2005;64:160–7. [PubMed]
41. Jin RJ, Lho Y, Connelly L, et al. The nuclear factor-kappaB pathway controls the progression of prostate cancer to androgen-independent growth. Cancer Res. 2008;68:6762–9. [PMC free article] [PubMed]
42. Chen CD, Sawyers CL. NF-kappa B activates prostate-specific antigen expression and is upregulated in androgen-independent prostate cancer. Mol Cell Biol. 2002;22:2862–70. [PMC free article] [PubMed]
43. Cinar B, Yeung F, Konaka H, et al. Identification of a negative regulatory cis-element in the enhancer core region of the prostate-specific antigen promoter: implications for intersection of androgen receptor and nuclear factor-kappaB signalling in prostate cancer cells. Biochem J. 2004;379:421–31. [PubMed]