PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Biochemistry. Author manuscript; available in PMC 2010 October 27.
Published in final edited form as:
PMCID: PMC2793082
NIHMSID: NIHMS150609

Amino acid Asp181 of 5’-flap endonuclease 1 is a useful target for chemotherapeutic development

Abstract

DNA alkylation-induced damage is one of the most efficacious anti-cancer therapeutic strategies. Increased DNA alkylation and decreased DNA repair capacity in cancer cells is responsible for the effectiveness of DNA-alkylating therapies. 5’-Flap endonuclease 1 (Fen1) is an important enzyme involved in base excision repair (BER), specifically in long-patch (LP)-BER. Using the site-directed mutagenesis approach, we have identified an important role for amino acid Asp181 of Fen1 in its endonuclease activity. The Asp181 is thought be involved in Mg2+ binding in the active site. Using structure-based molecular docking of Fen1 targeted to its metal-binding pocket M2 (Mg2+ site), we have identified a potent small molecular weight inhibitor (SMI; NSC-281680) that efficiently blocks the LP-BER. In this study, we have demonstrated that the interaction of this SMI with Fen1 blocked its endonuclease activity, thereby blocking the LP-BER and enhancing the cytotoxic effect of DNA-alkylating agent, Temozolomide (TMZ) in mismatch repair (MMR)-deficient and MMR-proficient colon cancer cells. The results further suggest that blockade of LP-BER by NSC-281680 may bypass other drug resistance mechanisms such as mismatch repair (MMR) defects. Therefore, our findings provide groundwork for the development of highly specific and safer structure-based small molecular inhibitors targeting the BER pathway, which can be used along with existing chemotherapeutic agents, like TMZ, as combination therapy for the treatment of colorectal cancer.

Keywords: Base excision repair, 5’-flap endonuclease 1, small molecular weight inhibitor, colorectal cancer, chemotherapeutic intervention

Introduction

Colorectal cancer develops in a multi-step process involving the functional imbalance between oncogenes, tumor suppressor genes, and DNA repair genes (1). Mutations of the adenomatous polyposis coli (APC), Ki-ras, deleted in colorectal cancer (DCC), and p53 genes play important roles at different stages of colorectal tumorigenesis (2). Mutation of the APC gene is an early event in familial adenomatous polyposis (FAP), a syndrome in which there is an inherited predisposition to colon cancer. The success of the treatment of colon cancer patients depends on matching the most effective therapeutic regimen with the characteristics of the individual tumor. The primary challenge in achieving this goal is the heterogeneity of the disease. In the past 10 years, the overall survival of colon cancer patients has significantly improved with adjuvant drug trials. However, the recurrence rate over five years is still high. Although a great deal has been learned about the molecular events involved in the initiation and progression of colorectal cancer, surgery still remains the primary treatment, followed by chemotherapy. Thus, there is clearly an urgent need for the development of new chemotherapeutic drugs and strategies.

In chemotherapy, DNA-alkylating agents play a central role in the curative treatment of many tumors. However, one of the major obstacles in chemotherapy is the development of chemo-resistance which limits the effectiveness of these agents. The efficacy of the most widely used methylating agent, Temozolomide (TMZ; 4-methyl–5-oxo-2,3,4,6,8-pentazabicyclo[4.3.0]nona-2,7,9-triene-9-carboxamide; NSC-362856), has been attributed to the formation of O6-methyguanine (O6-MeG), a DNA lesion repaired by the protein O6-methyguanine methyl transferase (MGMT). TMZ resistance has been ascribed to elevated levels of MGMT and/or reduced mismatch repair (MMR). Inhibitors of these DNA-repair systems have emerged, but they target mainly the MGMT and MMR pathways. However, more than 80% of the DNA lesions induced by TMZ are N-methylated bases [N7-Methylguanine (N7-MeG), N3-Methylguanine (N3-MeG) and N3-Methyladenine (N3-MeA)] which are recognized by DNA glycosylases and are processed efficiently by the base excision repair (BER) system. Therefore, resistance to TMZ may also be due to robust base excision repair. The blockade of the BER pathway has been overlooked, although in the case of several DNA-alkylating drugs including TMZ, BER is responsible for the repair of 70%, 5% and 9% of N7-MeG, N3-MeG, and N3-MeA lesions, respectively (3). Any defect in the BER pathway can cause an accumulation of these lesions, resulting in cytotoxicity, a process that can be exploited as a chemotherapeutic target in cancer cells (4).

A new and emerging concept is to sensitize cancer cells to DNA-damaging agents by inhibiting various proteins in DNA repair pathways. Small molecular weight inhibitors (SMIs) have been identified by molecular docking or NMR studies to target the BER pathway by inhibiting AP-endonuclaese 1 (APE1) and Pol-β activities (5). Although a number of Pol-β inhibitors have been reported in recent years (5), more potent and selective inhibitors are still needed. The most active SMI identified for Pol-β by NMR chemical-shift mapping is pamoic acid (6). However, this SMI, which inhibits the dRP-lyase activity of Pol-β and blocks Pol-β-directed single-nucleotide (SN)-BER, requires high concentrations of the inhibitor. Since abasic DNA damage can also be repaired by LP-BER, there is a need for agents that can block long-patch (LP)-BER pathway as well, in which 5’-flap endonuclease 1 (Fen1) plays a major role (7). Fen1 recognizes and removes the 5’-flap structure generated by Pol-β during the strand-displacement synthesis. The removal of this flap is essential for the joining of the newly synthesized DNA strand with the parent strand by DNA ligase to complete the repair.

The 5'-flap structure is a common DNA structural intermediate occurring during DNA replication, recombination, and repair. In eukaryotic DNA replication, displacement of an upstream primer by an incoming polymerase can result in the formation of the 5'-flap structure (8). Fen1 cleaves the displaced flap at the single strand/double strand junction. It also acts as a 5'-3' exonuclease. By doing so, Fen1 participates in hydrolysis of double-stranded DNA substrates containing a nick, gap, or 3'-overhang. During lagging strand DNA synthesis, RNA primers are removed by RNase H1. However, this enzyme cannot excise the final 5'-terminal ribonucleotide at the RNA-DNA junction. The completion of RNA primer removal by Fen1 is essential for Okazaki fragment processing in reconstituted replication assays (9, 10). The 5'-flap intermediates are also formed during double-stranded break repair, homologous recombination, and excision repair (11). Thus, Fen1 is an important enzyme with multiple functions in the cell.

Using the site-directed mutagenesis approach, we identified an important role for amino acid Asp181 of Fen1 in its endonuclease activity. Asp181 is thought to be involved in Mg2+ binding in the active site, and thus important for catalytic activity (12). Using structure-based molecular docking of Fen1 and targeting its metal binding pocket M2 (Mg2+ site), which is formed by the amino acid residues Asp179, Asp 181and Asp233 (13), we have identified a potent small molecular weight inhibitor (SMI) which efficiently blocks the LP-BER. In this paper, we have demonstrated that the interaction of this SMI with Fen1 blocked its endonuclease activity, thereby blocking LP-BER and potentiating the cytotoxic effects of TMZ in both MMR-deficient and MMR-proficient colon cancer cells. Therefore, our findings provide a basis for the development of highly specific and safer structure-based small molecular inhibitors, in combination with existing DNA-alkylating agents, as a novel therapeutic strategy for intervention of colorectal cancer.

Materials and Methods

Maintenance of mammalian cell lines

Human colon cancer cell lines HCT-116 (MMR-deficient; ATCC, Manassas, VA) and HCT-116+ch3 (chromosome 3 complimentation, MMR-proficient; Dr. Tom Kunkel, NIEHS, Research Triangle Prak, NC) were grown in McCoy’s 5a medium at 37°C under a humidified atmosphere of 5% CO2. In each case, the medium was supplemented with 10% fetal bovine serum (Hyclone, Logan, UT) 100 U/ml penicillin, and 100 μg/ml streptomycin.

Oligonucleotides and Chemicals

All oligonucleotides were purchased from Sigma-Genosys (Woodlands, TX). Restriction enzymes and T4-polynucleotide kinase (PNK) were purchased from New England Biolabs (Ipswich, MA) whereas radionuclide [γ-32P] ATP was purchased from MP Biomedicals (Solon, OH).

Molecular docking

The protein crystal structure used for in silico screening of the structural site in question was that of the human Fen1-PCNA complex (RCSB Protein Data Bank code: 1UL1) (12). MSROLL was used to generate the molecular surface of 1UL1, which was then used as input for the sphere generation program SPHGEN. A cluster of spheres occupying the site of interest was then selected and manually edited, leaving 50 spheres to be used as the shape based site points. The SHOWBOX program was used to construct a 3-dimensional rectangle, 4 Angstroms in every direction from the sphere cluster, in which the steric and electrostatic environments of the protein were calculated using the GRID program. SYBYL 7.0 (Tripos, St. Louis, MO) was used to convert the PDB file of 1UL1 into the appropriate mol2 format. DOCK was then used to screen approximately 220,000 small molecules from the National Cancer Institute/Developmental Therapeutics Program (NCI/DTP) within the 1UL1 grid. The output was ranked based on predicted energy scores (composed of electrostatic interactions and van der Waals’ forces). The top 40 compounds were obtained from the NCI/DTP for testing. All of the programs listed for this procedure with the exception of SYBYL 7.0 were part of the DOCK5.0 suite developed at UCSF (14).

Purification of His-tagged human Pol-β, Fen1 and DNA ligase I proteins

We purified the hexa-histidine tagged fusion proteins of wild-type Pol-β and Fen1 as described previously with some modifications (15). The Fen1(D181N) construct was made using the Quick Change II site directed mutagenesis kit (Stratagene, USA) according to the manufacturer’s instructions using the sense strand (5'-AAAGTCTATGCTGCGGCTACCGAGGACATGA ATTGCCTCACCTTC-3'), anti-sense strand (5'-GAAGGTGAGGCAATTCATGTCCTCGGTAGCCGCAGCATAGACTTT-3') and the wild type Fen1 as a template. The human APE1 was obtained from Dr. Linda Bloom (University of Florida, Gainesville, FL).

Synthesis and labeling of Fen1 substrate

Fen1 substrate for 5'-flap endonuclease activity was made by annealing an upstream 23-mer (5'-CTAGATGCCTGCAGCTGATGCGC-3') and a downstream 51-mer oligonucleotide (5'-FAACATTTTTTTGTACGGATCCACGTGTACGGTACCGAGGGCGGGTCGACA-3') to a 63-mer complementary template (5'-GATCTACGGACGTCGACTACGCGACATGCCTAGGTGCACATGCCATGGCTCCCGCCCAGCTGT-3'). The 51-mer downstream oligonucleotide has a flap of 11-nt (with a teterahydrofuran, F, residue at the 5'-end), which is cleaved by Fen1. The 51-mer downstream oligonucleotide was radiolabeled at the 5'-end with [γ-32P]ATP and T4 polynucleotide kinase (New England Bio Lab, Woburn, MA). The labeled probe was purified by using a nick column (GE Healthcare, Piscataway, NJ). All the three oligonucleotides were annealed at a molar ratio of 1:1:1.

Fen1 endonuclease assay

The in vitro Fen1 endonuclease assay was performed in a 20 µl reaction mixture containing the final concentrations of 30 mM Hepes, pH 7.5, 30 mM KCl, 8.0 mM MgCl2, 1.0 mM DTT, 100 µg/ml BSA and 5% (v/v) glycerol. Briefly, 0.5 nM Fen1 and different concentrations of SMIs were incubated at room temp for 5 min, followed by addition 2.5 nM of 32P-labeled 51-mer flapped-DNA substrate. Then, it was incubated for 30 min at 37°C. Each reaction was terminated by the addition of 20 µl of stop solution (5.0 mM EDTA, 0.4% (w/v) SDS) with 1 µg of proteinase K and 5 µg carrier tRNA. After incubation for an additional 20 min at 37°C, the DNA was extracted with an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1, v/v) followed by ethanol precipitation. The 11-mer reaction products were resolved on a 15% polyacrylamide-7 M urea gel.

In vitro LP-BER assays with purified proteins

The LP-BER reaction mixture contained the final concentrations of 30 mM Hepes, pH 7.5, 30 mM KCl, 8.0 mM MgCl2, 1.0 mM DTT, 100 µg/ml BSA, 0.01 % (v/v) Nonidet P-40, 0.5 mM ATP, and 20 µM each of dATP, dCTP, dGTP, dTTP in a final volume of 20 µl. Briefly, 0.5 nM Fen1 and different concentrations of SMIs were incubated at room temp for 5 min followed by addition of 2.5 nM 32P-labeled 63-mer F-DNA (pre-incubated with 1 nM APE1 to create an incision at the repair site), 5 nM Pol-β and 0.4 nM DNA ligase I. The structure of the F-DNA substrates has been described in our previous studies (1618). The incubation period for LP-BER was 30 min at 37°C. Each reaction was terminated by the addition of 20 µl of stop solution (5.0 mM EDTA, 0.4% (w/v) of SDS) with 1 µg of proteinase K and 5 µg carrier tRNA. After incubation for an additional 20 min at 37°C, the DNA was extracted with an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1, v/v) followed by ethanol precipitation. The reaction products were resolved on a 15% polyacrylamide-7 M urea gel.

In vitro LP-BER assays with nuclear extract

The in vitro LP-BER assay was performed using the APE1 nicked 32P-labeled 63-mer F-DNA and a nuclear extract served as a source of BER proteins. The nuclear extract was prepared using the procedure of Shapiro et al. (19). Here, 5 µg of the nuclear extract from HCT-116 cells was incubated at 37°C for 60 min.

Clonogenic assay

A single cell suspension of HCT-116 and HCT-116+ch3 cells was plated (200 cells/well) in triplicate in a six-well plate. Cells were pre-treated with varying concentrations of SMI or vehicle (0.1% DMSO) for 2 h followed by the treatment with different concentrations of TMZ for 48 h. After the treatment, the cultures were replaced with fresh medium and cells were allowed to grow for a further 8 days. Visible colonies of more than 100 cells were stained with methylene blue and counted for viability.

Results

Importance of amino acid Asp181 of Fen1 in its 5’-flap endonuclease activity

The active site of human Fen1 is located at the central cleft with two possible metal ion binding sites, which are formed by two clusters of conserved acidic residues. Four residues (Asp34, Asp86, Glu158 and Glu160) form the first metal ion-binding site (M1). Three residues (Asp179, Asp181 and Asp233) form the second metal ion-binding site (M2) (13). These acidic residues are conserved in all known Fen1 enzymes, and the prevailing catalytic mechanism is thought to be universal. M1 is known to play an important role in catalysis, probably in the nucleophilic attack of the phosphodiester bonds of DNA, while it has been suggested that M2 is involved in DNA-binding (12). Using site-directed mutagenesis, we created a mutant of Fen1 in which the Asp181 of its metal-binding site M2 was changed to Asn (D181N). 5’-Flap endonuclease assay for this mutant protein (Fig.1B) and quantification of the cleaved product (Fig.1C) revealed that it is functionally inactive indicating the importance of D181 in its catalytic function. Therefore, M2 was used as a target for the identification of small molecular weight inhibitors (SMIs) by structure-based molecular docking.

Figure1
Asp181 is an important amino acid for Fen1 endonuclease activity

Structure-based molecular docking of small molecules

Ideally, a drug should be highly active with only little or no side effects. In order to achieve these goals, small molecular weight inhibitors (SMIs) should be selected or designed on the basis of structural characteristics that promote specific interaction with the intended target site (20). We used a high performance computing simulation method to screen approximately 220,000 small molecules for their ability to interact with the crystal structure of Fen1. Specifically, the screen was targeted to the Fen1 metal-binding pocket (Mg2+ binding site), which is formed by the amino acid residues Asp179, Asp181 and Asp233 for the purpose of identifying a small molecule to block its 5’-flap endonuclease activity. The protein crystal structure used for in silico screening of the structural site in question was that of the human Fen1/PCNA complex (Fig. 2A; RCSB Protein Data Bank code: 1UL1) (12). After screening, the 40 highest scoring compounds were obtained from the NCI/DTP for testing. One such small molecule (NSC-281680) is shown interacting with amino acid Asp181 of the Fen1 metal-binding pocket (M2) (Fig. 2B and C).

Figure 2
Identification of Fen1 interacting small molecules

NSC-281679, NSC-337807 and NSC-281680 block Fen1 endonuclease activity

Initially, we screened 40 different SMIs for their ability to block Fen1 endonuclease activity. We selected three SMIs, namely NSC-281679, NSC-337807 and NCS-281680 for further studies. Results obtained using these SMIs are shown in Figure 3. These SMIs blocked Fen1 mediated endonuclease activity in a dose-dependent manner (Fig. 3B; Lane 2–7, lane 8–13 and lane 14–19, respectively). The IC50 of these SMIs to inhibit Fen1 endonuclease activity was also calculated (Fig. 3C). The SMI NSC-281680 inhibited Fen1 endonuclease activity in a dose dependent manner and blocked it completely at 4.5 µM, while a similar effect was observed for NSC-337807 and NSC-281679, but at 10-times higher concentrations.

Figure 3
Screening of SMIs for blocking the 5’-flap endonuclease activity of Fen1

NSC-281679, NSC-337807 and NSC-281680 blocked LP-BER Activity

The SMIs NSC-281679, NSC-337807, and NSC-281680 were further tested for their inhibitory effects on LP-BER by using purified proteins. Results showed that these SMIs blocked Fen1-mediated strand-displacement (Fig. 4B, lane 6–9, lane 14–17, and lane 22–25) as well as complete LP-BER activities in a dose-dependent manner (Fig.4B lane 10–13, lane 18–21, and lane 26–29). Similarly, using nuclear extracts (NEs) from HCT-116 cells, these SMIs blocked of LP-BER in a dose-dependent manner (Fig. 5B, lane 3–7, lane 8–12, and lane 13–17). By comparison, these results revealed that out of three SMIs, NSC-281680 was the most potent. Thus, the SMI NSC-281680 was used in subsequent studies.

Figure 4
NSC-281679, NSC-337807 and NSC-281680 block LP-BER activity using purified proteins
Figure 5
NSC-281679, NSC-337807 and NSC-281680 block LP-BER activities using nuclear extract

The cytotoxic effect of Temozolomide (TMZ) on MMR-deficient and MMR-proficient colon cancer cells is enhanced by NSC-281680

We determined the effect of NSC-281680 on TMZ-induced cytotoxicity in MMR-deficient (HCT-116) and MMR-proficient (HCT-116+ch3) colon cancer cells. In MMR-proficient HCT-116+ch3 cells, a single copy of chromosome 3 harboring the hMLH1 gene has been inserted. As expected, these cells showed a greater cytotoxic response to TMZ treatment as compared to the MMR-deficient HCT-116 cells (Fig. 6A and B). The combination of different concentrations of NSC-281680 with TMZ further reduced the IC50 of TMZ in a dose-dependent manner in these cells (Fig. 6A and B). When applied alone NSC-281680 exhibited no cytotoxic effects on either the HCT-116 or HCT-116+ch3 cell lines (Fig. 6C), suggesting its clinical usefulness in combination with TMZ. These results suggest that NSC-281680 interacts with Fen1 and blocks LP-BER activity, which in turn increases the DNA damage burden caused by TMZ treatment and results in cell death. Thus, this strategy can be useful for chemotherapeutic intervention in both MMR-deficient and MMR-proficient colorectal tumors.

Figure 6
Efficacy of NSC-281680 in enhancing the cytotoxicity of TMZ to HCT-116, and HCT-116+ch3 colon cancer cell lines

Discussion

The current approach for the discovery of anti-tumor agents relies on random and semi-empirical screening procedures that have proven largely ineffective in treating complicated diseases, including colorectal cancers. The failure of such drugs could be due to an insufficient understanding of their pharmacology and their impact on the biochemistry and molecular genetics of normal and cancerous cells. Thus, there is a critical need for rational design of mechanism-based drugs with well-characterized specific targets. Most chemotherapeutic drugs are DNA-alkylating agents. Some of these are procarbazine (PCB), dacarbazine (DIC), streptozotocin (STZ), Temozolomide (TMZ), chloroethylnitrosourea (CENU), carmustin (BCNU), lomustine (CCNU) nimustine (ACNU) and fotemustine (Muphoran). The efficacy of these alkylating agents can be improved by blocking DNA repair pathways (21). These agents react with DNA via an SN1 mechanism to form an electrophilic carbonium ion, which covalently binds to nucleophilic sites on the DNA. Among the alkylating agents, TMZ has been assessed in clinical trials involving patients with renal cell carcinoma, soft tissue sarcoma, pancreatic carcinoma, advanced nasopharyngeal carcinoma, prostate cancer and brain metastases from a variety of solid tumors and melanoma (22). Importantly, a phase-II clinical trial study of TMZ in pre-selected advanced aerodigestive tract cancers including colon cancer is already in progress (Schering-Plough: http://clinicaltrials.gov/ct2/show/NCT00423150.)

The extent of DNA damage incurred plays a role in determining the cell’s response. The cells either attempt to continue to repair the DNA damage, or in the face of extensive damage, switch to an apoptotic response. The use of alkylating agents as chemotherapeutic drugs is based on their ability to trigger the apoptotic response (23), and the therapeutic efficacy is determined by the balance between DNA damage and repair. In many cases, an elevated DNA repair capacity in tumor cells leads to drug resistance and severely limits the efficacy of these agents. Thus, interfering with DNA repair in combination with DNA-alkylating agents has emerged as an important strategy (24). The alkylation damage-induced lesions are repaired by BER, MGMT and MMR pathways. The inhibitors that have been developed as anticancer drugs mostly target the MGMT and MMR pathways and many colon tumors become resistant to alkylating drugs due to a deficiency in MMR (25). However, the blockade of the BER pathway is equally important in inducing cellular toxicity as the major alkylation lesions created by TMZ are repaired by the BER pathway (3, 4, 26).

Long-patch (LP)-BER is the sub-pathway of BER in which Fen1 plays a critical role by removing the 5’-flap generated by Pol-β during the strand-displacement synthesis. In our lab, using a site-directed mutagenesis approach, we identified Asp181 as an important amino acid in Fen1 endonuclease activity, which has been supported by other studies (27, 28). Since Asp181 is located in the active site of Fen1 along with Asp179 and Asp233 that constitute the Mg2+ binding-pocket M2 (12, 13), we selected this amino acid to identify small molecular weight inhibitors (SMIs) predicted to interact with Fen1 and blocking its activity. By using structure-based molecular docking we have identified a potent SMI NSC-281680, which efficiently blocks the LP-BER. Although the mechanism by which it blocks Fen1 activity can be more precisely determined by co-crystallization of NSC-281680 with Fen1, our studies suggest that interaction of NSC-281680 with Fen1 may cause some structural changes and the loss of Mg2+ binding that may be leading to loss of its endonuclease activity. In earlier studies, it is suggested that the position of D181 is not crucial for cleavage capability of Fen1, but it also acts as a ligand for Mg2+ binding (27).

NSC-281680 does not block the in vitro activity of APE1, Pol-β and DNA ligase I (data not shown), suggesting its specificity toward Fen1-targeted cytotoxicity of TMZ toward colon cancer cells. Since Fen1 is a ubiquitously expressed protein and BER is a primary DNA repair pathway of alkylation-induced lesions, it may also affect normal colonic epithelial cells. However, its effect will be much higher in rapidly proliferating cancer cells than in normal cells, as supported by previous studies (29). We expect that TMZ alone or in combination with NSC-281680 reversibly targets normal cells and preferentially targets the tumor cells. This will be explored in our future studies involving in vivo xenograft tumor growth of MMR-proficient and MMR-deficient colon cancer cells.

Many colon tumors become resistant to DNA-alkylating agents due to overexpression of MGMT or MMR-deficiency (30). Cells deficient in MGMT are unable to process O6MeG during DNA synthesis, and if it is not repaired, then a G:C to G:T transition mutation occurs (31). The G:T mismatch is then repaired by the MMR pathway (32). However, if the O6MeG is not repaired before the re-synthesis step in MMR, a thymine is likely to be re-inserted opposite the lesion. It is believed that the repetitive cycle of futile MMR results in the generation of tertiary lesions, most likely gapped DNA. This then gives rise to double-stranded breaks (DSBs) in DNA that elicit a cell death response (32). Thus, a chemotherapeutic strategy which can induce cell death in both MMR-proficient and MMR-deficient colon cancer cells is highly desirable. Our results indicate that the strategy of combining NSC-281680 with TMZ seems to effectively block the growth of both MMR-proficient and MMR-deficient colon cancer cells. This suggests that the blockade of the repair of TMZ-induced N7-MeG, N3-MeG, N3-MeA lesions by NSC-281680 causes much higher cytotoxicity than the lesions of O6-MeG. The results of previous studies suggest that N7-MeG, N3-MeG and N3-MeA lesions can be toxic in both MMR-deficient and MMR-proficient cells if the BER pathway is interrupted (33), and clinical studies indicate that MMR-deficiency may not be the main cause of TMZ-induced resistance in adult malignant glioma (34). Our results support these findings and clearly suggest the importance of targeting BER and argue in favor of mechanistic studies for the development of inhibitors of BER. Thus, we expect that NSC-281680 can be used in combination with TMZ as a highly effective strategy that will provide the pre-clinical framework for the development of novel and advanced chemotherapeutic agents and facilitate the improvement of conventional colon cancer treatments.

Acknowledgements

The financial support for these studies was provided to S.N. by the NIH-grants CA-097031 and CA-100247.

Abbreviations

APE1
apurinic/apyrimidinic endonuclease 1
Fen1
5’-flap endonuclease 1
LP-BER
long-patch base excision repair
MMR
mismatch repair
Pol-β
DNA polymerase β
SMI
small molecular weight inhibitor
TMZ
Temozolomide

References

1. Fearon ER, Vogelstein B. A genetic model for colorectal tumorigenesis. Cell. 1991;61:759–767. [PubMed]
2. Narayan S, Roy D. Role of APC and DNA mismatch repair genes in the development of colorectal cancers. Mol. Cancer. 2003;2:41. [PMC free article] [PubMed]
3. Liu L, Gerson SL. Therapeutic impact of methoxyamine: blocking repair of abasic sites in the base excision repair pathway. Curr. Opin. Investig. Drugs. 2004;5:623–627. [PubMed]
4. Adhikari S, Choudhury S, Mitra PS, Dubash JJ, Sajankila SP, Roy R. Targeting base excision repair for chemo sensitization. Anticancer Agents Med. Chem. 2008;8:351–357. [PubMed]
5. Horton JK, Wilson SH. Hypersensitivity phenotypes associated with genetic and synthetic inhibitor-induced base excision repair deficiency. DNA Repair (Amst) 2003;6:530–543. [PMC free article] [PubMed]
6. Hu HY, Horton JK, Gryk MR, Prasad R, Naron JM, Sun DA, Hecht SM, Wilson SH, Mullen GP. Identification of small molecule synthetic inhibitors of DNA polymerase β by NMR chemical shift mapping. J. Biol. Chem. 2004;279:39736–39744. [PubMed]
7. Beard WA, Wilson SH. Structure and mechanism of DNA polymerase Beta. Chem. Rev. 2006;106:361–382. [PubMed]
8. Bambara RA, Murante RS, Henrichsen LA. Enzymes and reactions at the eukaryotic DNA replication fork. J. Biol. Chem. 1997;272:4647–4650. [PubMed]
9. Robins R, Pappin DJC, Wood RD, Lindahl T. Structural and functional homology between mammalian DNase IV and the 5'-nuclease domain of Escherichia coli DNA polymerase I. J. Biol. Chem. 1994;269:28535–28538. [PubMed]
10. Waga S, Bauer G, Stillman B. Reconstitution of complete SV40 DNA replication with purified replication factors. J. Biol. Chem. 1994;269:10923–10934. [PubMed]
11. Kim CY, Shen B, Park MS, Olah GA. Structural changes measured by X-ray scattering from human flap endonuclease-1 complexed with Mg2+ and flap DNA substrate. J. Biol. Chem. 1999;274:1233–1239. [PubMed]
12. Shen B, Nolan JP, Sklar LA, Park MS. Essential amino acids for substrate binding and catalysis of human flap endonuclease 1. J. Biol. Chem. 1996;271:9173–9176. [PubMed]
13. Sakurai S, Kitano K, Hirito Y, Hamada K, Okada K, Fukuda K, Uchida M, Ohtsuka E, Morioka H, Hakoshima T. Structural basis for recruitment of human flap endonuclease 1 to PCNA. EMBO J. 2005;24:683–693. [PubMed]
14. Moustakas DT, Lang PT, Pegg S, Pettersen E, Kuntz ID, Brooijmans N, Rizzo RC. Development and validation of a modular, extensible docking program: DOCK 5. J. Comput. Aided Mol. Des. 2006;20:601–619. [PubMed]
15. Balusu R, Jaiswal AS, Armas ML, Bloom LB, Narayan S. Structure/function analysis of the interaction of adenomatous polyposis coli (APC) with DNA polymerase β and its implications for base excision repair. Biochemistry. 2007;46:13961–13974. [PubMed]
16. Narayan S, Jaiswal AS, Balusu R. Tumor suppressor APC blocks DNA polymerase beta-dependent strand displacement synthesis during long patch but not short patch base excision repair and increases sensitivity to methylmethane sulfonate. J. Biol. Chem. 2005;280:6942–6949. [PubMed]
17. Jaiswal AS, Balusu R, Armas ML, Kundu CN, Narayan S. Mechanism of adenomatous polyposis coli (APC)-mediated blockage of long-patch base excision repair. Biochemistry. 2006;45:15903–15914. [PMC free article] [PubMed]
18. Balusu R, Jaiswal AS, Armas ML, Bloom LB, Narayan S. Structure/function analysis of the interaction of adenomatous polyposis coli (APC) with DNA polymerase β and its implications for base excision repair. Biochemistry. 2007;46:13961–13974. [PubMed]
19. Shapiro DJ, Sharp PA, Wahli WW, Keller MJ. A high-efficiency HeLa cell nuclear transcription extract. DNA. 1988;7:47–55. [PubMed]
20. Hait WN. Targeted cancer therapies. Cancer Res. 2009;69:1263–1267. [PubMed]
21. Middleton MR, Margison GP. Improvement of chemotherapy efficacy by inactivation of a DNA-repair pathway. Lancet Oncol. 2003;4:37–44. [PubMed]
22. Payne MJ, Pratap SE, Middleton MR. Temozolomide in the treatment of solid tumours: current results and rationale for dosing/scheduling. Crit. Rev. Oncol. Hematol. 2005;53:241–252. [PubMed]
23. Sawyers C. Targeted cancer therapy. Nature. 2004;432:294–297. [PubMed]
24. Ding J, Miao ZH, Meng LH, Geng MY. Emerging cancer therapeutic opportunities target DNA repair systems. Trends Pharmacol. Sci. 2006;27:338–344. [PubMed]
25. Liu L, Markowitz S, Gerson SL. Mismatch repair mutations override alkyltransferase in conferring resistance to temozolomide but not to 1,3-bis(2-chloroethyl) nitrosourea. Cancer Res. 1996;56:5375–5379. [PubMed]
26. Kaina B, Christmann M, Naumann S, Roos WP. MGMT: key node in the battle against genotoxicity, carcinogenicity and apoptosis induced by alkylating agents. DNA Repair (Amst) 2007;6:1079–1099. [PubMed]
27. Kim CY, Park MS, Dyer RB. Human flap endonuclease-1: conformational change upon binding to the flap DNA substrate and location of the Mg2+ binding site. Biochemistry. 2001;40:3208–3214. [PubMed]
28. Zheng L, Li M, Shan J. Krishnamoorthi R, Shen B. Distinct roles of two Mg2+ binding sites in regulation of murine flap endonuclease-1 activities. Biochemistry. 2002;41:10323–10331. [PubMed]
29. Keyomarsi K, Pardee AB. Selective protection of normal proliferating cells against the toxic effects of chemotherapeutic agents. Prog. Cell Cycle Res. 2003;5:527–532. [PubMed]
30. Liu L, Gerson SL. Targeted modulation of MGMT: clinical implications. Clin. Cancer Res. 2006;12:328–331. [PubMed]
31. Kawate H, Sakumi K, Tsuzuki T, Nakatsuru Y, Ishikawa T, Takahashi S, Takano H, Noda T, Sekiguchi M. Separation of killing and tumorigenic effects of an alkylating agent in mice defective in two of the DNA repair genes. Proc. Natl. Acad. Sci. USA. 1998;95:5116–5120. [PubMed]
32. Branch P, Aquilina G, Bignami M, Karran P. Defective mismatch binding and a mutator phenotype in cells tolerant to DNA damage. Nature. 1993;362:652–654. [PubMed]
33. Liu L, Taverna P, Hitacre CM, Chatterjee S, Gerson SL. Pharmacologic disruption of base excision repair sensitizes mismatch repair-deficient and -proficient colon cancer cells to methylating agents. Clin. Cancer Res. 1999;5:2908–2917. [PubMed]
34. Maxwell JA, Johnson SP, McLendon RE, Lister DW, Horne KS, Rasheed A, Quinn JA, Ali Osman F, Friedman AH, Modrich PL, Bigner DD, Friedman HS. Mismatch repair deficiency does not mediate clinical resistance to temozolomide in malignant glioma. Clin. Cancer Res. 2008;14:4859–4868. [PMC free article] [PubMed]