PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jvirolPermissionsJournals.ASM.orgJournalJV ArticleJournal InfoAuthorsReviewers
 
J Virol. 2009 December; 83(23): 12424–12431.
Published online 2009 September 16. doi:  10.1128/JVI.00806-09
PMCID: PMC2786720

Cell Cycle Arrest by Transforming Growth Factor β1 Enhances Replication of Respiratory Syncytial Virus in Lung Epithelial Cells[down-pointing small open triangle]

Abstract

Respiratory syncytial virus (RSV) is a common respiratory viral infection in children which is associated with immune dysregulation and subsequent induction and exacerbations of asthma. We recently reported that treatment of primary human epithelial cells (PHBE cells) with transforming growth factor β (TGF-β) enhanced RSV replication. Here, we report that the enhancement of RSV replication is mediated by induction of cell cycle arrest. These data were confirmed by using pharmacologic inhibitors of cell cycle progression, which significantly enhanced RSV replication. Our data also showed that RSV infection alone resulted in cell cycle arrest in A549 and PHBE cells. Interestingly, our data showed that RSV infection induced the expression of TGF-β in epithelial cells. Blocking of TGF-β with anti-TGF-β antibody or use of a specific TGF-β receptor signaling inhibitor resulted in rescue of the RSV-induced cell cycle arrest, suggesting an autocrine mechanism. Collectively, our data demonstrate that RSV regulates the cell cycle through TGF-β in order to enhance its replication. These findings identify a novel pathway for upregulation of virus replication and suggest a plausible mechanism for association of RSV with immune dysregulation and asthma.

Respiratory syncytial virus (RSV) is a single-stranded RNA virus and is a common cause of severe respiratory infections in children. RSV predominantly infects lung epithelial cells, inducing bronchiolitis, and in high-risk individuals it can cause lung fibrosis, airway hyperresponsiveness, mucus secretion, and edema. Interestingly, there is substantial evidence to show that RSV infection induces a dysregulation of the immune response (13, 14, 24, 28, 49). However, the molecular underpinnings of this immune dysregulation are not yet completely understood.

It has been established that through its interaction with the immune system, RSV is associated with development and exacerbations of asthma, which is a chronic inflammatory respiratory disease (17, 18, 36, 41). In comparison to healthy individuals, those with asthma have an exaggerated inflammatory response during respiratory virus infections. Despite many studies reporting the involvement of RSV with asthma development and exacerbations, the underlining mechanisms are not yet fully delineated.

Previously, we reported that transforming growth factor β (TGF-β) treatment enhanced RSV replication (30). TGF-β is a pleiotropic cytokine with diverse effects on T-cell differentiation and immune regulation and potent anti-inflammatory functions (21, 27, 33, 45). In the lung microenvironment TGF-β inhibits cell proliferation, induces mucus secretion, and regulates airway fibrosis and remodeling (2, 5, 6, 20, 23, 34, 39, 46), all of which are hallmarks of chronic asthma. Specifically, it has been reported that TGF-β expression is elevated in bronchoalveolar lavage fluids and lung tissue of asthmatic patients (9, 32, 48).

In addition, genetic studies have found an association between asthma phenotype and TGF-β (19, 26, 38, 43). These studies have identified several single-nucleotide polymorphisms (C509T, T869C, and G915C) in the promoter and coding region of TGF-β that contributed to the increase in gene expression and are significantly associated with childhood wheezing, asthma diagnosis, and asthma severity. Despite this correlation between TGF-β and asthma, the interaction between this key cytokine and respiratory viral infection is poorly understood.

A well-known function of TGF-β is the regulation of cell cycle progression. Activation of TGF-β-induced signaling pathways promotes cell cycle arrest in both the G0/G1 and G2/M phases of the cell cycle (7, 8, 25, 29, 40, 42, 44). In the current study, our data showed that TGF-β induction of cell cycle arrest was beneficial to RSV replication. The association of cell cycle arrest with RSV replication was determined by using three different pharmacological inhibitors of cell cycle progression, which enhanced RSV replication. Interestingly, RSV infection alone resulted in secretion of active TGF-β. Treatment of epithelial cells with anti-TGF-β or a specific inhibitor of TGF-β receptor (TGF-βR) signaling resulted in a reduction in RSV replication.

In the current study, our data uncover a new pathway for virus regulation of the cell cycle. These findings support our hypothesis that RSV regulates and utilizes TGF-β in lung epithelium to enhance its replication, which may contribute to the physiological changes in the lung leading to immune dysregulation, asthma development, and exacerbations.

MATERIALS AND METHODS

Cell culture conditions, reagents, and treatments.

Primary human bronchial epithelial (PHBE) cells and serum-free bronchial epithelial basal medium with growth supplements were from Lonza Walkersville Inc. (Walkersville, MD). The human alveolar epithelial cell line A549 was grown as a monolayer in Dulbecco's modified Eagle's/Ham's F-12 medium with 5% fetal calf serum and 1% penicillin-streptomycin at 37°C in a 5% CO2 humidified incubator. The human recombinant TGF-β1 (hereafter referred to as TGF-β) was purchased from Fitzgerald Industries International (Concord, MA) and was diluted in phosphate-buffered saline (PBS) with 2% bovine serum albumin.

For treatments, TGF-β was added to PHBE and A549 cells 2 h prior to RSV infection. For infection longer than 24 h, cells were treated with TGF-β every 24 h. A Specific TGF-β signaling inhibitor, the TGF-βR-I kinase (ALK-5) inhibitor (TGF-βR inhibitor), was purchased from EMD-Calbiochem (San Diego, CA). TGF-β was neutralized using monoclonal anti-TGF-β1 antibody (MAB240) from R&D Systems (Minneapolis, MN). This antibody is specific to both active and latent TGF-β1 and was used at 10 μg/ml. For inhibition of the cell cycle by pharmacological inhibitors, we used purvalanol A (50 nM), olomoucine (100 μM), and nocodazole (100 ng/ml) from EMD-Calbiochem (San Diego, CA).

Virus and infections.

The human RSV subtype A2 was grown and titrated in human epithelial cell line HEp-2 as previously described (15), RSV infection was performed on PHBE and A549 cells at least 24 h after plating. The multiplicity of infection (MOI) is indicated in each figure legend. Cells were infected with virus in a low volume of serum-free medium (100 μl per 60-mm dish) for 1 h with occasional rocking at 37°C. Complete medium was then added, and cells were incubated until harvesting.

Cell proliferation assay and cell cycle analysis.

At the indicated times postinfection, PHBE and A549 cells were washed and resuspended in PBS. The total cell number at each day was determined with a hemocytometer, and dead cells were identified by trypan blue staining. The amount of trypan blue-positive cells in all experiments was less than 1%. Cell cycle analysis was performed by flow cytometry. Briefly, at 4 h prior to harvesting, cells were treated with 10 μM bromodeoxyuridine (BrdU) (BD Bioscience, San Jose, CA). Cells were then fixed with 70% ethanol for 30 min at −20°C and were then labeled with fluorescein isothiocyanate-conjugated anti-BrdU antibody according to the manufacturer's instructions (BD Bioscience, San Jose, CA). To specifically analyze RSV-infected cells for cell cycle phase determination, cells were gated by using fluorescein isothiocyanate-conjugated polyclonal antibody to RSV (Millipore, Billerica, MA), and the cell cycle property was then analyzed using BrdU incorporation and propidium iodide staining. Flow cytometry was carried out on a Becton-Dickinson FACSort flow cytometer, and quantification of cell cycle distribution was determined using either CellQuest or Modfit software (BD Biosciences, San Jose, CA).

Western blot analysis and ELISA.

For Western blot analysis, cells were washed twice with PBS and were then lysed in 1× sodium dodecyl sulfate (SDS) sample buffer containing 2.5% β-mercaptoethanol. The total cell proteins were denatured and reduced by heating at 95°C for 5 min. The chromosomal DNA was sheared by passing the samples through a 26-gauge needle several times. The protein concentration was then determined by the Bio-Rad protein assay (Bio-Rad, Hercules, CA). Proteins were then resolved by SDS-polyacrylamide gel electrophoresis and were electrotransferred onto polyvinylidene difluoride membranes. The membranes were probed with respective primary antibodies and corresponding horseradish peroxidase-conjugated secondary antibody according to the manufacturer's instructions. Primary antibodies were antiretinoblastoma (anti-Rb), anti-phospho-Rb (anti-p-Rb), anti-GAPDH (anti-glyceraldehyde-3-phosphate dehydrogenase) (Cell Signaling, Danvers, MA), anti-histone-3 (anti-His-3), anti-phospho-His-3 (anti-p-His-3) (Millipore, Billerica, MA), and goat anti-RSV (Fitzgerald, Concord, MA). The enhanced chemiluminescence (ECL) Western blot detection system was then used to visualize the immunoblotted proteins (GE Healthcare, Piscataway, NJ). Quantification of the bands was performed using the ImageJ software. For detection of TGF-β secretion, we used enzyme-linked immunosorbent assay (ELISA) according to the manufacturer's instructions (Biosource, Carlsbad, CA).

RNA extraction and RT-PCR.

Total RNA was isolated with TRIzol RNA isolation reagent (Invitrogen, Carlsbad, CA) following the manufacturer's instructions. RNA was reverse transcribed into first-strand cDNA using Superscript reverse transcriptase (Invitrogen, Carlsbad, CA). The cDNA was then amplified by real-time PCR as previously described (30). Primer sequences used in reverse transcription-PCR (RT-PCR) were as follows: GAPDH forward, GGACCTGACCTGCCGTCTAG; GADPH reverse, TAGCCCAGGATGCCCTTGAG; RSV-G forward, CAACCCCAACATACCTCACC; RSV-G reverse, GTGGATTGCAGGGTTGACTT, h-TGF-β forward, CAGCAACAATTCCTGGCGATA; and h-TGF-β reverse, AAGGCGAAAGCCCTCAATTT. Statistical analysis values are standard errors of the means based on Student's t test. Significance values (P values) of less than 0.05 were interpreted as statistically significant.

RESULTS

RSV infection induces cell cycle arrest in PHBE and A549 cells.

We previously reported that TGF-β treatment of epithelial cells enhanced RSV replication (30). We therefore hypothesized that a well-known function of TGF-β, namely, cell cycle regulation, was responsible for upregulation of RSV replication. To evaluate the role of the cell cycle in RSV replication, subconfluent monolayers of PHBE or A549 cells were treated with TGF-β alone, TGF-β with RSV, or RSV alone as a control (Fig. (Fig.1).1). Initially, to determine the effect on cell replication, we enumerated the cells by using a hemocytometer. Unexpectedly, we found that similar to TGF-β treatment, infection of the cells with RSV alone was sufficient to induce inhibition of cell proliferation (Fig. 1A and B).

FIG. 1.
The cell cycle is arrested in PHBE and A549 cells during RSV infection. (A and B) Subconfluent monolayers (approximately 10% confluence) of PHBE cells (A) or A549 cells (B) were seeded 24 h prior to infection. The cells were then mock treated ...

As a result of the decrease in cell numbers, we performed cell cycle analysis using BrdU incorporation and flow cytometry. The data, presented in Fig. 1C and D, showed that RSV infection induced significant G2/M cell cycle arrest in PHBE and G0/G1 cell cycle arrest in A549 cells. The reason for this discrepancy in the cell type-specific arrest is not completely clear, but it could be due to differences between an immortalized cell line (A549) and primary cells.

Cell cycle arrest is mediated by a complex interaction of several proteins. A key signal for G2/M phase arrest is an increase in phosphorylation of His-3 protein, and a key signal for G0/G1 arrest is dephosphorylation of Rb protein. Therefore, to determine the phosphorylation state of His-3 and Rb, we performed Western blot analysis. Total cell extracts were prepared from uninfected and RSV-infected cells and were used in SDS-polyacrylamide gel electrophoresis and Western blotting using anti-p-Rb and anti-p-His-3 (Fig. (Fig.2).2). The data showed that in agreement with the data obtained from the cell cycle analysis, RSV infection induced phosphorylation of His-3 in PHBE cells and dephosphorylation of Rb in A549 cells.

FIG. 2.
Infection with RSV affects cell cycle regulatory proteins. PHBE (upper two panels) and A549 (lower two panels) cells were infected with RSV at an MOI of 5 PFU/cell. After 24 h, total cell extracts were prepared and used in Western blot analysis using ...

Cell cycle arrest enhances RSV replication.

We next determined whether cell cycle arrest had an effect on RSV replication. To address this issue, we used pharmacological inhibitors of cell cycle progression. Subconfluent monolayers of PHBE and A549 cells were treated with purvalanol A and olomoucine to undergo G0/G1 and S phase cell cycle arrest and with nocodozole to induce G2/M arrest prior to infection with RSV at an MOI of 0.2 PFU/cell. The data in Fig. 3A and B show that treatment of epithelial cells with the cell cycle inhibitors for 2 h prior to infection resulted in an increase in expression of viral proteins and viral titers. The results suggest that cell cycle arrest in lung epithelial cells is beneficial to RSV replication.

FIG. 3.
RSV protein and mRNA accumulation are enhanced during cell cycle arrest. Pharmacological inhibitors of the cell cycle were used in RSV infection of PHBE cells (A, upper panels) and A549 cells (A, lower panels). The cell cycle inhibitor purvalanol A (Pur) ...

RSV infection induces TGF-β expression in epithelial cells.

Based on our data, we reasoned that a possible mechanism for the induction of cell cycle arrest by RSV was through induction of TGF-β. Virus infections are known to induce many cytokines and chemokines; however, TGF-β induction by RSV has not been previously reported. To address this possibility, we examined the expression of TGF-β in PHBE and A549 cells (Fig. 4A and B). Cells were infected with RSV at MOIs of 2.5 and 5 PFU/cell, and after 24 h, RNA and culture supernatant were harvested. The data in Fig. 4A and B show that RSV infection induced, in a dose-dependent manner, both transcription and secretion of TGF-β from both cell types.

FIG. 4.
RSV infection induces TGF-β expression. Induction of TGF-β protein and mRNA was determined by RT-PCR (A) and ELISA (B). PHBE and A549 cells were infected with RSV at the indicated MOI, and after 24 h, culture supernatants and total cellular ...

TGF-β autocrine signaling regulates cell cycle arrest and RSV replication.

We next asked whether RSV-induced TGF-β expression promoted cell cycle arrest and enhanced RSV replication in an autocrine fashion. Initially, the autocrine effects of RSV-induced TGF-β on cell replication were determined by cell enumeration using PHBE and A549 cells (Fig. 5A and B). Subconfluent monolayers of PHBE and A549 cells were infected with RSV at an MOI of 2.5 PFU/cell and were then treated with specific TGF-βR inhibitor. The cell number was then determined at the indicated days postinfection. The data show that inhibition of TGF-β signaling rescued the RSV-induced cell cycle arrest (Fig. 5A and B). Treatment of cells with the inhibitor alone did not affect cell cycle in either cell type.

FIG. 5.
TGF-β regulates RSV-induced cell cycle arrest. (A and B) To determine the effect of TGF-β inhibition on RSV-induced cell cycle arrest, PHBE (A) or A549 (B) cells were mock treated (•), TGF-β treated (10 ng/ml) ([filled square]), ...

We next confirmed the autocrine effects of TGF-β on cell cycle regulation by flow cytometry (Fig. 5C and D). A549 and PHBE cells were infected and were treated as described above. Similar to the data in Fig. 5A and B, inhibition of TGF-β with TGF-βR inhibitor significantly attenuated the RSV-induced cell cycle arrest.

Autocrine effects of TGF-β enhance RSV replication.

We next determined the effects of RSV-induced TGF-β on virus protein and viral titers. Specific anti-TGF-β antibody or TGF-βR inhibitor were added to the culture media of PHBE and A549 cells at 2 h prior to infection with RSV at an MOI of 0.2 PFU/cell. At 24 h postinfection, total RNA and proteins were collected from the cells. Data from Western blot analysis showed that both anti-TGF-β and TGF-βR inhibitor significantly reduced viral protein expression in human lung epithelial cells (Fig. 6A and B). We then confirmed these data by viral titration (Fig. (Fig.6C).6C). Taken together, the data demonstrate that RSV-induced TGF-β participates in an autocrine enhancement of RSV replication in lung epithelial cells. A working model is shown in Fig. Fig.77.

FIG. 6.
Autocrine regulation of RSV replication by TGF-β. (A and B) The autocrine effect of TGF-β on RSV protein (F, N, P, M) expression was determined by using a specific anti-TGF-β antibody (A) or by treatment of A549 cells with 200 ...
FIG. 7.
A working model of autocrine TGF-β effects on RSV replication.

DISCUSSION

Respiratory infections are the most common viral illness in human populations. Based on epidemiologic and molecular evidence, there is an association between severe childhood respiratory viral infections and chronic lung immune-mediated diseases such as asthma (3, 12, 17, 18, 36, 41). Thus far, the underlying molecular mechanisms that are involved in viral induction of chronic respiratory diseases are not completely clear. However, it has been reported that viral load is a critical factor in determining the severity of RSV infections (10, 11).

We previously reported that treatment of human respiratory epithelial cells with TGF-β enhanced RSV replication (30). Recently, a study by Thomas et al. showed that TGF-β also increased rhinovirus replication (47). A well-characterized function of TGF-β is regulation of cell cycle progression. Activation of the TGF-β1-induced signaling through the Smad 2/3 pathways promotes cell cycle arrest in both the G0/G1 and G2/M phases of the cell cycle, albeit regulation of G0/G1 by TGF-β is much more studied (7, 8, 40, 42, 44). Our data in Fig. 5C and D confirm previous findings that TGF-β, depending on the cell type, can affect both G0/G1 and G2/M phases.

Here, we report that the enhancement of RSV replication is associated with cell cycle regulatory properties of TGF-β. Treatment of A549 or PHBE cells with TGF-β inhibited cell proliferation, which was concomitant with inhibition of cell cycle progression and enhancement of RSV replication (Fig. (Fig.1).1). The role of cell cycle arrest in RSV replication was further confirmed by using three different pharmacological inhibitors of cell cycle progression, i.e., purvalanol A, olomoucin, or nocodazole, which led to an increase in RSV protein expression and viral titers in both A549 and PHBE cells (Fig. 3A and B). A previous report by Kallewaard et al. showed that nocodazole decreased RSV replication in the human epithelial cell line Hep-2 (22). The reason for the discrepancy between their results and our data is not yet clear, but it could be due to a cell-specific event. It is also possible that the difference may be due to the amounts of nocodazole used in the two studies; we used 100 ng/ml (approximately 0.3 mM), compared to 17 mM used in the studies by Kallewaard et al. (22).

Interestingly, infection of epithelial cells with RSV alone resulted in cell cycle arrest (Fig. (Fig.1).1). RSV-induced cell cycle arrest was accompanied by a corresponding reduction in Rb phosphorylation, a G0/G1 phase marker, and an increase in His-3 phosphorylation, a G2-to-M phase transition marker (Fig. (Fig.2).2). Previous reports have shown inhibition of cell cycle progression in host cells infected by other RNA viruses. Infection of Vero cells with coronavirus and of fibroblast cells with reovirus resulted in G0/G1 and G2/M cell cycle arrest (4, 37). Cell cycle arrest at the G0/G1 phase was shown in T lymphocytes after measles virus infection (35). Our data demonstrated that RSV-infected primary lung epithelial cells underwent G2/M arrest while the A549 alveolar lung epithelial cell line underwent G0/G1 arrest, which may reflect differences between a lung cancer cell line (A549) and primary cells (PHBE) (Fig. 1C and D).

We next address the possible mechanisms of RSV induction of cell cycle arrest. Our hypothesis, which was confirmed by our data, was that RSV infection induced the expression of TGF-β, which may have had an autocrine effect on the cell cycle and subsequently on virus replication. Infection of the epithelial cells with RSV resulted in induction of TGF-β mRNA and protein secretion into the medium (Fig. 4A and B). Consistent with the expression data, inhibition of TGF-β using a specific neutralizing antibody or a pharmacological inhibitor of TGF-βR rescued the RSV-induced cell cycle arrest and reduced viral replication (Fig. (Fig.55 and and6).6). Since inhibition of TGF-β significantly but incompletely rescued the RSV-induced cell cycle arrest, it is likely that other virus-associated events participate in cell cycle arrest. Nonetheless, it appears that cell cycle arrest in any cycle may be beneficial to RSV replication.

It is not exactly clear how cell cycle arrest enhances virus replication, but a possible mechanism is by the increase in availability of host cellular components for virus replication. Alternatively, it is possible that RSV can take advantage of a cell cycle regulatory molecule that is activated during TGF-β treatment, such as cell division cycle-2 (cdc2), which has been proposed for herpes simplex virus infections (1). Further experiments to delineate the exact mechanisms of the enhanced RSV replication during cell cycle arrest are under way.

A study by Groskreutz et al. showed that RSV infection reduced the level of p53 tumor suppressor protein. They suggested that RSV infection may be enhanced by the increase in cell survival through lower p53 expression (16). At this point, the exact correlation between our data and the data published by Groskreutz et al. is not clear. However, since p53 plays a critical role in the cell cycle, it is possible that p53 is involved in our observations. We are currently examining this possibility.

RSV-induced cell cycle arrest benefits viral replication but very likely has adverse effects on lung epithelium. It is plausible that cell cycle arrest of lung cells impedes lung repair during RSV infection, which is known to induce severe bronchiolitis. Bronchiolitis is associated with serious airways injury, including loss of cilia, sloughing of epithelial cells, mucus hypersecretion, and edema. In addition, the interplay between cell cycle arrest and the increase in viral load can lead to a more prolonged and severe infection.

To our knowledge, this is the first report showing that RSV induces expression of TGF-β in human epithelial cells. TGF-β is pluripotent cytokine with profound effects on cell cycle, fibrosis, inhibition of inflammation, and immune regulation. It is established that aberrant expression of TGF-β in lungs, due to genetic polymorphism or environmental insult, leads to fibrosis, airway remodeling, and mucus hypersecretion (2, 5, 6, 20, 23, 34, 39, 46). These are characteristics that are closely associated with the asthma phenotype. Based on work by others and our data in Fig. Fig.4,4, we propose that expression of TGF-β by RSV may contribute to lung remodeling and the asthma phenotype. Currently, we are further delineating the molecular pathways activated during RSV infections that are required for induction of TGF-β.

In addition to the regulation of lung physiology, TGF-β is a pivotal immunoregulatory cytokine. TGF-β can enhance regulatory T-cell development, induce immunoglobulin switching, and act as an anti-inflammatory cytokine (21, 27, 33, 45). Therefore, it is possible that induction of TGF-β may contribute to the immune deviation that is observed during RSV infections (13, 28, 49). It is interesting to note that the immunosuppression that is induced during measles virus infections has been attributed to cell cycle arrest in T lymphocytes (31). Based on our data, it is tempting to speculate that the immunosuppression and T-lymphocyte cell cycle arrest may be mediated through TGF-β expression.

In this study, we have shown for the first time that RSV causes cell cycle arrest of lung epithelial cells in part through the TGF-β autocrine pathway. Furthermore, the cell cycle arrest enhanced viral replication. Our findings provide further mechanistic insight into RSV pathogenesis and RSV-induced pathologies. Further experiments to assess the role of RSV-induced TGF-β in the development of the asthma phenotype in murine experimental models are under way.

Acknowledgments

This research was supported entirely by the Intramural Research Program at the National Institute of Environmental Health Sciences, NIH.

Footnotes

[down-pointing small open triangle]Published ahead of print on 16 September 2009.

REFERENCES

1. Advani, S. J., R. R. Weichselbaum, and B. Roizman. 2000. The role of cdc2 in the expression of herpes simplex virus genes. Proc. Natl. Acad. Sci. USA 97:10996-11001. [PubMed]
2. Boland, S., E. Boisvieux-Ulrich, O. Houcine, A. Baeza-Squiban, M. Pouchelet, D. Schoevaert, and F. Marano. 1996. TGF beta 1 promotes actin cytoskeleton reorganization and migratory phenotype in epithelial tracheal cells in primary culture. J. Cell Sci. 109:2207-2219. [PubMed]
3. Busse, W. W., and J. E. Gern. 1997. Viruses in asthma. J. Allergy Clin. Immunol. 100:147-150. [PubMed]
4. Chen, C. J., and S. Makino. 2004. Murine coronavirus replication induces cell cycle arrest in G0/G1 phase. J. Virol. 78:5658-5669. [PMC free article] [PubMed]
5. Chu, H. W., S. Balzar, G. J. Seedorf, J. Y. Westcott, J. B. Trudeau, P. Silkoff, and S. E. Wenzel. 2004. Transforming growth factor-beta2 induces bronchial epithelial mucin expression in asthma. Am. J. Pathol. 165:1097-1106. [PubMed]
6. Cohn, L., J. A. Elias, and G. L. Chupp. 2004. Asthma: mechanisms of disease persistence and progression. Annu. Rev. Immunol. 22:789-815. [PubMed]
7. Davy, C., and J. Doorbar. 2007. G2/M cell cycle arrest in the life cycle of viruses. Virology 368:219-226. [PubMed]
8. Desai, T. R., N. J. Leeper, K. L. Hynes, and B. L. Gewertz. 2002. Interleukin-6 causes endothelial barrier dysfunction via the protein kinase C pathway. J. Surg. Res. 104:118-123. [PubMed]
9. Doherty, T., and D. Broide. 2007. Cytokines and growth factors in airway remodeling in asthma. Curr. Opin. Immunol. 19:676-680. [PubMed]
10. Estripeaut, D., J. P. Torres, C. S. Somers, C. Tagliabue, S. Khokhar, V. G. Bhoj, S. M. Grube, A. Wozniakowski, A. M. Gomez, O. Ramilo, H. S. Jafri, and A. Mejias. 2008. Respiratory syncytial virus persistence in the lungs correlates with airway hyperreactivity in the mouse model. J. Infect. Dis. 198:1435-1443. [PubMed]
11. Fodha, I., A. Vabret, L. Ghedira, H. Seboui, S. Chouchane, J. Dewar, N. Gueddiche, A. Trabelsi, N. Boujaafar, and F. Freymuth. 2007. Respiratory syncytial virus infections in hospitalized infants: association between viral load, virus subgroup, and disease severity. J. Med. Virol. 79:1951-1958. [PubMed]
12. Gern, J. E., and W. W. Busse. 2002. Relationship of viral infections to wheezing illnesses and asthma. Nat. Rev. Immunol. 2:132-138. [PubMed]
13. Graham, B. S., L. A. Bunton, P. F. Wright, and D. T. Karzon. 1991. Role of T lymphocyte subsets in the pathogenesis of primary infection and rechallenge with respiratory syncytial virus in mice. J. Clin. Investig. 88:1026-1033. [PMC free article] [PubMed]
14. Graham, B. S., T. R. Johnson, and R. S. Peebles. 2000. Immune-mediated disease pathogenesis in respiratory syncytial virus infection. Immunopharmacology 48:237-247. [PubMed]
15. Graham, B. S., M. D. Perkins, P. F. Wright, and D. T. Karzon. 1988. Primary respiratory syncytial virus infection in mice. J. Med. Virol. 26:153-162. [PubMed]
16. Groskreutz, D. J., M. M. Monick, T. O. Yarovinsky, L. S. Powers, D. E. Quelle, S. M. Varga, D. C. Look, and G. W. Hunninghake. 2007. Respiratory syncytial virus decreases p53 protein to prolong survival of airway epithelial cells. J. Immunol. 179:2741-2747. [PubMed]
17. Hashimoto, K., B. S. Graham, S. B. Ho, K. B. Adler, R. D. Collins, S. J. Olson, W. Zhou, T. Suzutani, P. W. Jones, K. Goleniewska, J. F. O'Neal, and R. S. Peebles, Jr. 2004. Respiratory syncytial virus in allergic lung inflammation increases Muc5ac and gob-5. Am. J. Respir. Crit. Care Med. 170:306-312. [PubMed]
18. Hegele, R. G., P. J. Robinson, S. Gonzalez, and J. C. Hogg. 1993. Production of acute bronchiolitis in guinea-pigs by human respiratory syncytial virus. Eur. Respir. J. 6:1324-1331. [PubMed]
19. Hoffjan, S., I. Ostrovnaja, D. Nicolae, D. L. Newman, R. Nicolae, R. Gangnon, L. Steiner, K. Walker, R. Reynolds, D. Greene, D. Mirel, J. E. Gern, R. F. Lemanske, Jr., and C. Ober. 2004. Genetic variation in immunoregulatory pathways and atopic phenotypes in infancy. J. Allergy Clin. Immunol. 113:511-518. [PubMed]
20. Howat, W. J., S. T. Holgate, and P. M. Lackie. 2002. TGF-beta isoform release and activation during in vitro bronchial epithelial wound repair. Am. J. Physiol. Lung Cell. Mol. Physiol. 282:L115-L123. [PubMed]
21. Izcue, A., J. L. Coombes, and F. Powrie. 2006. Regulatory T cells suppress systemic and mucosal immune activation to control intestinal inflammation. Immunol. Rev. 212:256-271. [PubMed]
22. Kallewaard, N. L., A. L. Bowen, and J. E. Crowe, Jr. 2005. Cooperativity of actin and microtubule elements during replication of respiratory syncytial virus. Virology 331:73-81. [PubMed]
23. Kelly, M., M. Kolb, P. Bonniaud, and J. Gauldie. 2003. Re-evaluation of fibrogenic cytokines in lung fibrosis. Curr. Pharm. Des. 9:39-49. [PubMed]
24. Klein, M. I., S. Coviello, G. Bauer, A. Benitez, M. E. Serra, M. P. Schiatti, M. F. Delgado, G. A. Melendi, L. Novalli, H. G. Pena, R. A. Karron, S. R. Kleeberger, and F. P. Polack. 2006. The impact of infection with human metapneumovirus and other respiratory viruses in young infants and children at high risk for severe pulmonary disease. J. Infect. Dis. 193:1544-1551. [PubMed]
25. Laiho, M., J. A. DeCaprio, J. W. Ludlow, D. M. Livingston, and J. Massague. 1990. Growth inhibition by TGF-beta linked to suppression of retinoblastoma protein phosphorylation. Cell 62:175-185. [PubMed]
26. Li, H., I. Romieu, H. Wu, J. J. Sienra-Monge, M. Ramirez-Aguilar, B. E. Del Rio-Navarro, I. C. Del Lara-Sanchez, E. O. Kistner, H. K. Gjessing, and S. J. London. 2007. Genetic polymorphisms in transforming growth factor beta-1 (TGFB1) and childhood asthma and atopy. Hum. Genet. 121:529-538. [PMC free article] [PubMed]
27. Li, M. O., and R. A. Flavell. 2008. TGF-beta: a master of all T cell trades. Cell 134:392-404. [PubMed]
28. Lukacs, N. W., M. L. Moore, B. D. Rudd, A. A. Berlin, R. D. Collins, S. J. Olson, S. B. Ho, and R. S. Peebles, Jr. 2006. Differential immune responses and pulmonary pathophysiology are induced by two different strains of respiratory syncytial virus. Am. J. Pathol. 169:977-986. [PubMed]
29. Matsumoto, M., S. Kikkawa, M. Kohase, K. Miyake, and T. Seya. 2002. Establishment of a monoclonal antibody against human Toll-like receptor 3 that blocks double-stranded RNA-mediated signaling. Biochem. Biophys. Res. Commun. 293:1364-1369. [PubMed]
30. McCann, K. L., and F. Imani. 2007. Transforming growth factor beta enhances respiratory syncytial virus replication and tumor necrosis factor alpha induction in human epithelial cells. J. Virol. 81:2880-2886. [PMC free article] [PubMed]
31. McChesney, M. B., A. Altman, and M. B. Oldstone. 1988. Suppression of T lymphocyte function by measles virus is due to cell cycle arrest in G1. J. Immunol. 140:1269-1273. [PubMed]
32. Minshall, E. M., D. Y. Leung, R. J. Martin, Y. L. Song, L. Cameron, P. Ernst, and Q. Hamid. 1997. Eosinophil-associated TGF-beta1 mRNA expression and airways fibrosis in bronchial asthma. Am. J. Respir. Cell Mol. Biol. 17:326-333. [PubMed]
33. Moore, B., R. F. Murphy, and D. K. Agrawal. 2008. Interaction of TGF-beta with immune cells in airway disease. Curr. Mol. Med. 8:427-436. [PubMed]
34. Moses, H. L., E. Y. Yang, and J. A. Pietenpol. 1990. TGF-beta stimulation and inhibition of cell proliferation: new mechanistic insights. Cell 63:245-247. [PubMed]
35. Naniche, D., S. I. Reed, and M. B. Oldstone. 1999. Cell cycle arrest during measles virus infection: a G0-like block leads to suppression of retinoblastoma protein expression. J. Virol. 73:1894-1901. [PMC free article] [PubMed]
36. Peebles, R. S., Jr., J. R. Sheller, J. E. Johnson, D. B. Mitchell, and B. S. Graham. 1999. Respiratory syncytial virus infection prolongs methacholine-induced airway hyperresponsiveness in ovalbumin-sensitized mice. J. Med. Virol. 57:186-192. [PubMed]
37. Poggioli, G. J., C. Keefer, J. L. Connolly, T. S. Dermody, and K. L. Tyler. 2000. Reovirus-induced G2/M cell cycle arrest requires σ1s and occurs in the absence of apoptosis. J. Virol. 74:9562-9570. [PMC free article] [PubMed]
38. Pulleyn, L. J., R. Newton, I. M. Adcock, and P. J. Barnes. 2001. TGFbeta1 allele association with asthma severity. Hum Genet. 109:623-627. [PubMed]
39. Roberts, A. B., M. B. Sporn, R. K. Assoian, J. M. Smith, N. S. Roche, L. M. Wakefield, U. I. Heine, L. A. Liotta, V. Falanga, J. H. Kehrl, et al. 1986. Transforming growth factor type beta: rapid induction of fibrosis and angiogenesis in vivo and stimulation of collagen formation in vitro. Proc. Natl. Acad. Sci. USA 83:4167-4171. [PubMed]
40. Saltis, J. 1996. TGF-beta: receptors and cell cycle arrest. Mol. Cell Endocrinol. 116:227-232. [PubMed]
41. Schwarze, J., E. Hamelmann, K. L. Bradley, K. Takeda, and E. W. Gelfand. 1997. Respiratory syncytial virus infection results in airway hyperresponsiveness and enhanced airway sensitization to allergen. J. Clin. Investig. 100:226-233. [PMC free article] [PubMed]
42. Seoane, J., C. Pouponnot, P. Staller, M. Schader, M. Eilers, and J. Massague. 2001. TGFbeta influences Myc, Miz-1 and Smad to control the CDK inhibitor p15INK4b. Nat. Cell Biol. 3:400-408. [PubMed]
43. Silverman, E. S., L. J. Palmer, V. Subramaniam, A. Hallock, S. Mathew, J. Vallone, D. S. Faffe, T. Shikanai, B. A. Raby, S. T. Weiss, and S. A. Shore. 2004. Transforming growth factor-beta1 promoter polymorphism C-509T is associated with asthma. Am. J. Respir. Crit. Care Med. 169:214-219. [PubMed]
44. Simon, K. E., H. H. Cha, and G. L. Firestone. 1995. Transforming growth factor beta down-regulation of CKShs1 transcripts in growth-inhibited epithelial cells. Cell Growth Differ. 6:1261-1269. [PubMed]
45. Taylor, A., J. Verhagen, K. Blaser, M. Akdis, and C. A. Akdis. 2006. Mechanisms of immune suppression by interleukin-10 and transforming growth factor-beta: the role of T regulatory cells. Immunology 117:433-442. [PubMed]
46. Ten Dijke, P., M. J. Goumans, F. Itoh, and S. Itoh. 2002. Regulation of cell proliferation by Smad proteins. J. Cell Physiol. 191:1-16. [PubMed]
47. Thomas, B. J., M. Lindsay, H. Dagher, N. J. Freezer, D. Li, R. Ghildyal, and P. G. Bardin. 2009. Transforming growth factor-β enhances rhinovirus infection by diminishing early innate responses. Am. J. Respir. Cell Mol. Biol. [PubMed]
48. Vignola, A. M., P. Chanez, G. Chiappara, A. Merendino, E. Pace, A. Rizzo, A. M. la Rocca, V. Bellia, G. Bonsignore, and J. Bousquet. 1997. Transforming growth factor-beta expression in mucosal biopsies in asthma and chronic bronchitis. Am. J. Respir. Crit. Care Med. 156:591-599. [PubMed]
49. Welliver, R. C., Sr. 2008. The immune response to respiratory syncytial virus infection: friend or foe? Clin. Rev. Allergy Immunol. 34:163-173. [PubMed]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)