PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of iaiPermissionsJournals.ASM.orgJournalIAI ArticleJournal InfoAuthorsReviewers
 
Infect Immun. 2009 December; 77(12): 5428–5436.
Published online 2009 September 21. doi:  10.1128/IAI.00528-09
PMCID: PMC2786475

Characterization of a Campylobacter jejuni VirK Protein Homolog as a Novel Virulence Determinant[down-pointing small open triangle]

Abstract

Campylobacter jejuni is a leading cause of food-borne illness in the United States. Despite significant recent advances, its mechanisms of pathogenesis are poorly understood. A unique feature of this pathogen is that, with some exceptions, it lacks homologs of known virulence factors from other pathogens. Through a genetic screen, we have identified a C. jejuni homolog of the VirK family of virulence factors, which is essential for antimicrobial peptide resistance and mouse virulence.

Campylobacter jejuni is a leading cause of infectious diarrhea in industrialized and developing countries (2, 67). Although most often self-limiting, C. jejuni infections can also lead to severe disease and harmful sequelae, such as Guillain-Barré syndrome (4, 55). Despite the significant progress made during the past few years, the mechanisms of C. jejuni pathogenesis remain poorly understood. A number of potential virulence factors have been identified, and in some cases, their role in virulence and/or colonization has been demonstrated in animal models of infection. For example, motility has been shown to be crucial in order for C. jejuni to colonize or cause disease in several animal models of infection (1, 15, 30, 54). A variety of surface structures, such as adhesins (34, 40, 64) and polysaccharides (5, 6), and glycosylation systems (38, 74), which presumably modify some of these surface structures, have also been shown to be important for infection. Additional studies have revealed the importance of specific metabolic pathways in C. jejuni growth both in vitro and within animals (16, 25, 31, 60, 76). The ability of C. jejuni to invade and survive within nonphagocytic cells has also been proposed to be an important virulence determinant (21, 41, 57, 58, 68, 75, 80).

The available genome sequences of several C. jejuni strains have provided significant insight into C. jejuni physiology and metabolism (22, 32, 62, 63, 65). Remarkably, however, analysis of these C. jejuni genome sequences has revealed very few homologs of common virulence factors from other pathogens. A notable exception is the toxin CDT (cytolethal distending toxin), which is also encoded by several other important bacterial pathogens (36, 44, 45). In this paper we describe the identification of a transposon insertion mutant in C. jejuni 81-176, which results in increased susceptibility to antimicrobial peptides and a significant defect in the ability of the organism to cause disease in an animal model of infection. The insertion mutant was mapped to the CJJ81176_1087 open reading frame (Cj1069 in the C. jejuni NCT 11168 reference strain), which encodes a protein with very significant amino acid sequence similarity to the VirK (DUF535) family of virulence factors (13, 20, 56).

MATERIALS AND METHODS

Bacterial strains, cell lines, and culture conditions.

The C. jejuni strains used in this study are listed in Table S1 in the supplemental material and were derived from the wild-type strain 81-176 (9, 42). Routinely, C. jejuni was grown on Brucella broth agar or blood agar plates (Trypticase soy agar supplemented with 5% defibrinated horse blood [Becton Dickinson]) at 37°C under an atmosphere of 10% CO2. C. jejuni transformants were selected on plates supplemented with kanamycin (50 μg ml−1) or chloramphenicol (7.5 μg ml−1), as indicated. For liquid cultures, C. jejuni strains were grown in brain heart infusion (BHI).

For growth assays, C. jejuni cultures were adjusted to an optical density at 600 nm (OD600) of 0.1 to 0.2 in 3 ml of BHI and were grown under an atmosphere of 10% CO2 in a rotating wheel (50 rpm). Bacterial growth was monitored by measuring the OD600 with a spectrophotometer (Spectronic 20; Genesys). The plating efficiency of the cultures was monitored by plating appropriate dilutions on blood agar plates.

COS-7 (an African green monkey kidney fibroblast-like cell line) or T84 (a human colon carcinoma cell line) cells were obtained from the American Type Culture Collection (Manassas, VA) and grown in Dulbecco's modified Eagle medium supplemented with 10% fetal bovine serum. All cell lines were grown under a 5% CO2 atmosphere.

The Tn552 insertion point was determined by nucleotide sequencing using primers (5′-CCAATTCTCGTTTTCATACC-3′ and 5′-GGATCAAGCCTGATTGGGAG-3′) complementary to the aphA cassette present in the transposable element. The transposable element was found to be inserted at nucleotide 260 of the CJJ81176_1087 open reading frame of C. jejuni.

DNA manipulations.

DNA manipulations were performed according to standard protocols described elsewhere (69). Bacterial genomic and plasmid DNAs were isolated using the DNeasy tissue and QIAprep spin miniprep kits (Qiagen), respectively.

To construct a tagged version of C. jejuni 81-176 VirK, a FLAG epitope tag was fused to the C terminus of the CJJ81176_1087 gene. CJJ81176_1087 was PCR amplified with primers Cj1069/81-176_5_EcoRI (GGAATTCGCTTGATGGAGGACATATACTTT) and Cj1069/81-176_3_NcoI_FLAG (CATGCCATGGCGTCTTGAATATCCAATGTCTTAT) and was cloned in frame into a vector encoding three copies of the FLAG epitope. To move the tagged version of virK into the C. jejuni chromosome, the virK-3xFLAG gene was cloned downstream of the chloramphenicol acetyltransferase cassette (cat cassette) of the previously described plasmid pSB3021 (80). This plasmid allows the integration of a gene of interest into a C. jejuni CJJ81176_1539 chromosomal locus that encodes a component of a restriction/modification system and is not required for virulence. The resulting plasmid was introduced into both wild-type C. jejuni 81-176 and the virK mutant derivative by natural transformation, creating C. jejuni strains CB32 and CB35, respectively. Natural transformation in C. jejuni was carried out as described elsewhere (27, 78).

Bacterial invasion assay.

The ability of C. jejuni to invade cultured intestinal epithelial cells was evaluated by a standard gentamicin protection assay as described elsewhere, with minor modifications (59, 79). T84 or COS cells were split to about 70% confluence (~105 cells per well) in 24-well plates the day before an experiment. To prepare the bacterial inoculum, C. jejuni strains were first grown in BHI medium to early-logarithmic phase (OD600, ~0.5) and then adjusted to an OD600 of ~0.1 using Hanks balanced salt solution (HBSS) (Invitrogen). Cell monolayers were infected at a multiplicity of infection (MOI) of ~10, and the plates were spun down at 200 × g for 5 min to enhance bacterium-host cell contact and were then incubated for 2 h at 37°C under 5% CO2. Following incubation, the infected monolayers were washed three times with buffered saline containing 1% gelatin, and prewarmed Dulbecco's modified Eagle medium containing gentamicin (200 μg ml−1) was added for 3 h to kill extracellular bacteria. Cells were washed again and lysed with 0.1% sodium deoxycholic acid (Sigma) in phosphate-buffered saline (PBS) to release the intracellular bacteria. Alternatively, cells were lysed by mechanical disruption in water. The invasion ability was expressed as the percentage of the inoculum that survived treatment with gentamicin. Each assay was conducted in triplicate and was independently repeated at least three times.

Sodium deoxycholate sensitivity assay.

To determine sensitivity to sodium deoxycholate under conditions resembling those of the invasion assay, C. jejuni strains were first grown in BHI medium to early-logarithmic phase (OD600, ~0.5) and then adjusted to a concentration of ~108 bacteria per ml in HBSS. One hundred microliters of bacterial cell suspension was transferred to microcentrifuge tubes containing 900 μl of either 0.1% sodium deoxycholate or HBSS. Samples were left at room temperature for 20 min, and the numbers of CFU were determined by plating on blood agar.

Surface hydrophobicity assay.

The surface hydrophobicity assay was carried out as previously described (33).

Bacterial motility assays.

The bacterial culture to be tested was adjusted to an OD600 of ~0.1, and 2 μl was spotted onto soft agar (0.5%, wt/vol). Plates were incubated for ~24 h at 37°C; the swarming diameter of the tested strain was compared to that of the wild type and the nonmotile flaA (or motA) strain. In addition, bacterial cultures were examined for motility by light microscopy immediately before their utilization in the invasion assays.

Mouse infections.

The ability of C. jejuni to colonize mice was tested with a recently developed mouse infection model that has been described in detail elsewhere (80). Six- to 8-week-old myd88−/− nramp-1−/− male mice were infected orally by stomach gavage with 109 CFU or intraperitoneally with 107 CFU of the different C. jejuni strains. At the indicated time points, feces were collected into BHI broth, weighed, and plated onto blood agar plates containing Campylobacter-selective supplements (Oxoid SR0167E) to determine the number of CFU per gram of feces. To differentiate between C. jejuni strains, antibiotics (kanamycin at 50 μg ml−1 or chloramphenicol at 7.5 μg ml−1) were added to selective medium when appropriate. At the end of the experiment, mice were sacrificed; their organs were aseptically removed and homogenized in HBSS; and the bacterial loads in the different tissues were enumerated by plating on selective plates as described above. Statistical analysis of the results was carried out with the Wilcoxon matched-pair signed-rank test.

Serum resistance assay.

To test the resistance of the different C. jejuni strains to the bactericidal effects of serum, cultures were grown in BHI broth to early-logarithmic phase (OD600, ~0.5), recovered by centrifugation, and suspended in HBSS medium. About 5 × 107 bacteria were added to 500 μl of HBSS containing an indicated percentage of either normal or heat-inactivated (30 min at 60°C; stored at −20°C) rabbit serum. Samples were incubated at 37°C under a 5% CO2 atmosphere for the time indicated, and series of 10-fold dilutions in HBSS containing 10 mM EDTA were plated onto blood agar plates. Survival was calculated as the percentage of CFU obtained for serum-treated bacteria relative to the number of CFU from the heat-inactivated serum control.

Polymyxin B and Magainin-1 sensitivity assay.

To determine sensitivity to polymyxin B sulfate (Sigma) or Magainin-1 (AnaSpec, San Jose, CA), C. jejuni strains were first grown in BHI medium to early-logarithmic phase (OD600, ~0.5) and then adjusted to a concentration of ~106 bacteria per ml in PBS. Cell suspensions were treated with different concentrations of polymyxin B or Magainin-1 and were incubated for 45 min (for polymyxin B) or 20 min (for Magainin-1) at 37°C. The CFU after treatment was determined by plating on blood agar. Statistical analysis of the results was carried out with the Student t test.

Subcellular fractionation.

Bacterial subcellular fractionation was carried out as described elsewhere (43), with some modifications. C. jejuni cultures were grown to an OD600 of ~0.3 to 0.5, and cells were harvested by centrifugation at 4,000 rpm for 15 min. Bacterial cells were resuspended in 1 ml of chilled PBS containing 0.1 mg of lysozyme/ml, 1 mM phenylmethylsulfonyl fluoride, and 10 mM EDTA; then they were incubated on ice for 1 h. C. jejuni cells were lysed by sonication (Branson Sonifier with a microtip duty of 50%; power 5) and clarified by centrifugation at 17,000 × g for 10 min (twice) to eliminate cell debris and unbroken cells. Samples were passed through a 0.22-μm-pore-size filter (Millex-GV) to remove unlysed bacteria. The supernatant was transferred to a fresh tube, and cell envelopes were collected by centrifugation at 100,000 × g for 1 h at 4°C. After centrifugation, the supernatant containing cytoplasmic and periplasmic soluble proteins was transferred to a fresh tube, and pellets were washed with PBS by ultracentrifugation (100,000 × g for 1 h at 4°C). The tagged protein was extracted from membrane pellets by suspending membrane fractions in either (i) PBS, (ii) 1 M NaCl and 100 mM Na2CO3 (pH 11.0), or (iii) 0.5% sodium lauroyl sarcosinate (Sarkosyl NL; Sigma) and 5 mM EDTA. After 1 h of incubation at 4°C, samples were subjected to high-speed centrifugation (100,000 × g for 1 h at 4°C), and the resulting pellet and supernatant fractions were analyzed for the presence of VirK by Western immunoblotting. Analysis of protein in culture supernatants was done as described elsewhere (17).

Immunofluorescence microscopy.

Intracellular and extracellular bacteria were enumerated by fluorescence microscopy as previously described (23). COS cells were first grown on poly l-lysine-treated 12-mm-diameter round glass coverslips to ~70% confluence and then infected with C. jejuni at an MOI of 50 in HBSS for 2 h. Cells were briefly washed with PBS, fixed in a 2% paraformaldehyde solution for 15 min at room temperature, and incubated in a 5% suspension of nonfat dry milk (Carnation) in PBS for 30 min. Fixed cells were incubated with rabbit anti-C. jejuni 81-176 serum in PBS containing 5% (wt/vol) milk for 30 min. Cells were washed three times with PBS and incubated with Alexa Fluor 488-conjugated goat anti-rabbit immunoglobulin G (1:1,000; Molecular Probes) for 30 min. The coverslips were washed with PBS and permeabilized with PBS containing 0.05% (wt/vol) saponin for 15 min. Cell were incubated again with rabbit anti-C. jejuni 81-176 serum, washed three times with PBS containing 0.05% (wt/vol) saponin, and incubated with Alexa Fluor 568-conjugated goat anti-rabbit immunoglobulin G (1:1,000; Molecular Probes) to stain intracellular bacteria. Cell nuclei were stained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI). The coverslips were mounted onto glass slides with ProLong Gold antifade reagent (Molecular Probes), and the numbers of intracellular bacteria per cell were quantified under a fluorescence microscope (Nikon Diaphot 300) with a 100× (numerical aperture, 1.4) oil immersion objective.

Extraction of LOS.

C. jejuni lipooligosaccharides (LOS) were prepared from whole-cell lysates as described previously (19). LOS were separated on 16% Tricine gels (70) and either silver stained as described elsewhere (61) or analyzed by Western immunoblotting using primary rabbit antibodies generated against heat- or formalin-killed C. jejuni strain 81-176 bacteria.

Membrane fractionation and 2D gel electrophoresis.

Membrane fractionation was carried out essentially as described elsewhere (77) using a continuous 29-to-50% sucrose gradient (wt/vol) and a gradient maker (Gradient Station; BioComp Instruments, Inc., Canada). Fractions that had the highest correspondence to the inner and outer membrane proteins were subjected to differential fluorescence 2-dimensional (2D) gel electrophoresis proteome profiling at the Keck Biotechnology Resource Laboratory (Yale University) using protein labeling with Cy3 and Cy5 N-hydroxysuccinimidyl ester dyes according to its standardized protocol (http://keck.med.yale.edu/dige).

RESULTS

A VirK protein homolog is required for the efficient interaction of C. jejuni 81-176 with cultured epithelial cells.

During a screen to identify C. jejuni 81-176 Tn552-kan transposon insertion mutants defective for entry into and/or survival within epithelial cells (V. Novik and J. E. Galán, unpublished data), we isolated an insertion mutant that mapped to the CJJ81176_1087 open reading frame (Cj1069 in the reference strain NCTC 11168), which encodes a homolog of the VirK family of proteins (Fig. (Fig.1).1). VirK was first identified in Shigella flexneri as a factor required for the efficient intercellular dissemination of this pathogen (56). A homolog of VirK has also been identified in Salmonella enterica serovar Typhimurium as a virulence factor required for intracellular replication and mouse virulence (13, 20). We will therefore refer to Cjj81176_1087 as VirK. To verify that the entry defect was due to the inactivation of virK, we constructed a C. jejuni virK mutant derivative carrying a FLAG epitope-tagged wild-type copy of the inactivated gene elsewhere in the chromosome (see Materials and Methods). As shown in Fig. Fig.2A,2A, the invasion defect of the virK mutant was fully restored by the introduction of a functional copy of virK. All strains exhibited equal sensitivities to gentamicin (data not shown).

FIG. 1.
Amino acid sequence comparison of C. jejuni CJJ81176_1087 with VirK protein family members from pathogenic bacteria. The proteins and organisms used in the alignment are as follows (from top to bottom): hypothetical protein APL_0453 of Actinobacillus ...
FIG. 2.
Ability of a C. jejuni 81-176 virK mutant strain to enter and survive within cultured cells. (A) Cultured cells were infected with C. jejuni 81-176 (wild type [WT]), the isogenic virK mutant, or the complemented virK mutant at an MOI of 10 for 2 h, followed ...

The invasion assay protocol used in these studies requires lysis of the mammalian cells by addition of 0.1% sodium deoxycholate. At this concentration, this detergent does not affect the viability of the wild-type bacteria. However, certain mutations are known to increase the sensitivity of C. jejuni to this compound (49). To rule out the possibility that the observed phenotype of the C. jejuni virK mutant strain was due to increased sensitivity to the detergent, this strain was treated with 0.1% sodium deoxycholate for 20 min, and its viability was compared to that of the equally treated wild-type parent strain. No difference in the sensitivity of these strains to sodium deoxycholate was detected (see Fig. S1 in the supplemental material), and equivalent results were obtained when cells were lysed mechanically in the presence of water during the invasion assay (data not shown). Therefore, the differences observed in the invasion assay reflect the intrinsic differences in these strains' abilities to invade and/or survive within cultured intestinal epithelial cells.

The gentamicin protection assay used in the screen cannot distinguish between a defect in bacterial entry and a loss of viability immediately after entry. To distinguish between these phenotypes, we examined the ability of the C. jejuni virK mutant to enter cultured epithelial cells by a microscopy-based assay. This assay uses a staining protocol that can distinguish between internalized and extracellular bacteria. Furthermore, this assay is independent of strain culturability after infection. Using this assay, we detected no significant defect in the ability of the C. jejuni virK mutant to enter epithelial cells (Fig. (Fig.2B).2B). We therefore conclude that the viability of C. jejuni virK decreases shortly after entry into epithelial cells.

Subcellular localization of the C. jejuni VirK protein.

Based on the secondary structural features and hydropathy profile of Shigella flexneri VirK, and the fact that it lacks a typical secretion signal, it has been hypothesized previously that VirK is localized in the bacterial cytoplasm (56). However, no studies have been conducted to investigate specifically the localization of any VirK family member. Although some studies have suggested that Shigella flexneri VirK and its homolog in S. Typhimurium may be involved in the remodeling of the bacterial envelope (12, 81), no studies have addressed how these proteins may exert their function. To gain insight into the function of C. jejuni VirK, we examined its subcellular localization. First, we constructed a FLAG epitope-tagged version of VirK and examined its ability to complement the virK mutation. The VirK-FLAG protein was able to complement the intracellular survival defect of this mutant strain, indicating that the presence of the FLAG epitope tag did not affect the function of VirK or, presumably, its subcellular localization (Fig. (Fig.2A).2A). We then carried out subcellular fractionation of C. jejuni and probed for the presence of VirK-FLAG in the different fractions by Western immunoblotting. VirK-FLAG was equally present in the cytoplasmic and membrane fractions (Fig. (Fig.3)3) but was absent from the culture supernatant (data not shown). Interestingly, in the cytoplasmic fraction, VirK migrated as a distinct doublet with an estimated difference of ~1.4 kDa (Fig. (Fig.3).3). We hypothesize that this difference is due to the presence of an alternative start codon in the virK gene, which would result in a longer version of this protein (see Fig. S2 in the supplemental material). The significance of the alternative start codon for virK or the extra amino acids is unknown. To probe the nature of the association of VirK with the membrane, the bacterial membrane fraction was subjected to different extraction procedures. Washing with PBS resulted in no extraction of VirK from the membrane, while treatment with high-salt and high-pH solutions resulted in only partial extraction (Fig. (Fig.3).3). Only treatment with 0.5% Sarkosyl completely solubilized VirK. Taken together, these results indicate that VirK is peripherally (although tightly) associated to the cytoplasmic side of the plasma membrane.

FIG. 3.
Subcellular localization of C. jejuni VirK. C. jejuni strain CB32, which encodes FLAG epitope-tagged VirK, was subjected to subcellular fractionation as described in Materials and Methods. The membrane fraction was treated as indicated, and the level ...

Comparison of the total envelope protein profiles of C. jejuni wild-type and virK mutant strains.

The finding that VirK is cytoplasmic or peripherally associated to the cytoplasmic side of the inner membrane suggested that it exerts its effect on intracellular survival indirectly, perhaps by modulating the composition of the bacterial envelope. To test this hypothesis, we compared the total protein profiles of bacterial envelopes isolated from wild-type C. jejuni 81-176 and its isogenic virK mutant strain by using differential fluorescence 2D gel electrophoresis proteome profiling. No significant differences in the protein profiles of the envelope fractions of these two bacterial strains were detected (see Fig. S3A and B in the supplemental material), indicating that the absence of VirK does not significantly alter the protein composition of the bacterial envelope. Consistent with this hypothesis, no difference in the surface hydrophobicity profiles of the wild type and the virK mutant derivative was detected by the salting-out method as described in Materials and Methods (data not shown).

VirK does not affect the growth of C. jejuni in vitro.

We compared the ability of the C. jejuni virK mutant strain to grow in liquid culture with that of the wild type, both when grown separately and in mixed cultures. As shown in Fig. S4 in the supplemental material, the growth properties of C. jejuni virK were indistinguishable from those of the wild type or the complemented mutant. These results indicate that VirK is not required for C. jejuni growth in vitro.

VirK is essential for systemic infection with C. jejuni in a mouse colonization model.

Previous studies demonstrated that VirK plays an important role in systemic S. Typhimurium infection in mice (20, 47). We therefore tested whether the C. jejuni homolog played a similar role during infection by using a recently developed mouse colonization model (80). Equal numbers of the wild-type C. jejuni strain (or the complemented virK mutant strain) and the virK mutant strain were simultaneously administered orally or intraperitoneally to MyD88/Nramp1-deficient mice. The presence of different C. jejuni strains in the feces of infected animals was monitored over time as described in Materials and Methods. When bacteria were administered intraperitoneally, the virK mutant strain was cleared rapidly, while the wild type or the complemented strain was readily recovered from the feces (Fig. 4A and C). No CFU from the mutant strain was detected in the feces 2 weeks postinfection when the mutant strain was competed against the complemented strain (Fig. (Fig.4C).4C). When the virK mutant strain was competed against the wild type, only one mouse out of six shed a small number of CFU of the mutant 6 weeks postinfection, while the levels of the wild-type strain remained high (Fig. (Fig.4A).4A). Six weeks after infection, low levels of C. jejuni virK were recovered from tissues of only one infected animal in each group (Fig. 4B and D). However, those numbers were still significantly lower than those of the wild-type strain. When administered orally, the numbers of CFU of the virK mutant strain in the feces of infected animals were also lower than those of the complemented mutant strain (Fig. (Fig.5A).5A). However, the intestinal colonization defect was not as pronounced as when the mutant was administered intraperitoneally and did not reach statistical significance. The numbers of CFU of the virK mutant strain in systemic tissues after oral inoculation were also significantly lower than those of the complemented mutant strain (Fig. (Fig.5B).5B). In summary, our results demonstrate that C. jejuni VirK plays an important role in colonization and systemic infection in a mouse model of infection.

FIG. 4.
C. jejuni virK is attenuated after intraperitoneal infection in a mouse colonization model. (A and B) Equal numbers of wild-type C. jejuni 81-176 and its virK mutant derivative were administered intraperitoneally to myd88−/− mice. (A) ...
FIG. 5.
Colonization of mice by C. jejuni virK after oral infection. Equal numbers of the complemented mutant strain and the virK mutant derivative were administered to myd88−/− mice by stomach gavage. The numbers of CFU of the complemented mutant ...

VirK is essential for C. jejuni resistance to antimicrobial peptides.

The resistance to complement-mediated bactericidal activity in serum is critical for a number of gram-negative pathogens to establish successful systemic infections in their hosts (3, 18, 37, 66, 71). Previous observations suggested that C. jejuni strains are susceptible to the killing action of complement (11), which may be related to the usually transient nature of C. jejuni-associated bacteremia (26, 46). However, some isolates can cause systemic infection in immunocompromised hosts, suggesting that these strains may have increased serum resistance (10, 35). Since the virK mutant showed a severe defect in its ability to colonize, spread, and survive in systemic tissues, we examined whether this mutant had increased sensitivity to serum. We compared the C. jejuni virK mutant with its complemented derivative for the ability to survive in the presence of 2% and 10% normal rabbit serum (see Materials and Methods for experimental details). While the percentage of bacteria that survived treatment with 2% serum for 60 min remained relatively high, the bacteria treated with 10% serum declined sharply in numbers after 30 min, and by 60 min both the mutant and complemented strains exhibited 20-fold reductions in CFU (see Fig. S5 in the supplemental material). These data are in agreement with the findings of a previous report, which tested the sensitivities of different C. jejuni isolates to 10% human serum (11), and they indicate that the absence of VirK does not result in increased serum sensitivity.

Antimicrobial peptides are an essential component of host innate immunity (14, 28). Resistance to killing by antimicrobial peptides is an essential virulence attribute of many pathogenic bacteria, and of enteropathogens in particular. It has been shown previously that the S. Typhimurium VirK protein is required for resistance to antimicrobial peptides (13, 20). Therefore we examined whether the C. jejuni VirK homolog would have a similar role. First, we tested the sensitivity of the C. jejuni VirK homolog to polymyxin B, since this antibiotic is known to bind to bacterial lipopolysaccharide and to mimic the action of antimicrobial peptides (7, 20, 24, 73). Wild-type C. jejuni, the virK mutant, and its complemented derivative were exposed in vitro to different concentrations of polymyxin B, and the numbers of surviving bacteria 45 min after treatment were determined by enumerating the CFU. As shown in Fig. Fig.6A,6A, the virK mutant strain was significantly more sensitive to polymyxin B treatment than the wild type strain.

FIG. 6.
C. jejuni virK exhibits increased susceptibility to antimicrobial peptides. Wild-type (WT) C. jejuni 81-176, the virK mutant, and the complemented mutant derivative [virK (+virK)] were treated with the indicated amounts of polymyxin B (PB) (as ...

We then tested the sensitivity of the virK strain to the antimicrobial peptide Magainin-1, which has been shown previously to be a good surrogate for testing overall sensitivity to antimicrobial peptides (72). Consistent with the polymyxin B resistance results, the C. jejuni virK mutant strain showed very significantly increased (>100-fold) sensitivity to this antimicrobial peptide relative to that of either the wild type or the complemented mutant (Fig. (Fig.6B).6B). In summary, these results showed that VirK is required for resistance to antimicrobial peptides, which may explain its important role in C. jejuni mouse colonization.

DISCUSSION

One of the surprising findings that emerged from the analyses of genome sequences from several C. jejuni isolates is the paucity of putative homologs of virulence factors from other pathogenic bacteria (22, 32, 62, 65). Here we have described the identification of a C. jejuni 81-176 gene, CJJ81176_1087, which encodes a homolog of the VirK family of virulence factors. Although little is known about the specific mechanisms by which the VirK homologs in various pathogens exert their function, it is intriguing that VirK family members are encoded by many pathogenic bacteria. For example, in addition to the VirK protein of Shigella spp., the first family member identified, homologs of this protein have been found in Salmonella enterica (also known as VirK) and Pasteurella multocida (LapB) (20, 29, 39, 53, 56).

We found that the C. jejuni virK mutant has a pronounced defect in its ability to colonize the intestine and deeper tissue of a mouse after either oral or systemic administration. This mutant strain also exhibited a reproducible defect in its ability to survive upon internalization into epithelial cells. However, we do not believe that the severe colonization defect observed in a mouse model of infection is a result of the intracellular survival defect of this strain. Neither do we believe that the observed reduction in the intracellular survival of the mutant strain is significant enough to suggest that this gene product is directly involved in mediating this process. Rather, we believe that the intracellular survival defect may be an indirect result of some changes in the composition of the C. jejuni envelope that may indirectly affect this phenotype. This is consistent with the observation that VirK is located within the bacterial cytoplasm, peripherally associated to the inner membrane, a location that makes this protein unlikely to mediate intracellular survival directly.

What could account for the profound defect in mouse colonization exhibited by the C. jejuni virK mutant strain? We hypothesize that the colonization defect is due largely to the increased susceptibility of the mutant strain to antimicrobial peptides. Indeed, antimicrobial peptides are one of the most important lines of defense against bacterial pathogens, and the virK mutant strain exhibited a >100-fold increase in susceptibility to at least one antimicrobial peptide in vitro. Consistent with this hypothesis, a virK mutant of S. Typhimurium, which is also defective in mouse colonization, exhibited significantly increased susceptibility to antimicrobial peptides (13, 20). This observation also suggests that these two protein homologs may exert their effect in a similar manner.

What could be the role of VirK in conferring resistance to antimicrobial peptides? The intracellular location of VirK suggests that it is unlikely to mediate antimicrobial peptide resistance directly. Rather, it is possible that VirK may modulate the composition of the bacterial envelope, which is the target of the antimicrobial peptide activity. We compared the protein profiles of the bacterial envelopes of wild-type C. jejuni and the isogenic virK mutant strain by differential fluorescence gel electrophoresis proteome profiling. However, despite the relative sensitivity of this technique, we found no significant differences between the envelope protein profiles of these strains. Although it is possible that differences could have escaped detection, we believe that this is unlikely. Rather, it is possible that VirK may be responsible for modulating the composition of other surface structures, such as the LOS or the capsule polysaccharide, or the lipid composition of the inner membrane itself. We did examine the LOS of both strains and found no gross differences (see Fig. S6 in the supplemental material), but it is possible that differences may have escaped detection by the rather insensitive approach we used in the analysis.

Our studies do not shed light on the actual mechanism by which VirK may exert its function. It should be noted that several VirK homologs are missannotated in the available databases as either putative transporters, ATPases, or ATP-binding cassette proteins. Furthermore, we have detected no predicted transmembrane domains in any of the many DUF535 homologs that we have analyzed, despite the fact that some of them are annotated as membrane proteins. Although we are not certain where the annotation errors come from, it is likely that they are due to automatic annotation, which has not been followed by careful curation. With the possible exception of a homolog in Pseudomonas entomophila, all DUF535 proteins, like VirK, are composed of a single domain (i.e., the DUF535 domain). The exception, a homolog in which the DUF535 domain is linked to a putative glycosyl transferase, is most likely a sequencing error, since in highly related bacteria, DUF535 and the glycosyl transferases are encoded by separate, immediately adjacent genes. Since it is unlikely that VirK has enzymatic activity, we hypothesize that it may modulate the activities of other bacterial proteins, perhaps by locating them to an appropriate site, quite possibly to the inner leaflet of the bacterial inner membrane, where VirK is primarily localized. In fact, it has been shown previously that the Shigella sp. VirK protein influences the ability of this bacterium to spread intracellularly (56). It is believed that VirK exerts this effect by regulating the stability and/or activity of IcsP, a protease required for the posttranslational regulation of IcsA (81). The latter is a Shigella surface protein that catalyzes actin nucleation at one of its poles (8, 48). C. jejuni 81-176 encodes a putative peptidase immediately upstream of CJJ81176_1087. This protease, CJJ81176_1086, belongs to the M50 family of metalloproteases, involved in regulated intramembrane proteolysis (51). Interestingly, a member of this family in Mycobacterium tuberculosis, Rv2860c, posttranslationally regulates a factor involved in modulating the cell envelope composition (50). Another member of this family, YaeL, degrades the virulence regulator TcpP in Vibrio cholerae under certain environmental conditions (52). Nevertheless, it is unknown whether C. jejuni VirK regulates the activity of the CJJ81176_1086 peptidase. Addressing the potential relationship between VirK and CJJ81176_1086 will require further experimentation, which is beyond the scope of this study.

In summary, we have characterized a C. jejuni protein that belongs to the VirK family of virulence factors and have determined that it plays an important role in virulence in a mouse model of infection. This protein, therefore, joins CDT as one of the rather limited number of virulence factors in C. jejuni for which homologs exist in other pathogenic bacteria.

Supplementary Material

[Supplemental material]

Acknowledgments

We thank María Lara-Tejero for providing the Myd88−/− mice and Heather Scobie for useful discussion and critical review of the manuscript.

This work was supported by a grant from the Ellison Medical Foundation to J.E.G.

Notes

Editor: V. J. DiRita

Footnotes

[down-pointing small open triangle]Published ahead of print on 21 September 2009.

Supplemental material for this article may be found at http://iai.asm.org/.

REFERENCES

1. Aguero-Rosenfeld, M. E., X. H. Yang, and I. Nachamkin. 1990. Infection of adult Syrian hamsters with flagellar variants of Campylobacter jejuni. Infect. Immun. 58:2214-2219. [PMC free article] [PubMed]
2. Allos, B. M. 2001. Campylobacter jejuni infections: update on emerging issues and trends. Clin. Infect. Dis. 32:1201-1206. [PubMed]
3. Anderson, P., R. B. Johnston, Jr., and D. H. Smith. 1972. Human serum activities against Hemophilus influenzae, type b. J. Clin. Investig. 51:31-38. [PMC free article] [PubMed]
4. Aspinall, G. O., S. Fujimoto, A. G. McDonald, H. Pang, L. A. Kurjanczyk, and J. L. Penner. 1994. Lipopolysaccharides from Campylobacter jejuni associated with Guillain-Barré syndrome patients mimic human gangliosides in structure. Infect. Immun. 62:2122-2125. [PMC free article] [PubMed]
5. Bachtiar, B. M., P. J. Coloe, and B. N. Fry. 2007. Knockout mutagenesis of the kpsE gene of Campylobacter jejuni 81116 and its involvement in bacterium-host interactions. FEMS Immunol. Med. Microbiol. 49:149-154. [PubMed]
6. Bacon, D. J., C. M. Szymanski, D. H. Burr, R. P. Silver, R. A. Alm, and P. Guerry. 2001. A phase-variable capsule is involved in virulence of Campylobacter jejuni 81-176. Mol. Microbiol. 40:769-777. [PubMed]
7. Bader, M. W., W. W. Navarre, W. Shiau, H. Nikaido, J. G. Frye, M. McClelland, F. C. Fang, and S. I. Miller. 2003. Regulation of Salmonella typhimurium virulence gene expression by cationic antimicrobial peptides. Mol. Microbiol. 50:219-230. [PubMed]
8. Bernardini, M. L., J. Mounier, H. d'Hauteville, M. Coquis-Rondon, and P. J. Sansonetti. 1989. Identification of icsA, a plasmid locus of Shigella flexneri that governs bacterial intra- and intercellular spread through interaction with F-actin. Proc. Natl. Acad. Sci. USA 86:3867-3871. [PubMed]
9. Black, R. E., M. M. Levine, M. L. Clements, T. P. Hughes, and M. J. Blaser. 1988. Experimental Campylobacter jejuni infection in humans. J. Infect. Dis. 157:472-479. [PubMed]
10. Blaser, M. J., D. S. Boose, W. Wang, and F. M. LaForce. 1979. Serum bactericidal activity toward Campylobacter fetus ss. jejuni and ss. intestinalis. Clin. Res. 27:137-142.
11. Blaser, M. J., P. F. Smith, and P. F. Kohler. 1985. Susceptibility of Campylobacter isolates to the bactericidal activity of human serum. J. Infect. Dis. 151:227-235. [PubMed]
12. Brodsky, I. E., R. K. Ernst, S. I. Miller, and S. Falkow. 2002. mig-14 is a Salmonella gene that plays a role in bacterial resistance to antimicrobial peptides. J. Bacteriol. 184:3203-3213. [PMC free article] [PubMed]
13. Brodsky, I. E., N. Ghori, S. Falkow, and D. Monack. 2005. Mig-14 is an inner membrane-associated protein that promotes Salmonella typhimurium resistance to CRAMP, survival within activated macrophages and persistent infection. Mol. Microbiol. 55:954-972. [PubMed]
14. Brown, K. L., and R. E. Hancock. 2006. Cationic host defense (antimicrobial) peptides. Curr. Opin. Immunol. 18:24-30. [PubMed]
15. Caldwell, M. B., P. Guerry, E. C. Lee, J. P. Burans, and R. I. Walker. 1985. Reversible expression of flagella in Campylobacter jejuni. Infect. Immun. 50:941-943. [PMC free article] [PubMed]
16. Candon, H. L., B. J. Allan, C. D. Fraley, and E. C. Gaynor. 2007. Polyphosphate kinase 1 is a pathogenesis determinant in Campylobacter jejuni. J. Bacteriol. 189:8099-8108. [PMC free article] [PubMed]
17. Collazo, C. M., and J. E. Galan. 1996. Requirement for exported proteins in secretion through the invasion-associated type III system of Salmonella typhimurium. Infect. Immun. 64:3524-3531. [PMC free article] [PubMed]
18. Davis, S. D., and R. J. Wedgwood. 1965. Kinetics of the bactericidal action of normal serum on gram-negative bacteria. J. Immunol. 95:75-79. [PubMed]
19. DeLeo, F. R., and M. W. Otto (ed.). 2008. Methods in molecular biology, vol. 431. Bacterial pathogenesis: methods and protocols. Humana Press, Totowa, NJ.
20. Detweiler, C. S., D. M. Monack, I. E. Brodsky, H. Mathew, and S. Falkow. 2003. virK, somA and rcsC are important for systemic Salmonella enterica serovar Typhimurium infection and cationic peptide resistance. Mol. Microbiol. 48:385-400. [PubMed]
21. Fauchere, J. L., A. Rosenau, M. Veron, E. N. Moyen, S. Richard, and A. Pfister. 1986. Association with HeLa cells of Campylobacter jejuni and Campylobacter coli isolated from human feces. Infect. Immun. 54:283-287. [PMC free article] [PubMed]
22. Fouts, D. E., E. F. Mongodin, R. E. Mandrell, W. G. Miller, D. A. Rasko, J. Ravel, L. M. Brinkac, R. T. DeBoy, C. T. Parker, S. C. Daugherty, R. J. Dodson, A. S. Durkin, R. Madupu, S. A. Sullivan, J. U. Shetty, M. A. Ayodeji, A. Shvartsbeyn, M. C. Schatz, J. H. Badger, C. M. Fraser, and K. E. Nelson. 2005. Major structural differences and novel potential virulence mechanisms from the genomes of multiple Campylobacter species. PLoS Biol. 3:e15. [PMC free article] [PubMed]
23. Fu, Y., and J. E. Galan. 1998. The Salmonella typhimurium tyrosine phosphatase SptP is translocated into host cells and disrupts the actin cytoskeleton. Mol. Microbiol. 27:359-368. [PubMed]
24. Groisman, E. A., J. Kayser, and F. C. Soncini. 1997. Regulation of polymyxin resistance and adaptation to low-Mg2+ environments. J. Bacteriol. 179:7040-7045. [PMC free article] [PubMed]
25. Guccione, E., M. del Rocio Leon-Kempis, B. M. Pearson, E. Hitchin, F. Mulholland, P. M. van Diemen, M. P. Stevens, and D. J. Kelly. 2008. Amino acid-dependent growth of Campylobacter jejuni: key roles for aspartase (AspA) under microaerobic and oxygen-limited conditions and identification of AspB (Cj0762), essential for growth on glutamate. Mol. Microbiol. 69:77-93. [PubMed]
26. Guerrant, R. L., R. G. Lahita, W. C. Winn, Jr., and R. B. Roberts. 1978. Campylobacteriosis in man: pathogenic mechanisms and review of 91 bloodstream infections. Am. J. Med. 65:584-592. [PubMed]
27. Guerry, P., R. Yao, R. A. Alm, D. H. Burr, and T. J. Trust. 1994. Systems of experimental genetics for Campylobacter species. Methods Enzymol. 235:474-481. [PubMed]
28. Hancock, R. E. 2001. Cationic peptides: effectors in innate immunity and novel antimicrobials. Lancet Infect. Dis. 1:156-164. [PubMed]
29. Hattori, Y., K. Iwata, K. Suzuki, M. Uraji, N. Ohta, A. Katoh, and K. Yoshida. 2001. Sequence characterization of the vir region of a nopaline type Ti plasmid, pTi-SAKURA. Genes Genet. Syst. 76:121-130. [PubMed]
30. Hendrixson, D. R., and V. J. DiRita. 2004. Identification of Campylobacter jejuni genes involved in commensal colonization of the chick gastrointestinal tract. Mol. Microbiol. 52:471-484. [PubMed]
31. Hofreuter, D., V. Novik, and J. E. Galan. 2008. Metabolic diversity in Campylobacter jejuni enhances specific tissue colonization. Cell Host Microbe 4:425-433. [PubMed]
32. Hofreuter, D., J. Tsai, R. O. Watson, V. Novik, B. Altman, M. Benitez, C. Clark, C. Perbost, T. Jarvie, L. Du, and J. E. Galan. 2006. Unique features of a highly pathogenic Campylobacter jejuni strain. Infect. Immun. 74:4694-4707. [PMC free article] [PubMed]
33. Jeon, B., W. Muraoka, A. Scupham, and Q. Zhang. 2009. Roles of lipooligosaccharide and capsular polysaccharide in antimicrobial resistance and natural transformation of Campylobacter jejuni. J. Antimicrob. Chemother. 63:462-468. [PMC free article] [PubMed]
34. Jin, S., A. Joe, J. Lynett, E. K. Hani, P. Sherman, and V. L. Chan. 2001. JlpA, a novel surface-exposed lipoprotein specific to Campylobacter jejuni, mediates adherence to host epithelial cells. Mol. Microbiol. 39:1225-1236. [PubMed]
35. Johnson, R. J., C. Nolan, S. P. Wang, W. R. Shelton, and M. J. Blaser. 1984. Persistent Campylobacter jejuni infection in an immunocompromised patient. Ann. Intern. Med. 100:832-834. [PubMed]
36. Johnson, W. M., and H. Lior. 1988. A new heat-labile cytolethal distending toxin (CLDT) produced by Campylobacter spp. Microb. Pathog. 4:115-126. [PubMed]
37. Joiner, K. A. 1988. Complement evasion by bacteria and parasites. Annu. Rev. Microbiol. 42:201-230. [PubMed]
38. Karlyshev, A. V., P. Everest, D. Linton, S. Cawthraw, D. G. Newell, and B. W. Wren. 2004. The Campylobacter jejuni general glycosylation system is important for attachment to human epithelial cells and in the colonization of chicks. Microbiology 150:1957-1964. [PubMed]
39. Klumpp, J., and T. M. Fuchs. 2007. Identification of novel genes in genomic islands that contribute to Salmonella typhimurium replication in macrophages. Microbiology 153:1207-1220. [PubMed]
40. Konkel, M. E., S. G. Garvis, S. L. Tipton, D. E. Anderson, Jr., and W. Cieplak, Jr. 1997. Identification and molecular cloning of a gene encoding a fibronectin-binding protein (CadF) from Campylobacter jejuni. Mol. Microbiol. 24:953-963. [PubMed]
41. Konkel, M. E., and L. A. Joens. 1989. Adhesion to and invasion of HEp-2 cells by Campylobacter spp. Infect. Immun. 57:2984-2990. [PMC free article] [PubMed]
42. Korlath, J. A., M. T. Osterholm, L. A. Judy, J. C. Forfang, and R. A. Robinson. 1985. A point-source outbreak of campylobacteriosis associated with consumption of raw milk. J. Infect. Dis. 152:592-596. [PubMed]
43. Kubori, T., and J. E. Galan. 2002. Salmonella type III secretion-associated protein InvE controls translocation of effector proteins into host cells. J. Bacteriol. 184:4699-4708. [PMC free article] [PubMed]
44. Lara-Tejero, M., and J. E. Galan. 2000. A bacterial toxin that controls cell cycle progression as a deoxyribonuclease I-like protein. Science 290:354-357. [PubMed]
45. Lara-Tejero, M., and J. E. Galan. 2002. Cytolethal distending toxin: limited damage as a strategy to modulate cellular functions. Trends Microbiol. 10:147-152. [PubMed]
46. Lastovica, A. J., and J. L. Penner. 1983. Serotypes of Campylobacter jejuni and Campylobacter coli in bacteremic, hospitalized children. J. Infect. Dis. 147:592. [PubMed]
47. Lawley, T. D., K. Chan, L. J. Thompson, C. C. Kim, G. R. Govoni, and D. M. Monack. 2006. Genome-wide screen for Salmonella genes required for long-term systemic infection of the mouse. PLoS Pathog. 2:e11. [PMC free article] [PubMed]
48. Lett, M. C., C. Sasakawa, N. Okada, T. Sakai, S. Makino, M. Yamada, K. Komatsu, and M. Yoshikawa. 1989. virG, a plasmid-coded virulence gene of Shigella flexneri: identification of the VirG protein and determination of the complete coding sequence. J. Bacteriol. 171:353-359. [PMC free article] [PubMed]
49. Lin, J., L. O. Michel, and Q. Zhang. 2002. CmeABC functions as a multidrug efflux system in Campylobacter jejuni. Antimicrob. Agents Chemother. 46:2124-2131. [PMC free article] [PubMed]
50. Makinoshima, H., and M. S. Glickman. 2005. Regulation of Mycobacterium tuberculosis cell envelope composition and virulence by intramembrane proteolysis. Nature 436:406-409. [PMC free article] [PubMed]
51. Makinoshima, H., and M. S. Glickman. 2006. Site-2 proteases in prokaryotes: regulated intramembrane proteolysis expands to microbial pathogenesis. Microbes Infect. 8:1882-1888. [PubMed]
52. Matson, J. S., and V. J. DiRita. 2005. Degradation of the membrane-localized virulence activator TcpP by the YaeL protease in Vibrio cholerae. Proc. Natl. Acad. Sci. USA 102:16403-16408. [PubMed]
53. May, B. J., Q. Zhang, L. L. Li, M. L. Paustian, T. S. Whittam, and V. Kapur. 2001. Complete genomic sequence of Pasteurella multocida, Pm70. Proc. Natl. Acad. Sci. USA 98:3460-3465. [PubMed]
54. Morooka, T., A. Umeda, and K. Amako. 1985. Motility as an intestinal colonization factor for Campylobacter jejuni. J. Gen. Microbiol. 131:1973-1980. [PubMed]
55. Nachamkin, I. 2002. Chronic effects of Campylobacter infection. Microbes Infect. 4:399-403. [PubMed]
56. Nakata, N., C. Sasakawa, N. Okada, T. Tobe, I. Fukuda, T. Suzuki, K. Komatsu, and M. Yoshikawa. 1992. Identification and characterization of virK, a virulence-associated large plasmid gene essential for intercellular spreading of Shigella flexneri. Mol. Microbiol. 6:2387-2395. [PubMed]
57. Newell, D. G., H. McBride, F. Saunders, Y. Dehele, and A. D. Pearson. 1985. The virulence of clinical and environmental isolates of Campylobacter jejuni. J. Hyg. (London) 94:45-54. [PMC free article] [PubMed]
58. Newell, D. G., and A. Pearson. 1984. The invasion of epithelial cell lines and the intestinal epithelium of infant mice by Campylobacter jejuni/coli. J. Diarrhoeal Dis. Res. 2:19-26. [PubMed]
59. Oelschlaeger, T. A., P. Guerry, and D. J. Kopecko. 1993. Unusual microtubule-dependent endocytosis mechanisms triggered by Campylobacter jejuni and Citrobacter freundii. Proc. Natl. Acad. Sci. USA 90:6884-6888. [PubMed]
60. Pajaniappan, M., J. E. Hall, S. A. Cawthraw, D. G. Newell, E. C. Gaynor, J. A. Fields, K. M. Rathbun, W. A. Agee, C. M. Burns, S. J. Hall, D. J. Kelly, and S. A. Thompson. 2008. A temperature-regulated Campylobacter jejuni gluconate dehydrogenase is involved in respiration-dependent energy conservation and chicken colonization. Mol. Microbiol. 68:474-491. [PMC free article] [PubMed]
61. Pandey, A., J. S. Andersen, and M. Mann. 2000. Use of mass spectrometry to study signaling pathways. Sci. STKE 2000:PL1. [PubMed]
62. Parkhill, J., B. W. Wren, K. Mungall, J. M. Ketley, C. Churcher, D. Basham, T. Chillingworth, R. M. Davies, T. Feltwell, S. Holroyd, K. Jagels, A. V. Karlyshev, S. Moule, M. J. Pallen, C. W. Penn, M. A. Quail, M. A. Rajandream, K. M. Rutherford, A. H. van Vliet, S. Whitehead, and B. G. Barrell. 2000. The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature 403:665-668. [PubMed]
63. Pearson, B. M., D. J. Gaskin, R. P. Segers, J. M. Wells, P. J. Nuijten, and A. H. van Vliet. 2007. The complete genome sequence of Campylobacter jejuni strain 81116 (NCTC11828). J. Bacteriol. 189:8402-8403. [PMC free article] [PubMed]
64. Pei, Z., and M. J. Blaser. 1993. PEB1, the major cell-binding factor of Campylobacter jejuni, is a homolog of the binding component in gram-negative nutrient transport systems. J. Biol. Chem. 268:18717-18725. [PubMed]
65. Poly, F., T. Read, D. R. Tribble, S. Baqar, M. Lorenzo, and P. Guerry. 2007. Genome sequence of a clinical isolate of Campylobacter jejuni from Thailand. Infect. Immun. 75:3425-3433. [PMC free article] [PubMed]
66. Roantree, R. J., and N. C. Pappas. 1960. The survival of strains of enteric bacilli in the blood stream as related to their sensitivity to the bactericidal effect of serum. J. Clin. Investig. 39:82-88. [PMC free article] [PubMed]
67. Ruiz-Palacios, G. M. 2007. The health burden of Campylobacter infection and the impact of antimicrobial resistance: playing chicken. Clin. Infect. Dis. 44:701-703. [PubMed]
68. Russell, R. G., M. O'Donnoghue, D. C. Blake, Jr., J. Zulty, and L. J. DeTolla. 1993. Early colonic damage and invasion of Campylobacter jejuni in experimentally challenged infant Macaca mulatta. J. Infect. Dis. 168:210-215. [PubMed]
69. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
70. Schägger, H. 2006. Tricine-SDS-PAGE. Nat. Protoc. 1:16-22. [PubMed]
71. Schoolnik, G. K., T. M. Buchanan, and K. K. Holmes. 1976. Gonococci causing disseminated gonococcal infection are resistant to the bactericidal action of normal human sera. J. Clin. Investig. 58:1163-1173. [PMC free article] [PubMed]
72. Shi, Y., M. J. Cromie, F. F. Hsu, J. Turk, and E. A. Groisman. 2004. PhoP-regulated Salmonella resistance to the antimicrobial peptides magainin 2 and polymyxin B. Mol. Microbiol. 53:229-241. [PubMed]
73. Storm, D. R., K. S. Rosenthal, and P. E. Swanson. 1977. Polymyxin and related peptide antibiotics. Annu. Rev. Biochem. 46:723-763. [PubMed]
74. Szymanski, C. M., D. H. Burr, and P. Guerry. 2002. Campylobacter protein glycosylation affects host cell interactions. Infect. Immun. 70:2242-2244. [PMC free article] [PubMed]
75. van Spreeuwel, J. P., G. C. Duursma, C. J. Meijer, R. Bax, P. C. Rosekrans, and J. Lindeman. 1985. Campylobacter colitis: histological immunohistochemical and ultrastructural findings. Gut 26:945-951. [PMC free article] [PubMed]
76. Velayudhan, J., M. A. Jones, P. A. Barrow, and D. J. Kelly. 2004. l-Serine catabolism via an oxygen-labile l-serine dehydratase is essential for colonization of the avian gut by Campylobacter jejuni. Infect. Immun. 72:260-268. [PMC free article] [PubMed]
77. Wagner, S., L. Baars, A. J. Ytterberg, A. Klussmeier, C. S. Wagner, O. Nord, P. A. Nygren, K. J. van Wijk, and J. W. de Gier. 2007. Consequences of membrane protein overexpression in Escherichia coli. Mol. Cell. Proteomics 6:1527-1550. [PubMed]
78. Wang, Y., and D. E. Taylor. 1990. Natural transformation in Campylobacter species. J. Bacteriol. 172:949-955. [PMC free article] [PubMed]
79. Watson, R. O., and J. E. Galan. 2005. Signal transduction in Campylobacter jejuni-induced cytokine production. Cell. Microbiol. 7:655-665. [PubMed]
80. Watson, R. O., V. Novik, D. Hofreuter, M. Lara-Tejero, and J. E. Galan. 2007. A MyD88-deficient mouse model reveals a role for Nramp1 in Campylobacter jejuni infection. Infect. Immun. 75:1994-2003. [PMC free article] [PubMed]
81. Wing, H. J., S. R. Goldman, S. Ally, and M. B. Goldberg. 2005. Modulation of an outer membrane protease contributes to the virulence defect of Shigella flexneri strains carrying a mutation in the virK locus. Infect. Immun. 73:1217-1220. [PMC free article] [PubMed]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)