PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of aacPermissionsJournals.ASM.orgJournalAAC ArticleJournal InfoAuthorsReviewers
 
Antimicrob Agents Chemother. 2009 December; 53(12): 5288–5290.
Published online 2009 September 21. doi:  10.1128/AAC.00822-09
PMCID: PMC2786339

Detection of the Novel Extended-Spectrum β-Lactamase OXA-161 from a Plasmid-Located Integron in Pseudomonas aeruginosa Clinical Isolates from Spain[down-pointing small open triangle]

Abstract

Two clonally related Pseudomonas aeruginosa isolates, recovered from two patients admitted to a pediatric intensive care unit, were found to harbor a new OXA-2 variant (Asn148Asp), designated OXA-161. The plasmid location of blaOXA-161 was demonstrated through electroporation to PAO1, and its codification in a class I integron (together with aacA4) was demonstrated through PCR and sequencing. blaOXA-2 and blaOXA-161 were cloned in parallel to demonstrate the extended-spectrum β-lactamase properties of OXA-161, conferring resistance to ceftazidime and reduced susceptibility to cefepime and aztreonam.

Pseudomonas aeruginosa is one of the most relevant nosocomial pathogens, particularly among patients admitted to the intensive care unit (ICU), where it is the main cause of ventilator-associated pneumonia (1). Furthermore, it is a major cause of chronic respiratory infections in patients with underlying diseases such as cystic fibrosis (11). In addition to its high intrinsic antibiotic resistance, P. aeruginosa may frequently acquire additional resistance by mutation and/or by horizontal transfer of resistance determinants such as β-lactamases, often carried within class 1 integrons, that can be mobilized by transposons and/or plasmids (10, 20). The OXA-type β-lactamases (belonging to Ambler's class D group) are often detected in P. aeruginosa but also in many other gram-negative microorganisms such as Acinetobacter baumannii (2, 13, 16). They were initially characterized by their high rates of hydrolysis of cloxacillin and oxacillin, although most of them did not significantly affect the extended-spectrum cephalosporins and carbapenems (12). Currently, over 125 OXA-type β-lactamases have been identified. Among them, single point mutations of OXA-2 and OXA-10 (also called PSE-2) provide extended-spectrum β-lactamase (ESBL) characteristics to these new derivatives, affecting ceftazidime (CAZ), aztreonam (ATM), cefotaxime, and ceftriaxone at different levels depending on the amino acid changes. They were first detected in Turkey and currently include several representatives: OXA-15 and -32 (deriving from OXA-2) and OXA-11, -14, -16, -17, -19, -28, and -35 (OXA-10 derivatives) (13). Their codification in plasmids and/or transposons may facilitate their horizontal diffusion, although many of them have been proved only to have a chromosomal location (12, 21).

In June 2008, a P. aeruginosa strain (PAjun08), displaying an unusual resistance phenotype, was isolated from a wound infection of a patient admitted to the Hospital Son Dureta pediatric ICU. One month later, a second P. aeruginosa isolate (PAjul08) with the same resistance phenotype was recovered from a lung biopsy specimen from a different patient admitted to the same ICU. MICs of piperacillin (PIP), PIP-tazobactam (PIP-TZ), CAZ, cefepime (FEP), ATM, imipenem (IMP), meropenem (MER), gentamicin (GEN), tobramycin (TOB), amikacin (AMK), ciprofloxacin, and colistin were determined by the Etest method (AB Biodisk, Solna, Sweden). Additionally, MICs of carbenicillin, CAZ, and CAZ plus 4 μg/ml clavulanate (CAZ-CLV) were determined by standard CLSI broth microdilution (3).

Both isolates were found to be resistant to all the tested aminoglycosides, CAZ, and IMP. They also showed reduced susceptibility to PIP, FEP, ATM, and MER but full susceptibility to PIP-TZ (Table (Table1).1). Furthermore, the double-disk synergy test using amoxicillin-CLV and CAZ disks (5-mm separation) yielded a slight synergy, suggesting the presence of an ESBL. Moreover, a slight synergy was also observed in a broth microdilution assay with CAZ-CLV (Table (Table1).1). To characterize the potential ESBL produced by the two P. aeruginosa isolates, PCRs using primers for the most common ESBL groups (OXA, PER, CTX-M, SHV, and TEM) were performed (4, 8). PCR using OXA-2 group primers provided positive results. Then, to amplify and sequence the complete blaOXA gene, the external primers OXA-2-EXT-F (5′-ATGGCAATCCGAATCTTCGC-3′) and OXA-2-EXT-R (5′-TTATCGCGCAGCGTCCGAG-3′) were used. The obtained band was purified and sequenced using a BigDye Terminator kit (PE Applied Biosystems, Foster City, CA), and sequences were analyzed on an ABI Prism 3100 DNA sequencer (PE Applied Biosystems). In all cases, sequencing of two independent PCR products was performed to ensure the absence of errors occurring during amplification. The resulting sequences were then compared with those available at GenBank (www.ncbi.nih.gov/BLAST), revealing the presence of a not previously described polymorphism of OXA-2: Asn148Asp (amino acid numbering corresponding to the full-length precursor protein).The novel OXA-type variant was named OXA-161.

TABLE 1.
MICs for P. aeruginosa isolates and their transformantsa

To find the epidemiological relatedness between the two OXA-161-producing isolates, pulsed-field gel electrophoresis was performed using conventional protocols (9). Analysis of the results (following the criteria defined by Tenover et al. [19]) revealed that the two isolates belonged to the same clone. This finding was certainly not unexpected, given that overlapping of ICU admission periods was documented.

The possible location of blaOXA-161 in a transferable plasmid was evaluated through transformation experiments. For this purpose, plasmid DNA (UltraClean plasmid prep kit; MO BIO, Carlsbad, CA) was introduced by electroporation into PAO1 as previously described (18). Transformants were selected in LB agar plates containing 20 μg/ml of CAZ. Transformants were checked by a double-disk synergy test and PCR. MICs of the obtained transformants are shown in Table Table1.1. As can be observed, the resistance profile of the β-lactams (except carbapenems) and aminoglycosides could be horizontally transferred to PAO1, proving the location of aminoglycoside resistance determinants in the same plasmid as blaOXA-161. Since carbapenem resistance was not transferred along with the blaOXA-161 plasmid, additional mechanisms, most likely classical OprD inactivation, should be responsible for IMP resistance in the clinical strains. The integron potentially harboring the aminoglycoside-modifying-enzyme genes and blaOXA-161 was characterized by PCR followed by DNA sequencing using previously described specific primers to amplify intI1, qacEΔ1 (8), and the DNA regions located between intI1 or qacEΔ1 and blaOXA-161. Reverse versions of cited primers OXA-2-EXT-F and OXA-2-EXT-R were used for this last purpose. The results showed the presence of blaOXA-161 in a class 1 integron. No gene was detected between intI1 and blaOXA-161, but downstream, a 6′-N-aminoglycoside acetyltransferase gene (aacA4) was found. This Aac(6′)-Ib enzyme was identical to the one described by Galimand et al. (7) (GenBank number S67948), conferring resistance to AMK and TOB. Therefore, cotransferred resistance to GEN in PAO1 transformants might result from the presence of additional aminoglycoside-modifying enzymes in the plasmid.

To investigate the precise resistance profile conferred by OXA-161 in comparison with its ancestor oxacillinase, OXA-2, both genes were amplified and cloned into the pUCP24 vector. Primers OXAF-SmaI (TCCCCGGGATGGCAATCCGAATCTTCGC) and OXAR-BamHI (TCGGATCCTTATCGCGCAGCGTCCGAG) (the restriction targets are underlined) were used for cloning. The obtained products were checked by sequencing, and the resulting plasmids (pUCPOXA-2 and pUCPOXA-161) were transformed to Escherichia coli XL1-Blue as previously described (17). After the plasmids were extracted, they were electroporated into P. aeruginosa reference strain PAO1, and MICs of the antibiotics listed above were determined by Etest (Table (Table1).1). As can be observed, the resistance profile confirmed the predicted OXA-161 spectrum: high-level CAZ resistance and reduced susceptibility to PIP, FEP, and ATM. Two other OXA-2 ESBL derivatives, OXA-15 and OXA-32, have been previously described (5, 14). In both cases, the authors attributed the amplification of the hydrolytic spectrum (mainly directed to a greater cephalosporinase activity) to changes in conserved regions of the oxacillinase sequence. In this sense, OXA-161 has a Asn148Asp change, which affects the YGN conserved motif of class D β-lactamases, that is very close to a proposed β turn or loop (position 150, which in OXA-15 has a Asp150Gly substitution) involved in the hydrolysis of β-lactams (5). On the other hand, OXA-32 has a Leu-to-Ile change in the class D oxacillinase fourth conserved region (14). Moreover, as occurs with OXA-15 and OXA-32, the most affected cephalosporin by the novel OXA-161 is CAZ (conferring high-level resistance).

The presence of potent β-lactamases, such as metallo-β-lactamases or ESBLs, in plasmid-located integrons (harboring additional resistance determinants such as aminoglycoside-modifying enzymes) in P. aeruginosa is a growing threat with major clinical and epidemiological consequences. Although several outbreaks have been described worldwide (6, 15, 20), their overall prevalence seems to be still limited. For instance, this is the first report of OXA ESBLs in Spain. Nevertheless, it should be noted that the actual prevalence of ESBLs in P. aeruginosa is probably underestimated, since their detection in this species is made more difficult by the frequent chromosomal β-lactam resistance mechanisms such as the overexpression of AmpC and/or one of the several efflux pumps encoded in its genome. Therefore, active surveillance studies are urgently needed in order to determine the actual prevalence of these relevant resistance mechanisms and to establish directed measures for controlling their spread.

Nucleotide sequence accession numbers.

The GenBank accession numbers for this study are as follows: blaOXA-161, FJ617206; class 1 integron harboring blaOXA-161, GQ202693.

Acknowledgments

This work was supported by the Ministerio de Ciencia e Innovación, Instituto de Salud Carlos III, through the Spanish Network for the Research in Infectious Diseases (REIPI C03/14 and RD06/0008) and by the Govern de les Illes Balears (PROGECIB-9A).

Footnotes

[down-pointing small open triangle]Published ahead of print on 21 September 2009.

REFERENCES

1. Aloush, V., S. Navon-Venezia, Y. Seigman-Igra, S. Cabili, and Y. Carmeli. 2006. Multidrug-resistant Pseudomonas aeruginosa: risk factors and clinical impact. Antimicrob. Agents Chemother. 50:43-48. [PMC free article] [PubMed]
2. Brown, S., and S. Amyes. 2006. OXA β-lactamases in Acinetobacter: the story so far. J. Antimicrob. Chemother. 57:1-3. [PubMed]
3. Clinical and Laboratory Standards Institute. 2008. Performance standards for antimicrobial susceptibility testing, vol. 28, no. 3, 18th informational supplement. M100-S18. Clinical and Laboratory Standards Institute, Wayne, PA.
4. Coque, T. M., A. Oliver, J. C. Perez-Diaz, F. Baquero, and R. Canton. 2002. Genes encoding TEM-4, SHV-2, and CTX-M-10 extended-spectrum beta-lactamases are carried by multiple Klebsiella pneumoniae clones in a single hospital (Madrid, 1989 to 2000). Antimicrob. Agents Chemother. 46:500-510. [PMC free article] [PubMed]
5. Danel, F., L. M. Hall, D. Gur, and D. M. Livermore. 1997. OXA-15, an extended-spectrum variant of OXA-2 beta-lactamase, isolated from a Pseudomonas aeruginosa strain. Antimicrob. Agents Chemother. 41:785-790. [PMC free article] [PubMed]
6. Empel, J., K. A. Filczak, A. Mrowka, W. Hryniewicz, D. M. Livermore, and M. Gniadkowski. 2007. Outbreak of Pseudomonas aeruginosa infections with PER-1 extended-spectrum β-lactamase in Warsaw, Poland: further evidence for an international clonal complex. J. Clin. Microbiol. 45:2829-2834. [PMC free article] [PubMed]
7. Galimand, M., T. Lambert, G. Gerbaud, and P. Courvalin. 1993. Characterization of the aac(6′)-Ib gene encoding an aminoglycoside 6′-N-acetyltransferase in Pseudomonas aeruginosa BM2656. Antimicrob. Agents Chemother. 37:1456-1462. [PMC free article] [PubMed]
8. Gutiérrez, O., C. Juan, E. Cercenado, F. Navarro, E. Bouza, P. Coll, J. L. Pérez, and A. Oliver. 2007. Molecular epidemiology and mechanisms of carbapenem resistance in Pseudomonas aeruginosa isolates from Spanish hospitals. Antimicrob. Agents Chemother. 51:4329-4335. [PMC free article] [PubMed]
9. Kaufmann, M. E. 1998. Pulsed field gel electrophoresis. Methods Mol. Med. 15:33-50. [PubMed]
10. Livermore, D. M. 2002. Multiple mechanisms of antimicrobial resistance in Pseudomonas aeruginosa: our worst nightmare? Clin. Infect. Dis. 34:634-640. [PubMed]
11. Lyczak, J. B., C. L. Cannon, and G. B. Pier. 2002. Lung infections associated with cystic fibrosis. Clin. Microbiol. Rev. 15:194-222. [PMC free article] [PubMed]
12. Naas, T., and P. Nordmann. 1999. OXA-type beta-lactamases. Curr. Pharm. Des. 5:865-879. [PubMed]
13. Paterson, D. L., and R. A. Bonomo. 2005. Extended-spectrum beta-lactamases: a clinical update. Clin. Microbiol. Rev. 18:657-686. [PMC free article] [PubMed]
14. Poirel, L., P. Gerome, C. De Champs, J. Stephanazzi, T. Naas, and P. Nordmann. 2002. Integron-located oxa-32 gene cassette encoding an extended-spectrum variant of OXA-2 β-lactamase from Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 46:566-569. [PMC free article] [PubMed]
15. Pournaras, S., M. Maniati, E. Petinaki, L. S. Tzouvelekis, A. Tsakris, N. J. Legakis, and A. N. Maniatis. 2003. Hospital outbreak of multiple clones of Pseudomonas aeruginosa carrying the unrelated metallo-β-lactamase gene variants blaVIM-2 and blaVIM-4. J. Antimicrob. Chemother. 51:1409-1414. [PubMed]
16. Pournaras, S., A. Markogiannakis, A. Ikonomidis, L. Kondyli, K. Bethimouti, A. N. Maniatis, N. J. Legakis, and A. Tsakris. 2006. Outbreak of multiple clones of imipenem-resistant Acinetobacter baumannii isolates expressing OXA-58 carbapenemase in an intensive care unit. J. Antimicrob. Chemother. 57:557-561. [PubMed]
17. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
18. Smith, A. W., and B. H. Iglewski. 1989. Transformation of Pseudomonas aeruginosa by electroporation. Nucleic Acids Res. 17:10509. [PMC free article] [PubMed]
19. Tenover, F. C., R. D. Arbeit, R. V. Goering, P. A. Mickelsen, B. E. Murray, D. H. Persing, and B. Swaminathan. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33:2233-2239. [PMC free article] [PubMed]
20. Walsh, T. R., M. A. Toleman, L. Poirel, and P. Nordmann. 2005. Metallo-β-lactamases: the quiet before the storm? Clin. Microbiol. Rev. 18:306-325. [PMC free article] [PubMed]
21. Walther-Rasmussen, J., and N. Høiby. 2006. OXA-type carbapenemases. J. Antimicrob. Chemother. 57:373-383. [PubMed]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)