PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Toxicol Appl Pharmacol. Author manuscript; available in PMC 2010 December 15.
Published in final edited form as:
PMCID: PMC2784148
NIHMSID: NIHMS144069

Acetylated H4K16 by MYST1 Protects UROtsa Cells from the Carcinogen Arsenic and is Decreased Following Chronic Arsenic Exposure

Abstract

Arsenic, a human carcinogen that is associated with an increased risk of bladder cancer, is commonly found in drinking water. An important mechanism by which arsenic is thought to be carcinogenic is through the induction of epigenetic changes that lead to aberrant gene expression. Previously, we reported that the SAS2 gene is required for optimal growth of yeast in the presence of arsenite (AsIII). Yeast Sas2p is orthologous to human MYST1, a histone 4 lysine 16 (H4K16) acetyltransferase. Here, we show that H4K16 acetylation is necessary for the resistance of yeast to AsIII through the modulation of chromatin. The role of MYST1 and H4K16 acetylation in arsenic toxicity and carcinogenesis was further explored in human bladder epithelial cells. The expression of MYST1 was knocked down in UROtsa cells, a model of bladder epithelium that has been used to study arsenic-induced carcinogenesis. Silencing of MYST1 reduced acetylation of H4K16, and induced sensitivity to AsIII and to its more toxic metabolite monomethylarsonous acid (MMAIII) at doses relevant to high environmental human exposures. In addition, both AsIII and MMAIII treatments decreased global H4K16 acetylation levels in a dose- and time-dependent manner. This indicates that acetylated H4K16 is required for resistance to arsenic and that a reduction in its levels as a consequence of arsenic exposure may contribute to toxicity in UROtsa cells. Based on these findings, we propose a novel role for the MYST1 gene in human sensitivity to arsenic.

Keywords: Arsenic, H4K16, histone acetylation, epigenetics, bladder cancer, yeast

Introduction

Bladder cancer is the most common urologic malignancy and the leading cause of cancer death in patients with urinary tract malignancies (Jemal et al., 2007). Chronic exposure to arsenic through drinking water is strongly linked to increased incidence and mortality of bladder cancer (Smith et al., 1998; Chu and Crawford-Brown, 2007; Marshall et al., 2007). For example, during 1958–1970, people who lived in region II of Chile were exposed to high concentrations of arsenic in water, and excess deaths from lung and bladder cancers predominated ten years after reduction of exposures (Marshall et al., 2007; Yuan et al., 2007).

Both DNA hypermethylation and altered histone acetylation have been observed in tumors from patients with bladder cancer (Chen et al., 2007; Brait et al., 2008), suggesting that aberrant epigenetic changes are associated with the development of this disease. There is increasing evidence indicating that epigenetic dysregulation plays an important role in the development of bladder cancer induced by arsenic (Marsit et al., 2006; Chai et al., 2007). Global DNA hypomethylation and focal DNA hypermethylation are both implicated in arsenic-induced malignant transformation in vivo and in vitro (Chen et al., 2001; Benbrahim-Tallaa et al., 2005; Chanda et al., 2006). Further, chronic exposure to arsenic alters DNA methylation and induces aberrant gene expression (Zhao et al., 1997; Xie et al., 2007). Moreover, arsenic induces aberrant acetylation of histone 3 (H3) at the loci of the proto oncogenes c-jun and c-fos, which in turn correlates with up regulation of these genes (Li et al., 2003), and increases global acetylation of H3 at lysine 9 through inhibition of histone deacetylases (Ramirez et al., 2007). Therefore, arsenic also impairs the normal regulation of histone modifications, which may result in gene expression changes.

In a genome-wide, parallel phenotypic screen of yeast deletion mutants, we identified several genes associated with epigenetic changes as essential for optimal growth in the presence of arsenicals (Jo et al., 2009). These results suggest that epigenetic regulation is required in response to arsenic. One of the identified genes, SAS2, is required for the resistance of yeast to arsenite (AsIII). This gene encodes the catalytic subunit of the heterotrimeric something about silencing (SAS) complex, which is responsible for the acetylation of histone 4 at lysine 16 (H4K16) (Shia et al., 2005). The SAS complex (Sas2p-Sas4p-Sas5p) is involved in transcriptional activation and silencing, chromatin-mediated boundary formation (Kimura et al., 2002; Suka et al., 2002; Shia et al., 2006a; Shogren-Knaak et al., 2006), and may play a role in DNA damage repair and maintenance of nuclear integrity (Lafon et al., 2007). The human ortholog of the yeast Sas2p, MYST1, is a histone acetyltransferase responsible for the acetylation of H4K16. Loss of MYST1 decreases levels of acetylated H4K16 and the efficiency of double-strand break repair after induction of DNA damage with ionizing radiation (Taipale et al., 2005; Gupta et al., 2008). Loss of MYST1 also leads to G2/M cell cycle arrest, nuclear morphological defects, spontaneous chromosomal aberrations, and reduced transcription of certain genes [reviewed in (Gupta et al., 2008)]. In addition, hypoacetylation of H4K16 is commonly found in human tumors and cell lines, and loss of acetylation at histone 4 (H4) appears to occur during malignant transformation (Fraga et al., 2005). Thus, current evidence suggests a connection between MYST1, H4K16 acetylation status and human cancer (Lafon et al., 2007; Rea et al., 2007).

In the current study, UROtsa cells were used to explore the potential role of H4K16 acetylation by MYST1 in the response to AsIII and its primary metabolite, monomethylarsonous acid (MMAIII). Both arsenic forms are detected in urine and in exfoliated bladder epithelial cells collected from people exposed to arsenic (Hernandez-Zavala et al., 2008). Because individuals who excrete a higher proportion of ingested arsenic as methylated forms are at higher risk of bladder cancer (Steinmaus et al., 2006), it was considered of particular importance to evaluate the effects of MMAIII. The UROtsa cell line, originally isolated from a primary culture of normal human uroepithelium, has previously been used as a model for bladder epithelium and arsenic-induced bladder cancer (Sens et al., 2004; Bredfeldt et al., 2006; Eblin et al., 2008). AsIII and MMAIII have previously been shown to induce malignant transformations in this model, partially through alterations in DNA methylation and histone acetylation (Jensen et al., 2008; Jensen et al., 2009). The acetylation of H4K16 by SAS2 and its modulation of arsenic toxicity were also studied in yeast in the current study. The results presented here show that acetylated H4K16, the status of which is determined by MYST1 probably in conjunction with other determinants in humans, is necessary for protection against arsenicals and suggest that reduction in the levels of acetylated H4K16 in bladder epithelial cells could increase the risk of arsenic carcinogenesis.

Methods

Cultures of yeast strains and human UROtsa cells

Yeast strains were from the BY4743 (Invitrogen, Carlsbad, CA), and RMY200 and JTY102TU (generous gift from Prof. Michael Grunstein, University of California, Los Angeles) backgrounds. Growth was conducted in rich media (yeast extract-peptone-dextrose, YPD) at 30 °C with shaking at 200 rpm. UROtsa cells (generously provided by Prof. Petia Simeonova, National Institute for Occupational Safety and Health, Centers for Disease Control and Prevention) were cultured at a starting cell density of 4–5 × 104 cells/ml in RPMI 1640 (Mediatech, Inc, Manassas, VA) with L-glutamine, 10% fetal bovine serum, 100 IU/ml penicillin, and 100 μg/ml streptomycin (Omega Scientific, San Diego, CA), under standard culturing conditions.

Arsenical exposures

Sodium arsenite (NaAsO2, AsIII) was purchased from Sigma Aldrich (St. Louis, MO). Monomethylarsine oxide (MMAIIIO, MMAIII) was a generous gift of Prof. Miroslav Styblo (University of North Carolina, Chapel Hill). MMAIIIO hydrolyzes to MMAIII in solution (Petrick et al., 2001). Stock solutions were prepared in sterile Milli-Q water, protected from light and stored at −80 °C until use. Yeast cells were treated with concentrations ranging from 0 – 300 μM of either AsIII or MMAIII. UROtsa cells were treated, once they reached 80–90% confluence in culture, with AsIII at 1, 3, and 10 μM or with MMAIII at 0.3, 1 and 3 μM.

Yeast growth assay

Yeast strains were pre-grown in YPD media to mid-log phase, diluted in fresh media to an optical density at 595 nm (OD595) of 0.0165, and inoculated into a 48-well microplate. Stock solutions of arsenicals were added to the desired final concentrations with at least three replicate wells per dose. Plates were incubated in a Tecan GENios spectrophotometer set to 30 °C, intermittent shaking and OD595 measurements at 15-minute intervals for a period of 24 h. Raw absorbance data were averaged for all replicates, background corrected and plotted as a function of time. The area under the curve (AUC) was calculated for the cultures in each well using Prism version 5.01 (GraphPad Software, Inc., La Jolla, CA), the treatments averaged and expressed as a percentage of the control.

Retrovirus-mediated MYST1 gene knockdown

The MYST1 RNAi design and sequences have been reported before (Taipale et al., 2005). With the modifications, the top strand cDNA sequence of the MYST1 shRNA construct (sh-MYST1) was 5′-GATCCGAGACCATAAGATTTACTGTTTCAAGAGAACAGTAAATCTTATGGTCTTTTT TACGCGTG-3′, and the bottom strand was 5′-AATTCACGCGTAAAAAAGACCATAAGATTTACTGTTCTCTTGAAACAGTAAATCTTA TGGTCTCG-3′. The non-silencing shRNA control was modified from the non-target shRNA control (Sigma-Aldrich), and the control sequence used for the shRNA (sh-NSC) was 5′-GATCCGCAACAAGATGAAGAGCACCAATTCAAGAGATTGGTGCTCTTCATCTTGTTG CTTTTTTACGCGTG-3′ for top strand, and 5′-AATTCACGCGTAAAAAAGCAACAAGATGAAGAGCACCAATCTCTTGAA TTGGTGCTCTTCATCTTGTTGCG-3′ for bottom strand. These oligonucleotide pairs containing BamHI and EcoRI overhangs were annealed and ligated to a linearized RNAi-Ready pSIREN-RetroQ-ZsGreen vector digested with BamHI and EcoRI (BD Biosciences Clontech). The RNAi-Ready pSIREN-RetroQ-ZsGreen vector is a self-inactivating retroviral expression vector designed to express a small hairpin RNA using the human U6 promoter. The resultant constructs were amplified, purified, and sequenced. The UROtsa cells were transfected with Lipofectamine 2000 reagent following the manufacture’s instruction (Invitrogen). After incubation at 37 °C for 8 h, the supernatant fraction containing the retroviral vector was removed and replaced with normal growth medium. Cells grown for 48–72 h were assessed by fluorescence microscopy. The ZsGreen fluorescent marker yields a bright green fluorescence, permitting direct monitoring of the delivery efficiency. Finally, the cell populations were sorted by the DAKO-Cytomation MoFlo High Speed Sorter (Dako North America, Carpinteria, CA), and the green fluorescent cells were purified and collected for continuing culture. The green fluorescent cells were used for additional experimentation.

Cytotoxicity assay (MTT assay)

The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay was performed to assess the effect of MYST1 silencing on cell viability after arsenic treatment. Cells were cultured in 96-well plates in a volume of 100 μl of media per well at a density of 5 × 104 cells per ml. Twenty four hours after incubation with AsIII or MMAIII (3 replicates/arsenical concentration), 10 μl of sterile MTT dye (Sigma Aldrich; 5 mg/ml) was added to each well and plates were incubated at 37 °C for 4 h. Then, the culture medium was removed and 200 μl of DMSO was added and thoroughly mixed in for 10 min. Spectrometric absorbance at 570 nm was measured in a microplate reader.

Human tissue array and real time-quantitative PCR assay

TaqMan-based real time-quantitative polymerase chain reaction (rt-qPCR) was performed to quantify MYST1 expression in human normal tissues in the Human Rapid-Scan Plate (OriGene Technologies, Inc., Rockville, MD). The primers and probe used for amplification of MYST1 and β-actin control were ordered from Applied Biosystems (Foster City, CA). For quantification of transcripts, relative gene expression was calculated using the ΔΔCT method.

Mass-spectrometry analysis of H4K16 acetylation

Human UROtsa cells were grown in SILAC RPMI 1640 medium containing L-lysine HCl (light) or L-lysine 2HCl (U-13C6, 98%; U-15N2, 98%, heavy) (Cambridge Isotope Laboratories Inc., Andover, MA), supplemented with 10% dialyzed fetal bovine serum (FBS) and antibiotics. Cells were cultured for five passages to ensure complete labeling of proteins before being exposed to AsIII or MMAIII for 24 hours or 7 days. Treatment and control cultures were mixed in a 1:1 ratio, and the corehistone proteins were extracted and purified as described before (Shechter et al., 2007), separated by 4–20% SDS-PAGE and visualized with Coomassie staining. In-gel digestions on histone bands were performed utilizing the procedure described at http://ms-facility.ucsf.edu/ingel.html.

Mass spectrometric analysis was carried out as described previously (Chu et al., 2006). Briefly, the tryptic digest of core H4 was separated by a 75-μm × 15-cm reverse-phase capillary column at a flow rate of 330 nl/min. The HPLC eluent was connected directly to the micro-ion electrospray source of a QSTAR XL mass spectrometer (Applied Biosystems/MDS Sciex, Foster City, CA). LC-MS data were acquired in an information-dependent acquisition mode, cycling between 1-s MS acquisition followed by 3-s low energy CID data acquisition. The centroided peak lists of the CID spectra were searched against the National Center for Biotechnology Information (NCBI) protein database using Batch-Tag (Chalkley et al., 2005). Protein N-terminus and lysine acetylation; lysine mono-, di-, and trimethylation; arginine mono- and dimethylation; phosphorylation; and lysine ubiquitination were considered as variable modifications. Quantitative calculation of identified peptides was carried out by the UCSF Search Compare program in ProteinProspector package, which performs peak list generation, SILAC- and extracted ion current-based quantitation, expectation value calculation, statistic analysis of identified peptide, data filtration and presentation. SILAC ratio of each peptide was normalized against the average SILAC ratio of all identified peptides in each histone protein.

Immunoblot analysis

Total cell lysates were prepared from 5 × 106 cells using 300 μl of radioimmunoprecipitation assay lysis buffer. Nuclear extractions were collected from 1 × 107 cells using a nuclear extraction kit (Millipore, Billerica, MA) according to manufacturer’s protocol. Protein concentrations in cell lysates and nuclear extracts were determined by the DC assay (Bio-Rad Laboratories, Inc., Hercules, CA). Equal protein amounts were resolved by SDS-PAGE, transferred onto nitrocellulose membranes, and immunoblotted for MYST1 (Novus Biologicals, Littleton, CO) and β-actin (Sigma-Aldrich) or acetyl-H4, acetyl-H4K16 and H4 pan (Millipore). Proteins were visualized using the enhanced chemiluminescence method (Amersham Biosciences, United Kingdom) as per manufacturer’s protocol. Film was exposed and developed using a Konica SRX-101 developer (Konica Minolta Medical Imaging USA, Wayne, NJ). Images were quantified using the ImageJ software (NIH, Bethesda, MD). Each measured protein was normalized to either of the loading controls β-actin or H4 pan.

Data analysis

Statistical analyses were performed using one-way analysis of variance followed by a post-hoc test if the group means were significantly different. Levels of significance were denoted in graphs as *, p value< 0.05; **, p value< 0.01 and ***, p value< 0.001.

Results

mRNA expression of MYST1 in human tissues

MYST1 is a recently characterized gene, and a search of the expressed sequence tag (EST) database revealed sequences matching the cDNA of MYST1 in many human tissues with varied expression levels. To experimentally measure and compare the mRNA expression of MYST1 across tissues, real-time quantitative PCR analysis was performed in cDNA from a panel of 48 human tissues contained in a tissue array (Fig. 1). Using the liver as reference, it was found that MYST1 is highly expressed in tissues such as the pituitary gland and placenta, moderately expressed in others including the stomach, prostate, kidney, lung, skin and urinary bladder; and weakly expressed in the mammary gland, colon and heart. The presence of detectable levels of MYST1 mRNA in several normal human tissues indicates a role for this gene in regular cellular metabolism and supports studying its relation to arsenic sensitivity in humans. Long-term exposure to AsIII has been associated with cancers in the lung, urinary bladder, and skin (Tchounwou et al., 2003), and interestingly, correlates with the lower MYST1 expression levels observed in these tissues.

Figure 1
Comparison of MYST1 gene expression in human tissues. Expression of MYST1 was quantified by rt-qPCR in cDNA from a panel of 48 normal human tissues. Transcript levels of MYST1 were determined using primers designed to amplify a defined region of the gene. ...

Deletion of yeast SAS2 and silencing of human MYST1 induces arsenic sensitivity

The growth phenotype of the SAS-deletion mutants was evaluated in the presence of either AsIII or MMAIII (Fig. 2). Deletion strains and their isogenic counterpart BY4743 wild type were treated with equitoxic doses equivalent to the IC20 and 2*IC20, which were 300 and 600 μM for AsIII, and 150 and 300 μM for MMAIII, respectively. In these treatments, sas2Δ, sas4Δ and sas5Δ exhibited decreased growth in AsIII relative to wild type, but not in MMAIII. These results showed a specific requirement of the SAS genes for optimal growth in AsIII, despite the higher toxicity of MMAIII.

Figure 2
Deletion of the SAS genes in yeast results in sensitivity to arsenite. The strains sas2Δ, sas4Δ, sas5Δ and their isogenic counterpart BY4743 wild type were treated with equitoxic doses equivalent to the IC20 and 2*IC20, which were ...

To investigate the role of MYST1 in arsenic toxicity in mammals, the expression of MYST1 was knocked down in UROtsa cells by approximately 75% compared to controls (Fig. 3A). Transfected UROtsa cells did not have an altered doubling time or appearance in culture. The UROtsa sh-MYST1 (MYST1 knockdown) and UROtsa sh-NSC cells (vector control) were then treated with either AsIII or MMAIII at several concentrations equivalent or below the IC50 for 24 h. The dose ranges used included doses equivalent to high environmental exposures encountered by humans. Arsenical treatments induced a dose-dependent decrease in viability in both cell lines. In the absence of arsenic treatment, there was no effect of MYST1 knockdown on cell viability, relative to vector control. Unlike deletion of the SAS genes in yeast, silencing of MYST1 led to increased sensitivity to both AsIII and MMAIII (Fig. 3B). MMAIII was more potent than AsIII in producing toxicity; at the IC50, the viability of UROtsa sh-MYST1 cells was about 70% of the UROtsa sh-NSC cells post-AsIII exposure (10 μM), as opposed to only 60% after MMAIII treatment (3 μM).

Figure 3
Knockdown of MYST1 in human UROtsa cells induces sensitivity to arsenic A. Western blot analysis of whole cell lysates with anti-MYST1 shows a reduction of approximately 75% in MYST1 protein levels, relative to vector controls, in human UROtsa cells after ...

AsIII resistance in yeast is related to acetylation of H4K16 and its modulation of the chromatin state

The growth phenotype of a H4K16→R yeast mutant, containing a non-acetylatable arginine residue at position 16 in place of lysine (Suka et al., 2002), was evaluated to further investigate the role of H4K16 acetylation in AsIII resistance. This strain exhibited slow growth compared to the wild type and was sensitive to high doses of AsIII (Fig. 4A). In addition, the growth of this mutant was evaluated in the presence of cytotoxic concentrations of AsIII, cadmium, copper and zinc, and sodium chloride (Fig. 4B). Only treatment with AsIII significantly decreased growth relative to wild type, therefore showing that H4K16 acetylation is specifically required for resistance to AsIII.

Figure 4
Acetylation of H4K16 is required for yeast resistance to AsIII. Mutant strains and their isogenic counterpart wild type (RMY200) were grown in rich media containing different AsIII concentrations. The optical density of the cultures was measured at 595nm ...

In yeast, the histone deacetylase Sir2p antagonizes the histone acetyltransferase activity of Sas2p by removing acetyl groups from acetylated lysine residues (Landry et al., 2000). These two proteins normally establish a gradient of histone acetylation in yeast chromosomes that ranges from an hypoacetylated state in telomeric-proximal regions to an hyperacetylated state in telomeric-distal regions, associated with heterochromatin and euchromatin, respectively (Kimura et al., 2002; Suka et al., 2002). Deletion of SAS2 reduces H4K16 acetylation and induces the spreading of heterochromatin from telomeric-proximal to telomeric-distal regions, which is reversed by further deletion of SIR2 (Suka et al., 2002). In order to determine whether the alteration in heterochromatic regions influences the sensitivity of yeast to AsIII, the growth phenotypes of sas2Δ, sir2Δ and sas2Δsir2Δ were evaluated in its presence. Deletion of SAS2, as previously shown, resulted in sensitivity to AsIII. Deletion of SIR2 in the double knock-out strain was dominant over deletion of SAS2 (Figs. 4C and 4D) and was in agreement with the proposed model for Sas2p and Sir2p function (Kimura et al., 2002; Suka et al., 2002). Both sir2Δ and sir2Δsas2Δ strains were insensitive to AsIII in liquid media and resistant when grown on agar plates (Figs. 4C and 4D), indicating that H4K16 acetylation plays a role in AsIII resistance. Silencing of genes located in telomeric-proximal regions is reduced in both of these mutant strains, suggesting that H4K16 acetylation in yeast influences the response to arsenic toxicity through its modulation of chromatin state. In an open chromatin conformation induced by acetylated H4K16, cells are resistant to AsIII, whereas in a closed state induced by deacetylated H4K16, cells are more sensitive to arsenic toxicity.

Arsenic exposure and H4K16 acetylation in UROtsa cells

MYST1 is responsible for the acetylation of H4K16 in human cells (Taipale et al., 2005; Gupta et al., 2008), and silencing of this gene in UROtsa cells led to increased sensitivity to both AsIII and MMAIII (Fig. 3B). Acetylation levels of H4 and H4K16 were compared between UROtsa sh-MYST1 and UROtsa sh-NSC cells, and were slightly reduced in H4 and significantly reduced in H4K16 (Fig. 5A). The correlation between decreased H4K16 acetylation and decreased viability after AsIII and MMAIII treatments provides evidence that this epigenetic modification is required for resistance against these two arsenicals in UROtsa cells.

Figure 5
Reduction of acetylated H4K16 levels in UROtsa cells after treatment with arsenicals. A. Silencing of MYST1 leads to a significant reduction in acetylated H4K16 levels. Nuclear extracts were run on SDS-PAGE gels, transferred onto nitrocellulose membranes, ...

Next, the ability of arsenic to alter H4K16 acetylation levels was determined. UROtsa cells were cultured in medium containing either heavy or light lysine to allow quantitative comparison through mass spectrometry of the epigenetic changes on histones. The analysis showed that arsenical treatment reduced levels of H4K16 acetylation in UROtsa cells. There was a dose- and time- dependent decrease in SILAC ratio (treatment/control) for the tetra-acetylated peptide corresponding to the N-terminus of histone H4, GKacGGKacGLGKacGGAKacR, after AsIII and MMAIII treatments (Table 1). Treatment with MMAIII for 24 h resulted in only a slight decrease in SILAC ratio at 0.3 and 1 μM, but a significant decrease at 3 μM (Fig. 5B). Interestingly, the SILAC ratios were significantly reduced for both 0.3 and 1 μM after 7 days of treatment and were comparable. Similarly, in the case of AsIII, only the highest dose of 10 μM led to a significant decrease (about two-fold) in the SILAC ratio for acetylated H4K16 peptide after 24 h of treatment. Acetylation of H4K16 was significantly decreased after 1 and 3 μM AsIII treatment when the UROtsa cells were treated for 7 days.

Table 1
SILAC ratiosa of acetylated H4K16 in UROtsa cells exposed to arsenic and controls

These findings were then confirmed by immunodetection of acetylated H4K16. Compared to the untreated control, the H4K16 acetylation levels were slightly but significantly reduced in histone extracts from UROtsa cells following 7 days of treatment with either 3μM AsIII or 1 μM MMAIII (Fig. 5C). These slight changes are not surprising, given the presence of relatively low levels of total H4 in the nuclear extracts, which contained a mixture of histones. Further, acetylation may not occur at all H4K16 residues in the cell but is likely targeted to specific chromosomal locations. In addition, as acetylation of H4K16 is thought to play a role in normal epigenetic processes the relatively high basal level of H4K16 acetylation makes the detection of small differences between treatment and control challenging. There were no apparent differences in H4K16 acetylation after 24 h of exposure to AsIII or MMAIII (data not shown).

In spite of the difference in the magnitude of changes observed between mass spectrometry and immunoblot analyses, the trend of decreased H4K16 acetylation after arsenical exposure was consistent between the two. Overall, the data show that both AsIII and MMAIII decrease H4K16 acetylation in UROtsa cells.

Discussion

Millions of people worldwide are exposed to arsenic through consumption of contaminated drinking water. Although a direct correlation between exposure to this metalloid and increased cancer risk is well documented, the mechanisms involved in arsenic carcinogenesis are not fully understood. Because inorganic arsenic is metabolized to methylated trivalent species with greater genotoxic potential (Mass et al., 2001) and are all found in urine, it is not surprising that the bladder is a target of arsenic carcinogenesis.

Histone acetylation is commonly associated with transcriptionally-active euchromatin. Acetylation of specific lysine residues can decrease the affinity of histones for DNA, making the DNA more accessible to transcription factors and components of the transcriptional machinery (Shia et al., 2006b). Arsenic is known to induce alterations in histone acetylation that are associated with aberrant gene expression. Studies aiming to characterize the effects of arsenic on N-tail histone modifications and its relation to transcriptional changes have focused on the acetylation of H3 (Li et al., 2003; Ramirez et al., 2007). Moreover, the hyperacetylation of H3 at specific gene promoters in UROtsa cells transformed by chronic exposure to AsIII and MMAIII (Jensen et al., 2008) further link these changes to malignant transformation. Therefore, the induction of alterations in histone acetylation coupled with aberrant gene expression may play a role in arsenic carcinogenesis.

This study focused on the N-tail histone acetylation at a different lysine residue, H4K16. We demonstrate that H4K16 acetylation mediates arsenic resistance in human UROtsa cells. We showed this through silencing of the MYST1 gene, which encodes the histone acetylase primarily responsible for H4K16 acetyltion. Furthermore, we show that MMAIII and AsIII decrease H4K16 acetylation in a dose- and time-dependent manner, suggesting that the functions mediated by acetylated H4K16 could be impaired after chronic exposure to arsenic. Hypoacetylated H4K16 appear early and accumulate during tumor development in a mouse model of multistage skin carcinogenesis, suggesting that loss of H4K16 acetylation occurs during malignant transformation and does not arise as a consequence of it (Fraga et al., 2005). Because H4K16 is commonly hypoacetylated in human tumors, loss of H4K16 acetylation may play a role in the pathogenesis of different human cancers. In bladder epithelial cells, a reduction in H4K16 acetylation caused by chronic arsenic exposure could be detrimental and contribute to bladder carcinogenesis. As a major determinant of H4K16 acetylation status, expression of MYST1 may constitute a potential biomarker of carcinogenesis in tissues associated with As-induced cancer.

The homologous proteins primarily responsible for the acetylation of H4K16 in yeast and humans, Sas2p and MYST1, respectively, belong to the MYST (MOZ, Ybf2/Sas3, Sas2 and TIP60) family of histone acetyltransferases. Members of this family share a conserved MYST domain containing a DNA binding and a zinc finger motif. The putative role of the MYST family in human cancer has been reviewed recently (Avvakumov and Cote, 2007; Lafon et al., 2007). Knockdown of MYST1 resulted in a considerable reduction in acetylated H4K16 levels, indicating that the bulk of H4K16 acetylation is catalyzed by the MYST1 protein and confirming previous findings in other cell lines (Taipale et al., 2005). These results provide evidence that the observed sensitivity of UROtsa cells to arsenic after MYST1 knockdown is due to a decrease in acetylated H4K16.

The sensitivity to both AsIII and MMAIII is indicative of common mechanisms by which these two arsenicals are toxic to humans and common biological processes in the cellular response to them. In spite of this similarity, MMAIII was more potent than AsIII both at decreasing viability in MYST1 knockdown cells and reducing H4K16 acetylation in UROtsa cells. Compared to a previous study, UROtsa cells were more sensitive to AsIII in the work presented here, while sensitivity to MMAIII was comparable (Drobna et al., 2005). While the exact reasons are unknown, possible contributions for the observed difference in sensitivity to AsIII may be related to cell culture conditions, timing of the treatments during culture and purity of the AsIII used. Deletion of SAS2 in yeast, on the other hand, increased sensitivity only to AsIII. Yeast has different but overlapping detoxification mechanisms against MMAIII and AsIII. For example, the arsenic resistance genes ARR are exclusively involved in detoxification of inorganic arsenic. Therefore, SAS2 may be associated with an AsIII-specific protection mechanism while detoxification of the different arsenic species in humans may be mediated through a single pathway in which MYST1 plays a common role.

Acetylation of H4K16 is a reversible, post-translational histone modification in eukaryotes that is associated with changes in gene expression. Thus, the requirement of acetylated H4K16 in the resistance to arsenic could be due to its ability to promote or maintain the expression of genes involved in response to arsenic stress. In yeast chromosomes, the H4K16 acetylation state defines heterochromatic and euchromatic regions and is associated with gene transcription (Kimura et al., 2002; Suka et al., 2002). Deletion of SAS2 and mutation of lysine in H4K16 specifically induced sensitivity to arsenic and not to other chemical stressors. Interestingly, deletion of SIR2, which results in hyperacetylation of H4K16, induced resistance to AsIII and further confirmed the importance of this epigenetic change. The H4K16 acetylation of chromosomal regions in yeast is associated with euchromatin. Therefore, H4K16 acetylation mediates arsenic resistance by promoting euchromatin formation in yeast chromosomes. These results show that SAS2 is not the only determinant factor in arsenic resistance modulated by H4K16 acetylation status. Furthermore, the data suggest that any factor that can affect H4K16 acetylation has the potential to impact yeast sensitivity to arsenic.

Unlike traditional carcinogens that form metabolites covalently bound to DNA, AsIII is not a potent mutagen but may act as a cocarcinogen by enhancing the mutagenicity of certain agents such as UV radiation (Danaee et al., 2004; Rossman et al., 2004). Decreased H4K16 acetylation as a consequence of environmental exposure to arsenic could render bladder epithelial cells more susceptible to genotoxic agents, such as chemicals found in cigarette smoke. Interestingly, smokers exposed to arsenic through drinking water are at a much higher risk of bladder cancer than exposed non smokers (Steinmaus et al., 2003).

There is limited knowledge of the risk factors that predispose individuals to the adverse health effects associated with long-term exposure to arsenic. Because knock down of MYST1 reduced acetylation of H4K16 and resulted in sensitivity to arsenic, it seems reasonable to consider a novel role for the MYST1 gene in human sensitivity to arsenic in UROtsa cells. Furthermore, because MYST1 is expressed in a variety of human tissues, the effects of arsenic on acetylated H4K16 levels and of decreased MYST protein expression on arsenic sensitivity need to be investigated in other cell types. Studies to determine potential mechanisms, other than MYST1, involved in the reduction of acetylated H4K16 levels following arsenic exposure are warranted. Our results suggest that genetic and/or environmental factors that can alter normal H4K16 acetylation could influence sensitivity to arsenic in humans. Importantly, the future identification of genes whose expression levels are epigenetically regulated by acetylated H4K16 in UROtsa cells, will not only identify additional sensitivity biomarkers of arsenic exposure, but also contribute to understanding the mechanisms of arsenic toxicity and carcinogenicity in the bladder.

Acknowledgments

We thank Prof. Miroslav Styblo for the generous gift of MMAIIIO, Prof. Michael Grunstein for providing several yeast strains and Prof. Petia Simeonova for providing UROtsa cells. We thank Dr. Cliona McHale for assistance with manuscript preparation. This research was funded by the Superfund Basic Research Program NIEHS Grant P42 ES004705 to MTS, CDV and LZ. W.J. and X.R. are trainees of the SBRP at UC Berkeley.

Footnotes

Conflict of Interest Statement

The authors declare that there are no conflicts of interest

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • Avvakumov N, Cote J. The MYST family of histone acetyltransferases and their intimate links to cancer. Oncogene. 2007;26:5395–5407. [PubMed]
  • Benbrahim-Tallaa L, Waterland RA, Styblo M, Achanzar WE, Webber MM, Waalkes MP. Molecular events associated with arsenic-induced malignant transformation of human prostatic epithelial cells: aberrant genomic DNA methylation and K-ras oncogene activation. Toxicology and applied pharmacology. 2005;206:288–298. [PubMed]
  • Brait M, Begum S, Carvalho AL, Dasgupta S, Vettore AL, Czerniak B, Caballero OL, Westra WH, Sidransky D, Hoque MO. Aberrant Promoter Methylation of Multiple Genes during Pathogenesis of Bladder Cancer. Cancer Epidemiol Biomarkers Prev. 2008;17:2786–2794. [PMC free article] [PubMed]
  • Bredfeldt TG, Jagadish B, Eblin KE, Mash EA, Gandolfi AJ. Monomethylarsonous acid induces transformation of human bladder cells. Toxicology and applied pharmacology. 2006;216:69–79. [PMC free article] [PubMed]
  • Chai CY, Huang YC, Hung WC, Kang WY, Chen WT. Arsenic salts induced autophagic cell death and hypermethylation of DAPK promoter in SV-40 immortalized human uroepithelial cells. Toxicology letters. 2007;173:48–56. [PubMed]
  • Chalkley RJ, Baker PR, Huang L, Hansen KC, Allen NP, Rexach M, Burlingame AL. Comprehensive analysis of a multidimensional liquid chromatography mass spectrometry dataset acquired on a quadrupole selecting, quadrupole collision cell, time-of-flight mass spectrometer: II. New developments in Protein Prospector allow for reliable and comprehensive automatic analysis of large datasets. Mol Cell Proteomics. 2005;4:1194–1204. [PubMed]
  • Chanda S, Dasgupta UB, Guhamazumder D, Gupta M, Chaudhuri U, Lahiri S, Das S, Ghosh N, Chatterjee D. DNA hypermethylation of promoter of gene p53 and p16 in arsenic-exposed people with and without malignancy. Toxicol Sci. 2006;89:431–437. [PubMed]
  • Chen H, Liu J, Zhao CQ, Diwan BA, Merrick BA, Waalkes MP. Association of c-myc overexpression and hyperproliferation with arsenite-induced malignant transformation. Toxicology and applied pharmacology. 2001;175:260–268. [PubMed]
  • Chen WT, Hung WC, Kang WY, Huang YC, Chai CY. Urothelial carcinomas arising in arsenic-contaminated areas are associated with hypermethylation of the gene promoter of the death-associated protein kinase. Histopathology. 2007;51:785–792. [PubMed]
  • Chu F, Nusinow DA, Chalkley RJ, Plath K, Panning B, Burlingame AL. Mapping post-translational modifications of the histone variant MacroH2A1 using tandem mass spectrometry. Mol Cell Proteomics. 2006;5:194–203. [PubMed]
  • Chu HA, Crawford-Brown D. Inorganic arsenic in drinking water and bladder cancer: a meta-analysis for dose-response assessment. International journal of environmental research and public health. 2007;4:340–341. [PubMed]
  • Danaee H, Nelson HH, Liber H, Little JB, Kelsey KT. Low dose exposure to sodium arsenite synergistically interacts with UV radiation to induce mutations and alter DNA repair in human cells. Mutagenesis. 2004;19:143–148. [PubMed]
  • Drobna Z, Waters SB, Devesa V, Harmon AW, Thomas DJ, Styblo M. Metabolism and toxicity of arsenic in human urothelial cells expressing rat arsenic (+3 oxidation state)-methyltransferase. Toxicology and applied pharmacology. 2005;207:147–159. [PMC free article] [PubMed]
  • Eblin KE, Bredfeldt TG, Gandolfi AJ. Immortalized human urothelial cells as a model of arsenic-induced bladder cancer. Toxicology. 2008;248:67–76. [PubMed]
  • Fraga MF, Ballestar E, Villar-Garea A, Boix-Chornet M, Espada J, Schotta G, Bonaldi T, Haydon C, Ropero S, Petrie K, Iyer NG, Perez-Rosado A, Calvo E, Lopez JA, Cano A, Calasanz MJ, Colomer D, Piris MA, Ahn N, Imhof A, Caldas C, Jenuwein T, Esteller M. Loss of acetylation at Lys16 and trimethylation at Lys20 of histone H4 is a common hallmark of human cancer. Nature genetics. 2005;37:391–400. [PubMed]
  • Gupta A, Guerin-Peyrou TG, Sharma GG, Park C, Agarwal M, Ganju RK, Pandita S, Choi K, Sukumar S, Pandita RK, Ludwig T, Pandita TK. The mammalian ortholog of Drosophila MOF that acetylates histone H4 lysine 16 is essential for embryogenesis and oncogenesis. Molecular and cellular biology. 2008;28:397–409. [PMC free article] [PubMed]
  • Hernandez-Zavala A, Valenzuela OL, Matousek T, Drobna Z, Dedina J, Garcia-Vargas GG, Thomas DJ, Del Razo LM, Styblo M. Speciation of arsenic in exfoliated urinary bladder epithelial cells from individuals exposed to arsenic in drinking water. Environmental health perspectives. 2008;116:1656–1660. [PMC free article] [PubMed]
  • Jemal A, Siegel R, Ward E, Murray T, Xu J, Thun MJ. Cancer statistics, 2007. CA: a cancer journal for clinicians. 2007;57:43–66. [PubMed]
  • Jensen TJ, Novak P, Eblin KE, Gandolfi AJ, Futscher BW. Epigenetic remodeling during arsenical-induced malignant transformation. Carcinogenesis. 2008;29:1500–1508. [PubMed]
  • Jensen TJ, Wozniak RJ, Eblin KE, Wnek SM, Gandolfi AJ, Futscher BW. Epigenetic mediated transcriptional activation of WNT5A participates in arsenical-associated malignant transformation. Toxicology and applied pharmacology. 2009;235:39–46. [PMC free article] [PubMed]
  • Jo WJ, Loguinov A, Wintz H, Chang M, Smith AH, Kalman D, Zhang L, Smith MT, Vulpe CD. Comparative Functional Genomic Analysis Identifies Distinct and Overlapping Sets of Genes Required for Resistance to Monomethylarsonous Acid (MMAIII) and Arsenite (AsIII) in Yeast. Toxicol Sci. 2009 doi: 10.1093/toxsci/kfp1162. [PMC free article] [PubMed] [Cross Ref]
  • Kimura A, Umehara T, Horikoshi M. Chromosomal gradient of histone acetylation established by Sas2p and Sir2p functions as a shield against gene silencing. Nature genetics. 2002;32:370–377. [PubMed]
  • Lafon A, Chang CS, Scott EM, Jacobson SJ, Pillus L. MYST opportunities for growth control: yeast genes illuminate human cancer gene functions. Oncogene. 2007;26:5373–5384. [PubMed]
  • Landry J, Sutton A, Tafrov ST, Heller RC, Stebbins J, Pillus L, Sternglanz R. The silencing protein SIR2 and its homologs are NAD-dependent protein deacetylases. Proceedings of the National Academy of Sciences of the United States of America. 2000;97:5807–5811. [PubMed]
  • Li J, Gorospe M, Barnes J, Liu Y. Tumor promoter arsenite stimulates histone H3 phosphoacetylation of proto-oncogenes c-fos and c-jun chromatin in human diploid fibroblasts. The Journal of biological chemistry. 2003;278:13183–13191. [PubMed]
  • Marshall G, Ferreccio C, Yuan Y, Bates MN, Steinmaus C, Selvin S, Liaw J, Smith AH. Fifty-year study of lung and bladder cancer mortality in Chile related to arsenic in drinking water. Journal of the National Cancer Institute. 2007;99:920–928. [PubMed]
  • Marsit CJ, Karagas MR, Danaee H, Liu M, Andrew A, Schned A, Nelson HH, Kelsey KT. Carcinogen exposure and gene promoter hypermethylation in bladder cancer. Carcinogenesis. 2006;27:112–116. [PubMed]
  • Mass MJ, Tennant A, Roop BC, Cullen WR, Styblo M, Thomas DJ, Kligerman AD. Methylated trivalent arsenic species are genotoxic. Chemical research in toxicology. 2001;14:355–361. [PubMed]
  • Petrick JS, Jagadish B, Mash EA, Aposhian HV. Monomethylarsonous acid (MMA(III)) and arsenite: LD(50) in hamsters and in vitro inhibition of pyruvate dehydrogenase. Chemical research in toxicology. 2001;14:651–656. [PubMed]
  • Ramirez T, Brocher J, Stopper H, Hock R. Sodium arsenite modulates histone acetylation, histone deacetylase activity and HMGN protein dynamics in human cells. Chromosoma 2007 [PubMed]
  • Rea S, Xouri G, Akhtar A. Males absent on the first (MOF): from flies to humans. Oncogene. 2007;26:5385–5394. [PubMed]
  • Rossman TG, Uddin AN, Burns FJ. Evidence that arsenite acts as a cocarcinogen in skin cancer. Toxicology and applied pharmacology. 2004;198:394–404. [PubMed]
  • Sens DA, Park S, Gurel V, Sens MA, Garrett SH, Somji S. Inorganic cadmium- and arsenite-induced malignant transformation of human bladder urothelial cells. Toxicol Sci. 2004;79:56–63. [PubMed]
  • Shechter D, Dormann HL, Allis CD, Hake SB. Extraction, purification and analysis of histones. Nature protocols. 2007;2:1445–1457. [PubMed]
  • Shia WJ, Li B, Workman JL. SAS-mediated acetylation of histone H4 Lys 16 is required for H2A.Z incorporation at subtelomeric regions in Saccharomyces cerevisiae. Genes & development. 2006a;20:2507–2512. [PubMed]
  • Shia WJ, Osada S, Florens L, Swanson SK, Washburn MP, Workman JL. Characterization of the yeast trimeric-SAS acetyltransferase complex. The Journal of biological chemistry. 2005;280:11987–11994. [PubMed]
  • Shia WJ, Pattenden SG, Workman JL. Histone H4 lysine 16 acetylation breaks the genome’s silence. Genome biology. 2006b;7:217. [PMC free article] [PubMed]
  • Shogren-Knaak M, Ishii H, Sun JM, Pazin MJ, Davie JR, Peterson CL. Histone H4-K16 acetylation controls chromatin structure and protein interactions. Science (New York, NY) 2006;311:844–847. [PubMed]
  • Smith AH, Goycolea M, Haque R, Biggs ML. Marked increase in bladder and lung cancer mortality in a region of Northern Chile due to arsenic in drinking water. American journal of epidemiology. 1998;147:660–669. [PubMed]
  • Steinmaus C, Bates MN, Yuan Y, Kalman D, Atallah R, Rey OA, Biggs ML, Hopenhayn C, Moore LE, Hoang BK, Smith AH. Arsenic methylation and bladder cancer risk in case-control studies in Argentina and the United States. Journal of occupational and environmental medicine/American College of Occupational and Environmental Medicine. 2006;48:478–488. [PubMed]
  • Steinmaus C, Yuan Y, Bates MN, Smith AH. Case-control study of bladder cancer and drinking water arsenic in the western United States. American journal of epidemiology. 2003;158:1193–1201. [PubMed]
  • Suka N, Luo K, Grunstein M. Sir2p and Sas2p opposingly regulate acetylation of yeast histone H4 lysine16 and spreading of heterochromatin. Nature genetics. 2002;32:378–383. [PubMed]
  • Taipale M, Rea S, Richter K, Vilar A, Lichter P, Imhof A, Akhtar A. hMOF histone acetyltransferase is required for histone H4 lysine 16 acetylation in mammalian cells. Molecular and cellular biology. 2005;25:6798–6810. [PMC free article] [PubMed]
  • Tchounwou PB, Patlolla AK, Centeno JA. Carcinogenic and systemic health effects associated with arsenic exposure--a critical review. Toxicologic pathology. 2003;31:575–588. [PubMed]
  • Xie Y, Liu J, Benbrahim-Tallaa L, Ward JM, Logsdon D, Diwan BA, Waalkes MP. Aberrant DNA methylation and gene expression in livers of newborn mice transplacentally exposed to a hepatocarcinogenic dose of inorganic arsenic. Toxicology. 2007;236:7–15. [PMC free article] [PubMed]
  • Yuan Y, Marshall G, Ferreccio C, Steinmaus C, Selvin S, Liaw J, Bates MN, Smith AH. Acute myocardial infarction mortality in comparison with lung and bladder cancer mortality in arsenic-exposed region II of Chile from 1950 to 2000. American journal of epidemiology. 2007;166:1381–1391. [PubMed]
  • Zhao CQ, Young MR, Diwan BA, Coogan TP, Waalkes MP. Association of arsenic-induced malignant transformation with DNA hypomethylation and aberrant gene expression. Proceedings of the National Academy of Sciences of the United States of America. 1997;94:10907–10912. [PubMed]