PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Clin Cancer Res. Author manuscript; available in PMC 2010 November 1.
Published in final edited form as:
PMCID: PMC2783218
NIHMSID: NIHMS140300

Validation of TPX2 as a Potential Therapeutic Target in Pancreatic Cancer Cells

Abstract

Purpose

Targeting protein for Xklp2 (TPX2) has gained attention recently as a putative oncogene possibly amplified in several human malignancies including pancreatic adenocarcinoma. In this work, we sought to evaluate the copy number and expression of TPX2 in pancreatic cancer cell lines and tumor tissues and to further explore the potential of TPX2 as a therapeutic target.

Experimental Design

The DNA copy number and expression of the TPX2 gene were surveyed in pancreatic cancer cell lines and tumor tissues and compared to those of immortalized normal pancreatic ductal cells and normal pancreas tissues. The cellular effects of TPX2 knockdown using siRNA oligonucleotides in pancreatic cancer cells, such as growth in tissue culture, in soft agar, and nude mice, apoptosis and sensitivity to paclitaxel, were also investigated using various assays.

Results

Low copy number TPX2 amplification was found in pancreatic cancer cell lines and low passage pancreatic cancer tumor xenografts. TPX2 expression was upregulated in pancreatic cancer cell lines at both the mRNA and protein levels relative to the immortalized pancreatic ductal epithelial cell line HPDE6. Immunohistochemical staining of a tissue microarray showed TPX2 expression was higher in pancreatic tumors compared to their normal counterparts. Treatment with TPX2 targeting siRNAs effectively reduced pancreatic cancer cell growth in tissue culture, induced apoptosis, and inhibited growth in soft agar and in nude mice. Knockdown of TPX2 also sensitized pancreatic cancer cells to paclitaxel treatment.

Conclusions

Our results suggest that TPX2 might be an attractive target for pancreatic cancer therapy.

Keywords: TPX2, new targets, drug discovery, pancreatic cancer

Introduction

Pancreatic ductal adenocarcinoma (PDAC), with a five-year survival rate of approximately 5% for all stages combined in the U.S., is among the most lethal of human cancers. In fact, the number of people estimated to die of pancreatic cancer (34,290 for 2008 in the U.S.) nearly matches the estimated number of individuals (37,680) who will be diagnosed with it (1). Currently, surgical resection is the only therapy that is considered to offer a cure, however, pancreatic adenocarcinoma is typically diagnosed as advanced inoperable disease characterized by resistance to current therapeutics. Therefore, new treatments as well as a better understanding of pancreatic cancer biology are urgently needed.

Genomic instability is thought to drive cancer, as regions with gains often harbor oncogenes and regions with losses commonly harbor tumor suppressor genes. PDAC harbors complicated aberrations of chromosomal alleles, with numerous specific gains and losses reported (25). Chromosomal gains of 20q are found in various types of adenocarcinoma. and are also prominent in pancreatic cancer (6). Recently, TPX2 was identified as a candidate oncogene from the amplicon on 20q11.2 showing copy-number-driven overexpression in non-small-cell lung cancer and PDAC (7, 8). However, the frequency and the level of TPX2 amplification in PDAC have not been reported. Additionally, it has been reported that the region containing TPX2 is amplified in over 50% of patients afflicted with giant-cell tumor of the bone. Additionally, high levels of TPX2 mRNA and protein were detected in a high percentage of squamous cell carcinoma of the lung tumor samples, with the expression correlating to tumor grade, stage and nodal status (9, 10).

TPX2 is a microtubule-associated protein downstream of Ran-GTP that plays a central role in mitotic spindle formation and therefore proper segregation of chromosomes during cell division (11). Its expression has been associated with highly proliferative tissues. Throughout interphase TPX2 is sequestered in a cell’s nucleus by interaction with the nuclear pore proteins importin α/β, but is released at the early stages of mitosis in a RanGTP-dependent manner (12). During mitosis TPX2 is able to interact with downstream partners, which includes the Aurora A kinase resulting in the localization of Aurora A to the microtubules of the mitotic spindle (13). Furthermore, TPX2 activates the kinase activity of Aurora A by locking it in an active conformation (14). Therefore, TPX2 exerts two levels of regulation on Aurora A kinase signaling (localization and enzymatic activity). Considering the potential upregulation of TPX2 in pancreatic cancer as well as its association with a signaling pathway involving oncogenic Aurora A, we hypothesize that TPX2 is a co-conspirator in driving pancreatic tumor development. In this work, we set out to further characterize TPX2 amplification and evaluate TPX2 expression in pancreatic cancer cell lines and patient tumors. Furthermore, we analyzed the biological consequences of siRNA-mediated knockdown of TPX2 expression in cultured pancreatic cancer cells.

Materials and Methods

Cell culture

The cell line HPDE6 (an immortalized but not transformed human pancreatic epithelial cell line) was obtained from Dr. Ming-Sound Tsao (University of Toronto, Ontario, Canada) (15) and maintained in keratinocyte serum-free medium supplemented with 0.2 ng/ml epidermal growth factor and 30 µg/ml bovine pituitary extract (Invitrogen, Carlsbad, CA). Pancreatic cancer cell lines were purchased from the American Type Culture Collection (ATCC, Manassas, VA) and the European Collection of Cell Cultures (ECACC, Salisbury, UK). MUTJ cells were obtained from the University of Arizona Cancer Center, The cell lines were maintained in RPMI 1640 supplemented with 10% fetal bovine serum, penicillin (100 U/ml) and streptomycin (100 µg/ml). To preserve integrity, all cell lines were expanded and frozen down into a large number of cryogenic vials upon receipt from the sources. Cells were passaged every 3–5 days and discarded after 8–10 passages. If additional cells were needed, a new vial from the original cryogenic stock was then thawed and used. Cell lines were therefore passaged less than 6 months in culture after receipt from the original sources. All cells were grown in a humidified incubator at 37°C and 5% CO2. Cells were harvested with trypsin at 80–90% confluency. Cell counting was done using trypan blue staining on a hemacytometer.

Gene copy number analysis

Genomic DNA isolated from cell lines and low passaged pancreatic tumor xenografts was isolated using the DNeasy Tissue kit (Qiagen). Gene copy number was analyzed by quantitative PCR using an iCycler (Bio-Rad). Reactions were carried out in 20 µl reactions with 200 nM of each primer, iQ™ SYBR® Green Supermix (Bio-Rad) and 10 ng gDNA. Two-step amplification (95°C for 15 sec and 56°C for 15 sec) was repeated for 40 cycles. Following the PCR reaction, a melting curve analysis was performed to determine PCR efficiency and purity of the amplified product. Data were provided as a threshold cycle value (Ct) for each sample indicating the cycle at which a statistically significant increase in fluorescence was first detected. These data were then normalized to β-actin, which served as a reference gene. Primer sequences for TPX2 were forward 5'-AGGGGCCCTTTGAACTCTTA-3' and reverse 5'-TGCTCTAAACAAGCCCCATT-3'. Primer sequences used for β-actin were 5'-CTGGAACGGTGAAGGTGACA-3' and 5'-AAGGGACTTCCTGTAACAACGCA-3'.

Quantitative RT-PCR

Total RNA from cell pellets was isolated using the NucleoSpin® RNA II isolation kit (BD Biosciences, Palo Alta, CA). One microgram of total RNA was used for reverse transcriptase (RT) reactions (20 µl total volume), which was carried out using the iScript™ cDNA Synthesis kit (Bio-Rad, Hercules, CA). An iCycler (Bio-Rad) was used to perform real-time fluorescence detection PCR. Reactions were carried out in 20 µl reactions with 200 nM of each primer, iQ™ SYBR® Green Supermix (Bio-Rad) and 1 µl cDNA. Primer sequences for TPX2 were 5'-CGAAAGCATCCTTCATCTCC-3' and 5'-TCCTTGGGACAGGTTGAAAG-3'. Primer sequences used for β-actin were 5'-CTGGAACGGTGAAGGTGACA-3' and 5'-AAGGGACTTCCTGTAACAACGCA-3'. Relative expression was calculated using the delta-delta Ct method (16) with β-actin serving as a reference gene for normalization.

Western blot analysis

Western blots were performed as previously described (17) using 50µg of nuclear lysate per sample and NuPAGE 4–12% Bis-Tris gels (Invitrogen). Membranes were probed with a mouse monoclonal antibody (clone18D5) against TPX2 (BioLegend, San Diego, CA) at a 1:5,000 dilution or a Rabbit monoclonal antibody against alpha tubulin (Cell Signaling, Waltham, MA, 11H10, #2125) at a 1:5,000 dilution. The membrane was washed and probed with anti-mouse or anti-rabbit HRP-linked secondary antibodies (Cell Signaling) and visualized with a chemiluminescence kit (Cell Signaling, Beverly, MA) and X-ray film. The film was scanned and quantified using the ImageQuant software (GE Healthcare, Piscataway, NJ).

Tissue microarray construction and immunohistochemical analysis

Needle cores of 1.0 mm in diameter were extracted from regions of interest from de-identified pancreatic tumor tissue blocks as well as normal pancreas samples and arrayed in precise orientation in a composite paraffin block. The TMA master block was serially sectioned at 5 micron intervals and transferred onto standard charged glass by water floatation method.. The TMA slides were dipped in paraffin for uniform epitope preservation. Dewaxing and antigen retrieval were carried out with a Bond-MaX autostainer (Leica Microsystems Inc. Banncokburn, IL) using the accompanying Bond Refine Polymer Detection Kit. TPX2 antibody (Mouse Monoclonal clone 3164C6a, GenWay, San Diego, CA) was used at a dilution of 1:50, with an incubation time of 20 minutes. Staining (relative to background) received an intensity score on a 0 to 3 scale with 0 for absence of staining, 1 to indicate mild staining, 2 to indicate moderate staining, or 3 to indicate strong staining. A prevalence score was recorded based on the percent of tumor cells positive for the recorded intensity score with 1 representing <10% staining, 2 representing 10–40% staining, and 3 representing >40% staining.. If the tissue in a core had multiple intensity scores, the highest intensity and its accompanying prevalence score was chosen. The intensity and prevalence were scored by a board certified pathologist (G.H.). The overall staining scores were then computed by multiplying the intensity and prevalence scores for a composite range IHC score of 0 to 9.

siRNA treatment

TPX2_s1 (targeting AAGAATGGAACTGGAGGGCTT) and TPX2_s2 (targeting ATGAAAGTTTCTAACAACAAA of exon 6–7), the AllStars Negative Control siRNAs (Non-silencing siRNA) and the Ubiquitin B siRNA oligonucleotides were obtained through Qiagen. Cells were transiently transfected using RNAiMAX (Invitrogen) according to the manufacturer’s recommendations.

Cell proliferation assay

At 0, 24, 48, 72, and 96 hours post siRNA transfection, cells were fixed with 10% trichloroacetic acid for 1 hr at 4° C. Following fixation, cells were washed with water, then stained with a 0.04% sulforhodamine B (SRB) solution for 1 hr. Cells were then washed with a 1% acetic acid solution. The plates were sat at room temperature until dry. 50 mM Tris/HCl was then added to each well and incubated for 15 minutes. Absorbance at 570 nm was quantified using a plate reader (BioTek, Winooski, VT). Four biological replicates (each done in triplicate) were performed.

Cell cycle analysis using flow cytometry

Cells were treated with TPX2 siRNA oligonucleotides as described above for 48 hours and harvested by trypsinization. The cells were resuspended and stained with propidium iodide (Sigma) in a modified Krishan buffer (18) for one hour at 4°C. The propidium iodide stained samples were then analyzed with a FACScan flow cytometer (BD Immunocytometry systems, San Jose, CA). Histograms were analyzed for cell cycle compartments and the percentage of cells at each phase of the cell cycle was calculated using CellQuest (BD Immunocytometry systems) analysis software.

Apoptosis assay

Cells were treated with TPX2 siRNA oligonucleotides as described above and harvested by trypsinization. Cell pallets were washed once with PBS buffer. The caspase-3 activity analysis was performed by following the manufacturer’s protocol (Clontech, BD Biosciences). Briefly. cell pellets were resuspended in 100 µl of chilled Cell Lysis Buffer and incubated on ice for 10 minutes. Cell lysates were centrifuged in a microcentrifuge at 10,000g for 10 minutes at 4 °C and then the supernatants were transferred into new microcentrifuge tubes. The concentration of total protein of each sample was determined by BCA protein assay (PIERCE, Rockford, IL). Twenty-five microgram total protein of each sample was used for the analysis of caspase-3 activity.

Cell death ELISA assay

To further confirm the apoptosis induced TPX2 siRNA oligonucleotides, we performed TPX2 siRNA concentration dependent treatment of the MIA PaCa-2 cells and quantified the induction of apoptosis using a second apoptosis assay, the Cell Death ELISAPLUS Kit (Roche Applied Science, Indianapolis, IN). The experimental protocol recommended by the kit manufacturer was followed. Briefly, cells were treated with a serial dilution of TPX2 siRNA oligonucleotides for 48 hours as described above in a 96-well microplate. The microplate was then centrifuged at 200g for 10 min and the supernatant was discarded. The cells were incubated with lysis buffer for 30 min. After centrifugation at 200g for 10 min, a 20 µl aliquot of the supernatant in each well was transferred to a streptavidin-coated microplate. Eight microliters of the immunoreagents containing the biotin-conjugated anti-histone and anti-DNA antibodies were added to each well and incubated for 2 hours at room temperature. The wells were then washed for 3 times with 300 µl of incubation solution followed by the addition of 100 µl of ABTS substrate solution. After incubating for 15 min at room temperature, 100 µl of ABTS stop solution was added to each well. The photometric signal intensities of the wells were finally measured by a microplate reader (BioTek) at 405nM.

Soft-agar colony formation assay

Cells were treated with siRNA for 24 hours, trypsinized, mixed with Difco agar (final concentration 0.26%) (BD Biosciences) and RPMI medium containing 10% FBS and overlaid onto an under-layer of 0.45% Difco agar containing the same medium in a 35-mm gridded Petri dish. Cells (2,000 per Petri dish) were seeded and allowed to grow for 14 (MIA PaCa-2) or 21 (PANC-1) days before counting the number of colonies (defined as ≥50 cells).

Xenograft tumor formation in nude mice

MIA PaCa-2 cells were treated with the TPX2 targeting siRNA olionucleotides (TPX2-s1 and TPX2-s2) for 48 hours as described above and harvested by trypsinization. Ten male athymic nude mice (CrTac:NCR-Foxn1nu) (Taconic, Germantown, NY) for each treatment group were inoculated subcutaneously in the right flank with 0.1 ml of a 50% RPMI / 50% Matrigel™ (BD Biosciences, Bedford, MA) mixture containing a suspension of the siRNA or vehicle treated MIA PaCa-2 cells (1.0 × 107 cells/mouse). Starting from the day after the inoculation, tumors were measured twice weekly using calipers and tumor weights calculated using the formula: Tumor weight (mg) = (a × b2/2) where ‘b’ is the smallest diameter and ‘a’ is the largest diameter. Body weights were taken twice weekly thereafter in conjunction with tumor measurements. When the individual tumor weight of each mouse reached an approximate end-point of 2,000 mg, mice were sacrificed with regulated CO2. The mice were housed in microisolator cages (Lab Products, Seaford, DE) and maintained under specific pathogen-free conditions. All procedures were carried out under the institutional guidelines of TGen Drug Development Services Institutional Animal Care and Use Committee (Protocol #06001, Approved January 2006). All tumor growth data was collected utilizing the animal study management software, Study Director V.1.6.58 (Study Log).

Statistical analysis

The χ2 test with Yates’ correction (two-tailed) was used to analyze the difference in TPX2 IHC staining between the pancreatic tumors and the normal adjacent tissue. The Analysis of Variance (ANOVA) with Tukey’s Multiple Comparison Test was used to compare the growth curves of the different siRNA treatment groups. Other P-values indicated in the figure legends were calculated using Student’s t-tests (two-tailed). A P-value of less than 0.05 was considered statistically significant.

Results

Amplifications at the TPX2 locus in pancreatic cancer

As previously mentioned, increased copy number of TPX2 in pancreatic cancer cell lines and tumor samples by aCGH has been reported (7, 8). In order to compare and verify TPX2 amplification, we used quantitative PCR to examine TPX2 copy number in pancreatic cancer cell lines and low passage xenograft tumors derived from PDAC tissues (19). Of the 17 cell lines tested, 7 did not contain extra copies of TPX2, 7 cell lines contained one extra copy, and 3 cell lines had 2 extra copies (Table 1). This low level amplification is in agreement with what has previously been reported (7, 8). For the low passage tumor xenografts, 13 out of 20 samples exhibited at least 1 extra copy of TPX2 in our analysis (10 samples have 3 copies, 1 sample has 4 copies and 2 samples have 6 copies).

Table 1
TPX2 copy numbers in pancreatic cancer cell lines

TPX2 expression in PDAC cell lines and tumors

TPX2 mRNA levels in pancreatic cancer cell lines relative to the immortalized HPDE6 cell line were determined by realtime RT-PCR. The average of 4 independent RT-PCR measurements showed that TPX2 mRNA expression was elevated in cancer cell lines compared to HPDE6 but varied widely by cell line with an approximately 10-fold difference in expression between MIA PaCa-2 (lowest) and CFPAC-1 (highest) (Figure 1A). Protein expression was also evaluated by Western blotting for the cell lines. Data from 3 independent Western blots (from 3 separate nuclear lysate preparations) showed that TPX2 was expressed in all cell lines tested (Figure 1B). Protein levels were especially high in Hs766t and PANC1 cells. The TPX2 protein was barely detectable in the HPDE6 cell line (Figure 1B).

Figure 1Figure 1
TPX2 expression in pancreatic cancer cell lines

To evaluate protein levels of TPX2 between pancreatic tumors and normal pancreas tissue, immunostaining was performed on a pancreatic tissue microarray (Figure 1C). As described in the Materials and Methods section, for any given TMA core, a 0 to 3 score for staining intensity was multiplied by a 0 to 3 prevalence score of tumor cells staining and to obtain an overall score that ranged from 0 to 9. As summarized in Table 2, staining was observed primarily in the invasive adenocarcinoma cells and not in the normal pancreatic ductal cells. Of the 40 evaluable PDAC tissue samples, 29 (88%) stained positive (overall staining score of 2 or higher) for TPX2. In contrast, only 4 out of 31 (12%) normal samples stained positive (Table 2). Of the PDAC cases, 22 cases had adjacent normal tissue with evaluable staining. Of these, 18 exhibited negative staining for the normal counterpart. Considering just the matched cases with negative TPX2 staining for the normal tissue, 16 out of 18 (88%) tumors stained positive, similar to the overall findings when all evaluable samples were considered.

Table 2
TPX2 expression levels in pancreatic cancer tissues detected by (IHC)

siRNA-mediated knockdown of TPX2 inhibits pancreatic cancer cell proliferation

Two siRNAs effective at knocking down the expression of TPX2 were identified from 4 different siRNA sequences. Real-time quantitative PCR analysis verified gene knockdown at >95% at the mRNA level for both siRNAs up to 96 hours post-transfection (data not shown).

We determined the effects of the TPX2 siRNAs on the viability of a panel of 10 pancreatic cancer cell lines. The cell viability was determined 96 hrs after transfection by a sulforhodamine B (SRB) colorimetric assay. Cell viability was decreased in all 10 cell lines, but to varying degrees. Five of the pancreatic cancer cell lines experienced a greater than 50% decrease in cell viability. Three cell lines showed about a 50% decrease in viability and the remaining two lines showed only modest decreases (Figure S1). The Hs766T cell line was one of the most resistant lines to decreases in cell viability; however, this lack of activity is partially due to an observed general toxicity of the non-silencing siRNA on this cell line. The non-silencing siRNA alone caused a 32% decrease in Hs766T cell viability relative to the untreated control. Therefore, if the TPX2-targeting siRNAs were evaluated relative to the untreated control the results would indicate a ~45% decrease in cell viability, rather than the ~20% reported on Figure S1. In our subsequent functional studies we chose PANC-1 and MIA PaCa-2 cell lines because they both have high level of TPX2 protein but showed minimal non-specific toxicity to the non-silencing siRNA treatment. Both TPX2-targeting siRNAs gave very similar results in all ten cell lines lending support to the conclusion that the observed decreases in cell proliferation were due to the disruption of TPX2 function and not some off-target effect. To further investigate the effects of TPX2 knockdown on cell viability and more specifically on cell growth, two of the cancer cell lines (MIA PaCa-2 and PANC-1) were treated as above, but monitored daily for 96 hrs by SRB staining. This generated growth curves for the two cell lines and the effects of the TPX2 siRNAs on each cell line were consistent with the single time point assay performed previously (Figure 2A). The non-silencing siRNA had little to no toxicity on the pancreatic cancer cell lines. As a comparison, we also treated the immortalized normal pancreatic ductal cell line HPDE6 with the TPX2 siRNAs. As shown in Figure S2, the TPX2 had little effect on the growth of the cells. This result is consistent with the fact that HPDE6 does not express TPX2 protein (Figure 1B).

Figure 2Figure 2Figure 2
TPX2 targeting siRNAs influence the proliferation, cell cycle progression and apoptosis induction of pancreatic cancer cells

To better understand the effects of TPX2 inhibition on pancreatic cancer cell proliferation, we subjected siRNA-treated cells to DNA content analysis by flow cytometry to observe disruptions in cell cycle progression. TPX2 siRNA-treated MIA PaCa-2 and PANC-1 cells showed a dramatic increase in the G2-M fraction, from less than 20% in the control samples (untreated or non-targeting siRNA) to > 50% for TPX2-s1 siRNA and > 60% for TPX2-s2 siRNA in both cell lines (Figure 2B). Such increase in G2-M fraction concurs with a decrease in the G1 population in comparison to the non-targeting control siRNA-treated sample (data not shown). We also observed a significant increase in the sub-G1 peak in the DNA content histograms after 48 hrs in the cells. Consistent with the known biological functions of TPX2, TPX2 knockdown by siRNA led to the failure of pancreatic cancer cells to progress through mitosis and the appearance of the sub-G1 peak suggests that apoptosis is a potential result following TPX2 inhibition.

TPX2 knockdown induces apoptosis is pancreatic cancer cells

To further explore the potential of TPX2 inhibition to induce apoptosis we evaluated the activity of caspase-3 in siRNA-treated cells using a fluorescence-based assay. The caspase-3 activities were similar between untreated and non-targeting siRNA treated cells indicating minimal to no general toxicity from the siRNA transfections. However, there was a 7-fold increase in caspase-3 activity following 48 hrs of treatment with TPX2-s1 in both PANC-1 and MIA PaCA-2 cells (Figure 2C). Similarly, the siRNA TPX2-s2 caused an 8-fold (PANC-1) and 10-fold (MIA PaCa-2) increase in caspase-3 activity relative to the non-silencing siRNA (Figure 2C).

We also detected the apoptosis-inducing effects of TPX2 knockdown by evaluating cytoplasmic histone-DNA adducts using a cell death ELISA assay. For these experiments MIA PaCa-2 cells were treated with the TPX2-s1 siRNAs at various concentrations between 20 nM and 0.027 nM. To evaluate the knockdown of TPX2 expression, we also performed RT-PCR detection of TPX2 mRNA in the samples treated with the serial dilutions of TPX2 siRNAs. As shown in Figure 2D, apoptosis as indicated by the signal of cell death ELISA was induced in a dose-dependent manner that correlated well with percent knockdown of the TPX2 gene expression. The concentration at which 50% of the maximal apoptotic effect was reached (EC50) was 1.6 nM for TPX2-s1 and the EC50 for TPX2 knockdown was 0.30 nM for TPX2-s1.

TPX2 is required for clonogenicity in soft agar

Additionally, we investigated the consequences of TPX2 knockdown by siRNA in MIA PaCa-2 and PANC-1 cells grown in soft agar. As shown in Figure 3A, the number of colonies was significantly decreased in the cells treated with either TPX2 siRNA when compared to non-silencing siRNA-treated cells. In fact, colony formation was almost completely inhibited by TPX2 siRNA treatment, suggesting TPX2 plays important roles in self-renewal and in the clonogenicity of pancreatic cancer cells.

Figure 3Figure 3
TPX2 targeting siRNAs influence the tumorigenecity of pancreatic cancer cells

TPX2 is required for tumorigenecity of pancreatic cells in nude mice

We also examined the effect of TPX2 knockdown by siRNA on the tumorigenecity of pancreatic cancer cells in nude mice. As shown in Figure 3B, MIA PaCa-2 cells treated with either TPX2-s1 or TPX-s2 siRNA showed a dramatic reduction in the tumor growth compared to those treated with vehicle control or non-silencing siRNA (P value < 0.001). The tumor growth between the two control groups (Vehicle control and Non-silencing siRNA) and between the two siRNA treatment groups (TPX2-s1 and TPX2-s2) was not significant different (P Value > 0.05). These results indicate that TPX2 overexpression is required for aggressive tumor growth of MIA PaCa-2 cells in nude mice.

TPX2 knockdown sensitizes pancreatic cancer cells to other mitosis-targeting agents

It is known that inhibition of some mitotic regulators, such as Aurora A, sensitizes cancer cells to the treatment of taxanes (20, 21). The rationale for the combination of these agents comes from the notion that due to the action of the taxane cells will accumulate in the phase of the cell cycle (G2-M) where the mitotic regulator plays an essential role. To evaluate whether this rationale expanded to TPX2 which plays an important role in the Aurora A signaling pathway, we observed the effects of TPX2 knockdown on the cytotoxicity of paclitaxel using a similar approach to the one describing the ability of Aurora A to sensitize cells (20). We first did a TPX2 siRNA dose dependent treatment of the MIA PaCa-2 and PANC-1 cells and measured the cell growth using SRB assays. As shown in Figure 4A, the two TPX2 siRNA oligonucleotides showed a dose-dependent growth inhibition in both cell lines. We found that the highest concentration at which the TPX2-targeting siRNAs had no significant effect on growth and viability of PANC-1 and MIA PaCa-2 cells was 0.1nM. Dose dependent treatment of the two cell lines with paclitaxel found that the highest concentration at which paclitaxel does not significantly affect the growth of the cells was 10 nM (Figure S3). Using these low doses of siRNA and paclitaxel, we transfected the cells with the TPX2-targeting siRNAs followed by addition of paclitaxel 6 hrs later. Cell viability was determined using an SRB assay after 96 hrs of incubation. As expected TPX2 siRNA or paclitaxel alone had no significant effect on cell viability at these concentrations; however, when combined the TPX2 siRNA and paclitaxel reduced cell viability by approximately 50% (Figure 4B). These results are further supported by experiments generating dose response curves to paclitaxel in the presence of low dose TPX2-targeting siRNAs or a non-silencing siRNA (Figure 4). The paclitaxel dose response curves reveal a shift to the left when combined with the TPX2 siRNAs indicating that TPX2 knockdown sensitizes cells to paclitaxel treatment. Similar experiments with gemcitabine (a nucleoside analog and the standard first line therapy for pancreatic cancer) in combination with TPX2 siRNA did not show any significant synergistic effect (Figure S4).

Figure 4Figure 4Figure 4
TPX2 siRNAs sensitize pancreatic cancer cells to paclitaxel

Discussion

TPX2 is a microtubule-associated protein that is tightly cell cycle regulated. Abnormally expressed TPX2 has been reported in various malignancies. TPX2 was found to be upregulated in squamous cell carcinoma of the lung with the expression correlating to tumor grade, stage and nodal status (9). However, little work has been done to explore TPX2 protein levels in pancreatic cancer cell lines and tumor samples. In the present study, we show that TPX2 is expressed at high levels in pancreatic cancer cell lines, and that in some cases amplification of the TPX2 locus might be responsible for the increased expression. Immunohistochemical staining of a pancreatic cancer tissue microarray also shows that TPX2 is highly and extensively expressed in pancreatic tumor tissues taken directly from patients with 88% of the tumor cases expressing TPX2 compared to 12% of normal tissue found adjacent to tumor.

About 60% of the pancreatic cancer cell lines and xenograft tumors we tested had low copy number amplification of the TPX2 gene (3–6 copies). TPX2 gene localizes to chromosome 20q11. The amplification of this chromosome region has been reported previously in pancreatic cancer (6). Using CGH array and FISH, Fukushige and colleagues found that ~80% of the pancreatic cancer cell lines and primary tumors they evaluated had gains in 20q. The copy number increased in this study was also not very high (4–8 copies per cell) (6). Interestingly, these gains were observed at the same frequency in early and advanced stages, suggesting that genes in this region might play an important role in the relatively early stage of pancreatic carcinogenesis. Due to the role of TPX2 in activating the Aurora A enzymatic activity and in promoting the progression of mitotsis, the amplification of TPX2 that we observed could confer a proliferation and growth advantage to pancreatic cancer cells compared to surrounding tissue. Furthermore, since Aurora A kinase has been shown to activate the Akt pathway (22), overexpression of TPX2 may also induce cell survival in cancer cells (23). Using TPX2 targeting siRNAs we have demonstrated that inhibition of TPX2 expression resulted in cell cycle arrest and apoptosis in cancer cell lines. Recently, Morgan-Lappe and co-workers identified TPX2 as one of 3 genes that significantly reduced the survival of multiple human tumor cell lines in a siRNA library based screening using an in vitro cytotoxicity assay. It was further shown that TPX2 siRNA selectively reduced the survival of activated K-Ras-transformed cells compared with their normal isogenic counterparts (23). Given the high percentage of pancreatic tumors with activated K-ras it is possible that knockdown of TPX2 would selectively kill cancer cells.

Furthermore, combination therapies of newly developed targeted agents combined with standard chemotherapy drugs are increasingly common in the clinic. Our findings suggest that a TPX2-targeted agent could synergistically combine with anti-mitotic agents, such as the taxanes. Our results show that exposure of pancreatic cancer cells to TPX2 siRNAs plus paclitaxel results in a synergistic decrease in cell viability, presumably through a profound mitotic arrest followed by extensive cell death. It is likely that this finding can be applied to additional agents targeting mitosis as it has been reported that TPX2 (and Aurora A) amplification is associated with resistance to Eg5/KSP inhibitors (24). We postulate that targeting TPX2 in these cancers will sensitize them to Eg5/KSP inhibition.

As mentioned above TPX2 is a binding partner of Aurora A, which functions as an activator of its kinase activity. TPX2 accomplishes this by binding to an allosteric site on Aurora A and increasing its binding affinity to ATP and substrate (25). Typically, Aurora small molecule inhibitors were discovered and optimized in Aurora A kinase assays without TPX2. A recent report, shows decreased inhibitory activity of many Aurora inhibitors against Aurora A when the kinase assays are performed in the presence of TPX2, which would presumably model the activity of Aurora A in vivo (26). Therefore, TPX2 may serve as a valuable target given its direct link in the Aurora A activation pathway that has been shown to be critical in pancreatic cancer. Provided that TPX2 is amenable to small-molecule inhibitors, targeting TPX2 over Aurora A may have its advantages given that blocking TPX2 binding to and, thus, activation of Aurora A kinase provides a higher specificity that may not be achievable with conventional kinase inhibitors (23).

Statement of Translational Relevance

With a 5-year survival rate of less than 5%, pancreatic cancer is among the most lethal types of human cancers. Current therapies are mostly ineffective and new therapies are desperately needed. This manuscript describes the validation of TPX2 as a potential therapeutic target for pancreatic cancer. We present direct evidence that the TPX2 gene is amplified and overexpressed in pancreatic tumor tissues; and disruption of TPX2 function induces apoptosis and causes cell death of pancreatic cancer cells. This work is highly translational since further investigation of TPX2 as a therapeutic target and subsequent development of agents that target TPX2 may result in new and improved treatment for patients with pancreatic cancer.

Supplementary Material

1

Figure S4:

TPX2 siRNAs does not sensitize pancreatic cancer cells to gemcitabine. A) Combination treatment of TPX2 siRNA (TPX2-s) and gemcitabine in PANC-1 cells. B) Combination treatment of TPX2 siRNA (TPX2-s) and gemcitabine in MIA PaCa-2 cells.

2

Figure S1:

Effects of two TPX2 targeting siRNA oligonucleotides (TPX2-s1 and TPX2-s2) on the growth of 10 pancreatic cancer cell lines.

3

Figure S3:

Concentration dependent inhibition of pancreatic cancer cell growth by paclitaxel. Based on these curves, 10nM concentration of paclitaxel was chosen for the combination treatment with TPX2 siRNA as shown in Figure 4B.

4

Figure S2:

Effect of TPX2 siRNA treatment on the growth of HPDE6 cells. Both TPX2 targeting siRNA oligonucleotides (TPX2-s1 and TPX2-s2) showed similar growth curves to those of Non-silencing control siRNA. The siRNA oligonucleotide targeting the Ubiquitin B gene (UBB) induced dramatically growth inhibition and cell death 24 hours after transfection, indicating a high siRNA transfection efficiency.

Acknowledgements

We thank Dr. Ming-Sound Tsao (University of Toronto) for generously providing the HPDE6 cell line and Ruben Munoz for his technical assistance. This work was supported by NCI grant CA095031.

Grant support: NIH/NCI CA095031 and CA109552

References

1. Jemal A, Siegel R, Ward E, et al. Cancer statistics, 2008. CA Cancer J Clin. 2008;58:71–96. [PubMed]
2. Nowak NJ, Gaile D, Conroy JM, et al. Genome-wide aberrations in pancreatic adenocarcinoma. Cancer Genet Cytogenet. 2005;161:36–50. [PubMed]
3. Furukawa T, Kanai N, Shiwaku HO, Soga N, Uehara A, Horii A. AURKA is one of the downstream targets of MAPK1/ERK2 in pancreatic cancer. Oncogene. 2006;25:4831–4839. [PubMed]
4. Harada T, Baril P, Gangeswaran R, et al. Identification of genetic alterations in pancreatic cancer by the combined use of tissue microdissection and array-based comparative genomic hybridisation. Br J Cancer. 2007;96:373–382. [PMC free article] [PubMed]
5. Harada T, Chelala C, Bhakta V, et al. Genome-wide DNA copy number analysis in pancreatic cancer using high-density single nucleotide polymorphism arrays. Oncogene. 2007 [PMC free article] [PubMed]
6. Fukushige S, Waldman FM, Kimura M, et al. Frequent gain of copy number on the long arm of chromosome 20 in human pancreatic adenocarcinoma. Genes Chromosomes Cancer. 1997;19:161–169. [PubMed]
7. Aguirre AJ, Brennan C, Bailey G, et al. High-resolution characterization of the pancreatic adenocarcinoma genome. Proc Natl Acad Sci U S A. 2004;101:9067–9072. [PubMed]
8. Tonon G, Wong KK, Maulik G, et al. High-resolution genomic profiles of human lung cancer. Proc Natl Acad Sci U S A. 2005;102:9625–9630. [PubMed]
9. Lin DM, Ma Y, Xiao T, et al. TPX2 expression and its significance in squamous cell carcinoma of lung. Zhonghua Bing Li Xue Za Zhi. 2006;35:540–544. [PubMed]
10. Smith LT, Mayerson J, Nowak NJ, et al. 20q11.1 amplification in giant-cell tumor of bone: Array CGH, FISH, and association with outcome. Genes Chromosomes Cancer. 2006;45:957–966. [PubMed]
11. Gruss OJ, Vernos I. The mechanism of spindle assembly: functions of Ran and its target TPX2. J Cell Biol. 2004;166:949–955. [PMC free article] [PubMed]
12. Gruss OJ, Carazo-Salas RE, Schatz CA, et al. Ran induces spindle assembly by reversing the inhibitory effect of importin alpha on TPX2 activity. Cell. 2001;104:83–93. [PubMed]
13. Kufer TA, Sillje HH, Korner R, Gruss OJ, Meraldi P, Nigg EA. Human TPX2 is required for targeting Aurora-A kinase to the spindle. J Cell Biol. 2002;158:617–623. [PMC free article] [PubMed]
14. Bayliss R, Sardon T, Ebert J, Lindner D, Vernos I, Conti E. Determinants for Aurora-A activation and Aurora-B discrimination by TPX2. Cell Cycle. 2004;3:404–407. [PubMed]
15. Ouyang H, Mou L, Luk C, et al. Immortal human pancreatic duct epithelial cell lines with near normal genotype and phenotype. Am J Pathol. 2000;157:1623–1631. [PubMed]
16. Freeman WM, Walker SJ, Vrana KE. Quantitative RT-PCR: pitfalls and potential. Biotechniques. 1999;26:112–122. 24–25. [PubMed]
17. Gray PJ, Jr, Bearss DJ, Han H, et al. Identification of human polo-like kinase 1 as a potential therapeutic target in pancreatic cancer. Mol Cancer Ther. 2004;3:641–646. [PubMed]
18. Krishan A. Rapid flow cytofluorometric analysis of mammalian cell cycle by propidium iodide staining. J Cell Biol. 1975;66:188–193. [PMC free article] [PubMed]
19. Rubio-Viqueira B, Jimeno A, Cusatis G, et al. An in vivo platform for translational drug development in pancreatic cancer. Clin Cancer Res. 2006;12:4652–4661. [PubMed]
20. Hata T, Furukawa T, Sunamura M, et al. RNA interference targeting aurora kinase a suppresses tumor growth and enhances the taxane chemosensitivity in human pancreatic cancer cells. Cancer Res. 2005;65:2899–2905. [PubMed]
21. Scharer CD, Laycock N, Osunkoya AO, et al. Aurora kinase inhibitors synergize with paclitaxel to induce apoptosis in ovarian cancer cells. J Transl Med. 2008;6:79. [PMC free article] [PubMed]
22. Yang H, He L, Kruk P, Nicosia SV, Cheng JQ. Aurora-A induces cell survival and chemoresistance by activation of Akt through a p53-dependent manner in ovarian cancer cells. Int J Cancer. 2006;119:2304–2312. [PubMed]
23. Morgan-Lappe SE, Tucker LA, Huang X, et al. Identification of Ras-related nuclear protein, targeting protein for xenopus kinesin-like protein 2, and stearoyl-CoA desaturase 1 as promising cancer targets from an RNAi-based screen. Cancer Res. 2007;67:4390–4398. [PubMed]
24. Jackson AL, Mao M, Kobayashi S, et al. Chromosome 20q amplification regulates in vitro response to Kinesin-5 inhibitor. Cancer Inform. 2008;6:147–164. [PMC free article] [PubMed]
25. Eyers PA, Erikson E, Chen LG, Maller JL. A novel mechanism for activation of the protein kinase Aurora A. Curr Biol. 2003;13:691–697. [PubMed]
26. Anderson K, Yang J, Koretke K, et al. Binding of TPX2 to Aurora A Alters Substrate and Inhibitor Interactions. Biochemistry. 2007;46:10287–10295. [PubMed]