PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Immunol. Author manuscript; available in PMC 2010 December 1.
Published in final edited form as:
PMCID: PMC2782783
NIHMSID: NIHMS152991

Estrogen regulates transcription factors STAT-1 and NF-κB to promote inducible nitric oxide synthase (iNOS) and inflammatory responses

Abstract

Estrogen regulation of inflammatory responses has broad physiological and pathological consequences. However, the molecular mechanism of estrogen regulation of inflammation is still poorly understood. In the present study, we report that activation of both IFNγ-STAT-1 and NF-κB signaling is essential for Con A-induced iNOS/nitric oxide in murine splenocytes. Interestingly, estrogen enhances STAT-1 DNA binding activity without increasing the expression of phosphorylated and total STAT-1 protein. We have reported that estrogen blocks the nuclear expression of NF-κB p65 and modifies nuclear NF-κBp50. Here, we demonstrated that both nuclear STAT-1 and NF-κB are modified by serine protease mediated proteolysis, which resulted in altered STAT-1 and NF-κB activity/signaling in splenocytes from estrogen-treated mice. Selected inhibition of serine protease activity with AEBSF (4-(2-Aminoethyl) benzenesulfonyl fluoride hydrochloride) restores the nuclear expression of full-length STAT-1 and NF-κB proteins, which causes decreased STAT-1 DNA binding activity and formation of NF-κB p65/p50 binding complexes in nuclei of splenocytes from estrogen-treated mice. Consequently, there is significantly decreased iNOS and IFNγ production in AEBSF treated splenocytes from estrogen-treated mice, which suggests a positive regulatory role of truncated STAT-1 and/or NF-κB. Interestingly, there is increased production of MCP-1 in STAT-1 or NF-κB siRNA transfected cells, as well as in AEBSF treated splenocytes from estrogen-treated mice. These data suggest a differential role of truncated STAT-1 and NF-κB in regulation of various inflammatory molecules in splenocytes from estrogen-treated mice. Together, our data reveal a novel molecular mechanism of estrogen-mediated promotion of inflammatory responses, which involves post-translational modification of STAT-1 and NF-κB proteins.

Keywords: Estrogen, STAT-1, NF-κB, iNOS, mouse splenocytes

INTRODUCTION

Inflammation, mediated by the production of inflammatory cytokines, chemokines, and other inflammatory molecules, is an essential body response that functions to eliminate extrinsic “assaults”. However, exaggerated or prolonged inflammation can lead to severe debilitating or even fatal inflammatory diseases. Thus, a better understanding of the generation and regulation of inflammatory molecules is critical. Current studies from our laboratory and others have revealed that in vivo estrogen exposure promotes inflammatory responses that include enhanced secretion of Th1 related cytokines (IFNγ, IL-12, IL-1β), inflammatory chemokines (MCP-1 and MCP-5), and induction of enzymes involved in proinflammation (Inducible nitric oxide synthase (iNOS) and Cyclooxygenases-2 (Cox-2)) (17). However, the molecular mechanism of estrogen-mediated pro-inflammatory responses remains unclear.

iNOS is the primary isoform present in immune cells that is capable of producing high levels of nitric oxide (8, 9). Nitric oxide is a unique signaling messenger, which plays an important role in the control of a number of immune defenses against microbes, viruses, and parasites (911). However, inappropriate or excessive nitric oxide production is detrimental and has been implicated in the pathogenesis of many chronic inflammatory diseases including asthma, multiple sclerosis, hypercholesterolemia, atherosclerosis, arthritis, and systemic lupus erythematosus (1214). Considering the versatile role of nitric oxide in the immune system and the fact that aberrant production of it can be detrimental, it is important to understand the mechanism of estrogen-mediated promotion of iNOS and nitric oxide in splenocytes.

Multiple transcription factors have been shown to regulate iNOS gene expression in response to different stimulations. Activation of the NF-κB pathway and/or the IFNγ-JAK-STAT-1 pathway has been shown to be essential for iNOS induction in various cell types (1518). Inhibition of STAT-1 or NF-κB signaling decreased LPS and/or IFNγ induced iNOS gene expression (17, 1921). Further, a role of interferon regulatory factor (IRF)-1 and Interferon Consensus Sequence Binding Protein (ICSBP, or IRF-8) in iNOS gene expression is suggested by the observations that IFNγ-stimulated iNOS was reduced in both IRF-1−/− and ICSBP −/− mouse macrophages (2224). Nevertheless, other cell types from IRF-1−/− mice, such as chondrocytes and pancreatic islet cells, have exhibited normal iNOS induction (24, 25). This suggests that the transcription factors required for induction of iNOS may vary among cell types. In addition, studies have shown that transcription factors such as CCAAT/enhancer binding protein-β (c/EBPβ), cAMP-responsive element binding protein (CREB), and activating protein-1 (AP-1) are also involved in iNOS regulation (17). Generally, maximal induction of iNOS requires synergistic activation of multiple transcription factors (16, 26, 27).

The focal point of the present studies was to reveal the molecular mechanism of estrogen-mediated promotion of iNOS, with particular emphasis on the critical role of the key transcription factors STAT-1 and NF-κB on iNOS gene expression in splenocytes. We found that estrogen enhances STAT-1 DNA binding activity without increasing the expression of phosphorylated and total STAT-1. Further, our data revealed that estrogen induces serine protease-mediated proteolysis of STAT-1 and NF-κB, which may alter and enhance the activity of these transcription factors. Moreover, we demonstrate that modified STAT-1 and NF-κB proteins in splenocytes from estrogen-treated mice have differential roles in regulating different inflammatory molecules such as iNOS, IFNγ and MCP-1. Together, our studies add new knowledge with regard to the mechanism of estrogen-mediated regulation of inflammation.

MATERIALS AND METHODS

Animals and estrogen treatment

Three to four week-old wild type C57BL/6 male mice were purchased from Charles River Laboratories and housed in the animal facility at the Center for Molecular Medicine and Infectious Diseases (CMMID). As is the long-standing standard practice in our laboratory, approximately one week after acclimatization, mice were orchiectomized and surgically implanted with silastic capsules containing 17-β estradiol (Sigma) or empty (placebo control) silastic implants (2, 6, 2831). These standard implants are known to slowly release estrogen over many weeks, and serum estrogen levels (222.67 ± 41.9 pg/ml at 7 wks) achieved by this method of implantation have been previously published (6). Mice were fed a commercial pellet diet devoid of estrogenic hormones (7013 NIH-31 Modified 6% Mouse/Rat Sterilizable Diet, Harlan-Teklad, Madison, WI). The Institutional Animal Use and Care Committee at the Virginia Polytechnic Institute and State University approved all animal procedures.

Splenocyte isolation and culture

Mice were euthanized 6–8 weeks after implantation. Splenocytes were isolated and cultured using procedures that have been described in detail before (5, 6, 28, 29, 31). The splenocytes were adjusted to 5 × 106 cells/ml before plating. RPMI-1640 (phenol red free) supplemented with 10% charcoal-stripped fetal bovine serum (Atlanta Biologicals), 2 mM L-glutamine, 100 IU/ml penicillin, 100 μg/ml streptomycin, and 1% non-essential amino acids (Mediatech) were used for splenocyte culture. For Con A and IFNγ stimulation, equal volumes of 10 μg/ml Con A (Sigma) or 10 ng/ml recombinant IFNγ (rIFNγ, eBioscience) in media were added to seeded cells (final concentrations at 5 μg/ml and 5 ng/ml, respectively). For non-stimulated cells (media controls), equal volumes of complete media were added to seeded cells. For JAK2 kinase and NF-κB inhibitor studies, the splenocytes were pretreated with vehicle (DMSO or ethanol), 20 μM AG490 (a selective JAK2 tyrosine kinase inhibitor, Sigma), or 10 μM A77 1726 (a selective NF-κB inhibitor, Axxora) for 1 hour before stimulation with Con A in the presence of the inhibitor or vehicle. For the serine protease inhibitor study, 50 μM AEBSF (Calbiochem) was added to plated cells with Con-A at the same time.

RAW 264.7 cell culture

The murine macrophage cell line, RAW264.7 (American Type Culture Collection), was cultured in RPMI 1640 medium supplemented with 10% charcoal-stripped fetal bovine serum (Atlanta Biologicals), 2 mM L-glutamine, 100 IU/ml penicillin, and 100 μg/ml streptomycin (Mediatech).

Electrophoretic mobility shift assay (EMSA)

EMSAs were performed as described in detail in our previous report (6). Briefly, 5' biotin labeled DNA binding probes for STAT-1 (γ-interferon activated sequence (GAS) probe, forward: GATCGTGATTTCCCCGAAATGACG and reverse complementary: CGTCATTTCGGGGAAATCACGATC) and NF-κB (κB DNA probe, forward: GATCGAGGGGACTTTCCCTAGC and reverse complementary: GCTAGGGAAAGTCCCCTCGATC) were synthesized by Integrated DNA Technologies and annealed. For the binding reaction, 5 μg of nuclear extract proteins (2–3 μl) were incubated with 20 fmol of biotin-labeled double-stranded DNA probe at room temperature for 25 minutes in 20 μl of 1x binding buffer (12 mM HEPES, pH 7.5, 80 mM NaCl, 5 mM DTT, 5 mM MgCl2, 0.5 mM EDTA, 1 μg poly dI-dC, and 5% glycerol). The binding complexes were separated on 5% TBE polyacrylamide gels (Bio-Rad), transferred to a positively charged Nylon membrane (Pierce) and then detected using a Chemiluminescent Nucleic Acid Detection Module (Pierce). The images were captured and the signal intensities were analyzed using a Kodak Image Station 440.

Western blotting

Western blotting was used to analyze the expression of proteins in whole cell, nuclear, and cytoplasmic extracts as we described previously (5, 6). For whole cell extracts, cell pellets were washed with ice-cold PBS and then lysed with CelLytic™M Cell Lysis Reagent (Sigma). Nuclear and cytoplasmic extracts were prepared using NE-PER nuclear and cytoplasmic extraction reagents (Pierce). The blot images were captured and analyzed using a Kodak Image Station 440. Antibodies against NF-κB p65 (c-20, and F-6), p50 (NLS), IRF-1, total STAT-1 were purchased from Santa Cruz Biotechnology. Antibodies against phosphorylated STAT-1 (Tyr701 and Ser270) were purchased from Cell Signaling. The antibody against β-actin (loading control) was obtained from Abcam.

Detection of nitric oxide, IFNγ, and MCP-1

Griess assays were used to measure nitrite, an indicator of nitric oxide production in the culture medium as described in detail before (5). The levels of IFNγ and MCP-1 in culture supernatants were determined by ELISAs as described in our previous studies (2, 31, 32).

Transfection of siRNA to splenocytes

A nucleofector device and mouse macrophage nucleofector kit (Amaxa) was used to transfect siRNA oligos to mouse splenocytes. All of the siRNA oligos were purchased from Dharmacon. Briefly, 1.5 × 107 freshly-isolated splenocytes were pelleted, resuspended in 100 μl of mouse macrophage nucleofector solution, and mixed with 3.5 μg of siRNA oligos. The sample was transferred to a cuvette and then transfected using the optimal nucleofector program m001. Twenty-four hours after transfection, the splenocytes were stimulated with Con A for 24 or 48 hours. The cells were collected for Western blot analysis. Supernatants were used for measurement of nitric oxide, IFNγ, and MCP-1.

Statistical analysis

All values are given as means ± SEM. To assess statistical significance between placebo- and estrogen-treated mice, two tailed, unpaired t tests were performed using GraphPad InStat version 3.0a for Macintosh (GraphPad Software). For evaluation of the effect of a specific inhibitor or siRNA, the levels of nitrite, IFNγ, and MCP-1 in specific inhibitor treated or siRNA transfected cells were shown as a percentage of the level of the corresponding control (regarded as 100%). Paired t tests were performed to assess the statistical significance of the effect of inhibitors and specific siRNA.

RESULTS

IFNγ-activated JAK-STAT-1 signaling is critical for Con A induced nitric oxide production in mouse splenocytes

In our previous report, we have shown that in vivo estrogen treatment of mice markedly augmented the ability of Con A activated splenocytes to release higher levels of IFNγ and nitric oxide (2, 5). Further, by using IFNγ−/− knockout mice, we have demonstrated that estrogen-mediated upregulation of iNOS and nitric oxide is IFNγ dependent (5). In this report, we investigated whether induction of iNOS and nitric oxide by Con A is mediated through IFNγ-activation of the JAK-STAT-1 signaling pathway. As we previously reported (5), nitric oxide production in estrogen-treated splenocytes was significantly higher than that of splenocytes from placebo-treated mice (11.03 ± 2.99 μM versus 5.39 ± 1.77 μM; p <0.001) following stimulation with Con A for 48 hours (Fig.1A). Inhibition of JAK-STAT-1 signaling with a specific JAK2 tyrosine kinase inhibitor, AG490, resulted in about 45% and 60% reduction in nitric oxide production in splenocytes from placebo- and estrogen-treated mice, respectively (Fig. 1B).

Figure 1
Inhibition of IFNγ-JAK-STAT-1 signaling decreases Con A-induced nitric oxide production in mouse splenocytes

To further determine the role of STAT-1 in Con A-stimulated iNOS in splenocytes, we used STAT-1 siRNA to specifically inhibit STAT-1 gene expression. The STAT-1 siRNA has no effect on the expression of other STATs such as STAT-3 and STAT-4 (Supplemental figure 1). As indicated, inhibition of STAT-1 protein expression markedly decreases Con A-stimulated iNOS protein expression (Fig. 1C), and nitric oxide production (Fig. 1D) in cells from both placebo- and estrogen-treated mice. Taken together, our data clearly indicate that the IFNγ-JAK-STAT-1 signaling pathway plays an important role in Con A stimulated iNOS expression and nitric oxide production in mouse splenocytes.

Estrogen treatment enhances the DNA binding activity of STAT-1, but not the expression level of phosphorylated and total STAT-1 in mouse splenocytes

Given the critical role of STAT-1 in regulating the expression of iNOS, we next determined whether in vivo estrogen treatment upregulated iNOS expression in splenocytes by increasing the expression and/or activity of STAT-1. The Western blot data from analysis of whole cell extracts indicated that there was constitutive phosphorylation of STAT-1 at the Serine 727 site (p-STAT-1-Ser), but not at the Tyrosine 701 site (p-STAT-1-Tyr) in freshly-isolated splenocytes (Fig. 2A). Following Con A stimulation, there was a dramatic increase of p-STAT-1-Tyr in splenocytes stimulated with Con A for 3 hrs from both placebo- and estrogen-treated mice. The level of p-STAT-1-Tyr was decreased with increased stimulation time at 6 and 24 hrs of Con A stimulation. Overall, the Western data with whole cell extracts revealed that the expression level of phosphorylated STAT-1 and total STAT-1 in splenocytes from estrogen-treated mice is comparable to that from placebo-treated mice (Fig. 2A).

Figure 2
Estrogen treatment enhances the DNA binding activity of STAT-1, but does not increase the expression of phosphorylated and total STAT-1 in splenocytes

Once activated, phosphorylated STAT-1 dimerizes, translocates into the nucleus, binds to specific promoters, and induces the expression of target genes. We therefore determined whether estrogen treatment increases the nuclear expression of phosphorylated STAT-1. The data indicated that the expression of phosphorylated STAT-1 is not increased in the nuclei of splenocytes from estrogen-treated mice when compared with that from placebo-controls. Indeed, the densitometry analysis of Western data indicated that the expression level of phosphorylated STAT-1 was decreased in splenocytes from estrogen-treated mice at 6 hrs and 24 hrs of Con A stimulation (Fig. 2B). Interestingly, in cells from estrogen treated mice, STAT-1 was modified and truncated STAT-1 forms were frequently observed (Fig. 2B). This post-translational modification of STAT-1 seems to be a dynamic process since in some samples, full-length STAT-1 and truncated STAT-1 forms co-existed. Figure 2B depicts two representative STAT-1 expression patterns in cells from estrogen-treated mice. Also, the modification was only observed for nuclear STAT-1, not cytoplasmic STAT-1 (Supplemental figure 2).

We then determined whether this post-translational modification of STAT-1 in the nuclei would affect the DNA binding activity of STAT-1. Experiments including EMSA assays with GAS DNA and κB DNA competitors, supershift assays, and in vitro DNA binding assays revealed that Con A activated NF-κB proteins bind to the GAS DNA oligos specifically. We could not separate formed p65/p50 GAS DNA binding complexes from STAT-1 GAS DNA binding complexes in cells from placebo-treated mice (Supplemental figure 3). Therefore, to exclusively detect the STAT-1 binding signal intensity, we included 1 pmol of unlabeled κB DNA oligo in the binding reaction to compete out the binding of NF-κB protein to GAS DNA probes. As shown in Figure 2C, there was no STAT-1 DNA binding in freshly-isolated cells (t0). Con A stimulation induced STAT-1 DNA binding complexes in nuclei of splenocytes from both placebo-and estrogen-treated mice. Although the nuclear level of phosphorylated STAT-1 was not increased in the samples from estrogen-treated mice after 3 hrs of Con A stimulation, the STAT-1 binding signal intensity was significantly stronger when compared to that from placebo-treated mice (Fig. 2 C and D). Since the STAT-1 in cells from estrogen-treated mice was truncated (Fig. 2B), the STAT-1 DNA binding complex in cells from estrogen-treated mice was slightly smaller than that from placebo-treated mice (Fig. 2C). By 24 hrs of Con A stimulation, the binding activity of STAT-1 completely disappeared (Fig. 2C), corresponding with the decrease of phosphorylated STAT-1 in the nuclei of splenocytes (Fig. 2B). Overall, our data show that although in vivo estrogen treatment does not increase the expression level of phosphorylated and total STAT-1, it does induce post-translational modification of nuclear STAT-1 and enhances the DNA binding activity of STAT-1.

Activation of IFNγ-JAK-STAT-1 signaling alone is not sufficient to induce iNOS expression in mouse splenocytes

We next determined whether activation of IFNγ-JAK-STAT-1 signaling alone is sufficient to induce iNOS and nitric oxide in splenocytes. As a control, we included the murine macrophage cell line, RAW264.7. Unlike RAW264.7 cells, there was no nitric oxide production in IFNγ stimulated splenocytes from either placebo- or estrogen-treated mice (Fig. 3A). Further, Western blot analysis indicated that there is also no iNOS protein expression in whole cell extracts from IFNγ stimulated splenocytes (Fig. 3B). The activation of IFNγ-STAT-1 signaling in IFNγ stimulated splenocytes from either placebo-or estrogen-treated mice was confirmed by the expression of IRF-1 (Fig. 3B), phosphorylated STAT-1 (Fig. 3C), and STAT-1 DNA binding activity (Fig. 3D), which paralleled those from Con A stimulated cells. Since we have shown that estrogen inhibited the expression of IRF-1 (28) and enhanced STAT-1 DNA binding activity (Fig. 2C), as expected, we observed an inhibition of IRF-1 expression and increased STAT-1 DNA binding activity in IFNγ stimulated cells from estrogen-treated mice compared to that from placebo-treated mice (Fig. 3B and 3D). The above data clearly indicated that although it is critical, activation of the IFNγ- STAT-1 signaling pathway alone is not sufficient to induce the expression of iNOS in splenocytes. Thus, the IFNγ-JAK-STAT-1 signaling pathway is likely to act synergistically with other signaling pathway(s) to induce iNOS and nitric oxide in Con A activated mouse splenocytes.

Figure 3
IFNγ stimulation alone cannot induce iNOS expression and nitric oxide production in mouse splenocytes

NF-κB signaling plays an important role in Con A-stimulated iNOS and nitric oxide production in mouse splenocytes

In addition to STAT-1, the transcription factor NF-κB is also critical for iNOS induction (17). A previous report from our lab has shown that estrogen enhances NF-κB signaling and that activated NF-κB proteins bind to the promoter of the iNOS gene (6). As expected, inhibition of NF-κB signaling with a selective NF-κB inhibitor, A77 1726, resulted in about a 40% reduction of nitric oxide production in splenocytes from both placebo and estrogen-treated mice (Fig. 4A). Further, inhibition of NF-κB p65 expression with p65 siRNA significantly decreased the production of Con A stimulated nitric oxide in splenocytes from both placebo-and estrogen-treated mice (Fig.4B). There is also decreased induction of nitric oxide in p50 siRNA transfected splenocytes from estrogen-treated mice (Fig. 4B). Western blot analysis further confirmed that the expression of iNOS protein was inhibited in p65 siRNA transfected splenocytes (Fig. 4C). The above data indicated that the NF-κB signaling pathway plays an important role in regulation of Con A-stimulated iNOS/nitric oxide in mouse splenocytes.

Figure 4
Inhibition of NF-κB signaling decreases Con A stimulated iNOS and nitric oxide production in mouse splenocytes

Differential roles of STAT-1 and NF-κB in regulation of IFNγ and MCP-1 in splenocytes from estrogen-treated mice

In addition to iNOS, we have also shown that estrogen upregulated other inflammatory molecules such as IFNγ and MCP-1 (2, 6, 31, 32). Here, we found that inhibition of either NF-κB or STAT-1 decreased Con A-stimulated IFNγ in splenocytes from placebo-treated mice. Interestingly, in cells from estrogen-treated mice, inhibition of NF-κBp65, but not STAT-1, significantly decreased Con A-induced IFNγ (Fig. 5A). These data suggested that NF-κB, not STAT-1, plays an important role in regulation of Con A-stimulated IFNγ in splenocytes from estrogen-treated mice. Impressively, although NF-κB signaling has also been shown to play an important role in regulating the expression of MCP-1 (33, 34), inhibition of NF-κBp65 did not decrease Con A-induced MCP-1 in splenocytes from estrogen-treated mice. Rather, there is increased MCP-1 production in NF-κB p65 siRNA transfected cells from estrogen-treated mice (Fig. 5B). Further, inhibition of STAT-1 also increased Con A-stimulated MCP-1 production in splenocytes from estrogen-treated mice (Fig. 5B). The effect of STAT-1 and NF-γB on MCP-1 could not be fully determined in placebo-treated mice since the Con A-stimulated MCP-1 level was very low, and hence MCP-1 could not be measured in all placebo samples. These data imply differential roles of STAT-1 and NF-κB in regulation of MCP-1 in splenocytes from estrogen-treated mice. Overall, our data showed that STAT-1 and NF-κB signaling in splenocytes from estrogen-treated mice have differential regulatory roles in regulating three inflammatory molecules: nitric oxide, IFNγ, and MCP-1.

Figure 5
The roles of STAT-1 and NF-κB played in the regulation of IFNγ and MCP-1

Serine proteases play a critical role in regulating STAT-1 and NF-κB signaling in splenocytes from estrogen-treated mice

Our data indicated that estrogen induced a post-translational modification of nuclear STAT-1, which resulted in truncated STAT-1. Proteolytic processing has been shown to play an important role in regulation of STAT protein-mediated signaling (35). Here, we found that selective inhibition of the activity of serine proteases with AEBSF completely abolished the truncated STAT-1 isoforms in cells from estrogen-treated mice (Fig. 6A). Moreover, we found that STAT-1 binding activity is obviously decreased in AEBSF treated splenocytes from estrogen-treated mice and there was a concomitant reappearance of full-length STAT-1 (Fig. 6B). However, AEBSF treatment has no effect on the expression and binding activity of STAT-1 in cells from placebo-treated mice.

Figure 6
Inhibition of serine protease activity abolished the post-translational modification of nuclear STAT-1

Additionally, we have recently shown that in vivo estrogen treatment increases NF-κB transcriptional activity even though it markedly inhibits nuclear expression of NF-κB p65, c-Rel, and RelB proteins (6). In addition, estrogen also modifies p50 protein in nuclei as indicated by truncated p50 protein (6). Here, we found that the truncated p50 protein had disappeared and been replaced with p50 protein of normal size in AEBSF treated cells from estrogen-treated mice (Fig. 7A). Surprisingly, we found that NF-κBp65 was also evident in the nuclei of AEBSF treated cells from estrogen-treated mice (Fig. 7A). Moreover, p65/p50 κB DNA binding complexes, which were inhibited by in vivo estrogen treatment, were evident in AEBSF treated cells from estrogen-treated mice (Fig.7B). The small binding complexes (referred to as “c” and “d”) (6), which were only observed in cells from estrogen-treated mice had disappeared and were no longer observed in AEBSF treated cells. By using a p65 antibody (F-6), which recognizes the N-terminal sequence of p65, a “c” terminal truncated p65 isoform (p65s, about 35 KD) in the nuclei of splenocytes from estrogen-treated mice was evident (Fig. 7C). Inhibition of serine proteases with AEBSF resulted in noticeable disappearance of p65s, which was replaced with full-length p65 (Fig. 7C).

Figure 7
Serine protease regulates NF-κB signaling

Further, we investigated the effect of inhibition of serine protease on Con A-stimulated inflammatory molecules in splenocytes. As indicated, with the inhibition of serine protease, we observed a significant decrease of Con A-stimulated nitric oxide and iNOS protein expression in cells from estrogen-treated mice, but not placebo-treated mice (Fig. 8A and B). Inhibition of serine protease significantly decreased IFNγ production in cells from both placebo- and estrogen-treated mice (Fig. 8C). In contrast to iNOS and IFNγ, with the inhibition of serine protease, Con A-stimulated MCP-1 in splenocytes from estrogen-treated mice was markedly increased (Fig. 8D). Taken together, our data revealed that in vivo estrogen treatment induced serine protease-mediated proteolysis of nuclear STAT-1 and NF-κB, which contributed to increased production of nitric oxide and IFNγ, but not MCP-1 in Con A-activated splenocytes.

Figure 8
Serine protease plays a role in regulating the expression of inflammatory molecules in mouse splenocytes

DISCUSSION

Given the pivotal role of estrogen in immune modulation and in gender differences in immunity and autoimmunity, there is a need to better understand the mechanisms of estrogen regulation of inflammatory immune responses. Interestingly, estrogen has been shown to exhibit both pro-inflammatory and anti-inflammatory immune responses in different studies. The divergent effects of estrogen on inflammatory responses could depend upon whether estrogen treatment is in vivo or in vitro, length of estrogen exposure time, the timing of estrogen treatment (i.e. with regard to age of the animal and its maturity), the dose of estrogen, the species or tissue type examined, and stimuli used (3, 8, 36, 37). Contradictory to the finding that estrogen inhibits the inflammatory protein iNOS in most in vitro studies (19, 38, 39), in vivo studies indicate that estrogen increases the expression of iNOS in splenocytes (4, 5), peritoneal macrophages (3), rat uterus (40), and ovine coronary arteries (41). In contrast to the finding that in vitro estrogen treatment inhibited NF-κB signaling, which resulted in decreased inflammation in macrophages (19), we have shown that in vivo estrogen enhanced NF-κB transcription activity and production of inflammatory molecules (6). These reports suggest that a different molecular mechanism underlies the effect of short-term in vitro and relative long-term in vivo estrogen treatment on inflammatory responses. In this study, we delineated the molecular mechanisms underlying estrogen-mediated promotion of inflammatory responses in splenocytes. Primarily, we focused on estrogen regulation of STAT-1 and NF-κB, two key transcription factors that are involved in the generation of inflammatory molecules.

Although estrogen upregulated the expression of IFNγ in Con A-activated splenocytes, it inhibited the expression of IRF-1, a transcription factor induced by IFNγ and known to play an important role in the regulation of IFNγ-induced genes such as iNOS (28). In the present study, we demonstrated that IFNγ-JAK-STAT-1 signaling is essential, but not sufficient, to induce iNOS in Con A-stimulated splenocytes. Activation of both IFNγ-JAK-STAT-1 and NF-κB signaling is necessary for iNOS/nitric oxide production in Con A-activated mouse splenocytes. Inhibition of either IFNγ-JAK-STAT-1 or NF-κB signaling significantly decreases the expression of iNOS in Con A-activated splenocytes (Fig.1 and Fig.4).

Increased IFNγ production in splenocytes from estrogen-treated mice did not enhance the expression of phosphorylated and total STAT-1, a key mediator of IFNγ signaling (Fig. 2A and B). However, we found that nuclear STAT-1 in splenocytes from estrogen-treated mice is truncated and STAT-1 DNA binding activity was enhanced (Fig. 2). Thus far, truncated STAT isoforms generated by proteolytic processing have been identified for STAT3, STAT5, and STAT-6 (35, 42). Here, we are the first to report that in vivo estrogen treatment induces serine protease-mediated proteolysis of nuclear STAT-1, which resulted in truncated STAT-1 in splenocyte nuclei. Moreover, our data have suggested that this modification of nuclear STAT-1 attributes to increased STAT-1 DNA binding activity in splenocytes from estrogen-treated mice since there are normal sized STAT-1 and decreased STAT-1 DNA binding activity in AEBSF treated cells (Fig. 6A and B). Given that the expression of truncated STAT proteins has been potentially linked to the pathology of human diseases (42), it is important to further investigate whether estrogen induced truncation of STAT-1 is related to estrogen-mediated immune disorders.

In addition to STAT-1, the nuclear expression of NF-κBp65 and p50, which are blocked and truncated, respectively, in splenocytes from estrogen-treated mice was also restored in AEBSF treated cells (Fig. 7A). We previously suspected that the absence of nuclear expression of NF-κB p65 in splenocytes from estrogen-treated mice could be caused by inhibition of nuclear translocation since these proteins are still present in the cytoplasm (6), and estrogen has been shown to control p65 intracellular transportation by targeting microtubule-associated transport systems (19). However, the reappearance of nuclear expression of NF-κB p65 in AEBSF treated cells suggests another possibility that nuclear p65 may be proteolyzed by serine protease. Further experiments with a different NF-κB p65 antibody (F-6), which recognizes the N-terminal sequence of p65, confirmed the existence of truncated p65 isoforms (p65s) in nuclei of splenocytes from estrogen-treated mice. Moreover, the nuclear expression levels of c-Rel, RelB, and IRF-1, which were inhibited by estrogen, were also increased in AEBSF treated splenocytes from estrogen-treated mice and were comparable to that observed in cells from placebo-treated mice (Supplemental figure 4). These data indicated that in vivo estrogen treatment could modify multiple transcription factors by inducing serine protease-mediated proteolysis.

Since the inhibition of NF-κB p65 and STAT-1 with their corresponding siRNA decreased iNOS expression in cells from estrogen-treated mice, it is possible that truncated STAT-1 and p65s isoforms still play positive regulatory roles for iNOS gene expression. At this time, we are not clear how truncated STAT-1 has stronger DNA binding activity than full-length STAT-1. In addition, with the complete deletion of the transactivation domain in the carboxyl-terminus, how p65-short isoforms play positive regulatory roles in splenocytes from estrogen-treated mice is also not apparent. A recent study revealed that a truncated p65 isoform (p35 RelA) was induced in in vitro Leishmania infected macrophages, and subsequently formed p35RelA/p50 dimers had transcriptional activity (43). As mentioned in our previous report (6), there is an unknown, small, p50 containing NF-κB binding complex “d” in Con-A activated splenocytes from estrogen-treated mice (Fig. 7B). This binding complex “d” was not observed in AEBSF treated splenocytes (Fig. 7B). Whether this NF-κB binding complex “d” is formed by p65s (about 35KD) and p50 is not known and requires further investigation. In addition, we have shown that in vivo estrogen exposure induced the expression of a transcriptional co-activator, B cell Lymphoma 3 (Bcl3), which binds to the iNOS promoter with NF-κBp50 in Con A-activated splenocytes from estrogen-treated mice (6). Bcl3 can bind to p50/p50 and p52/p52, which lack transactivation domains and confer the ability of these homodimers to induce NF-κB responsive genes (44, 45). Therefore, it is possible that p65s exerts its positive regulatory activity by interaction with p50 and Bcl3. However, further experiments are required to confirm this assumption.

In contrast to decreased iNOS/nitric oxide production, we observed increased MCP-1 induction in p65 siRNA and STAT-1 siRNA transfected cells from estrogen-treated mice (Fig. 5). Consistent with this finding, while the induction of iNOS/nitric oxide and IFNγ was inhibited, MCP-1 induction was enhanced when serine protease was inhibited in cells from estrogen-treated mice (Fig.8). These data suggested that truncated STAT-1 and p65 could also play negative regulatory roles for certain inflammatory molecules such as MCP-1. The complete understanding of the differential roles of modified STAT-1 and p65 in regulation of different inflammatory molecules in splenocytes from estrogen-treated mice requires further investigation. Considering that inflammatory gene expression involves multiple transcription factors and/or coactivators, it is possible that estrogen modifies the interactions between these transcription factors/co-activators, which alters the activity of transcriptional complexes and results in either increased or decreased inflammatory gene expression. It is also possible that estrogen treatment regulates transcription factors other than STAT-1 and NF-κB to enhance the induction of MCP-1. In concurrence with this, we found that estrogen treatment increases the expression and binding activity of c/EBPβ (Supplemental figure 5), another important transcription factor that regulates MCP-1, iNOS, and many other inflammatory molecules (17, 4648).

Our data suggest that serine protease plays an important role in regulating inflammatory responses by proteolyzing transcription factors, and that this is associated with estrogen exposure. Nevertheless, the underlying mechanism by which estrogen induces serine protease activity is unknown. In addition, since serine proteases play important roles in inflammatory responses, as well as in innate and adaptive immunity (49), it is worthwhile to further investigate which type of serine protease was induced by estrogen, and whether estrogen-induced serine protease is directly involved in regulation of inflammatory responses. Given the increasing importance of immune-tissue-derived iNOS, IFNγ, and MCP-1 in health and disease, studies on estrogen-induced regulation of these pro-inflammatory molecules may offer a better understanding of diseases and aid in devising new therapeutic interventions for estrogen-related immune disorders.

Supplementary Material

supplemental figures

ACKNOWLEDGEMENTS

The authors thank Mr. Carmine Graniello for his technical support. We also thank Mr. Peter Jobst, Ms. Connie Kingrea, and other animal care staff members.

This work was supported by the National Institutes of Health (5 RO1 AI051880-05).

Abbreviations

AEBSF
4-(2-Aminoethyl) benzenesulfonyl fluoride hydrochloride
iNOS
inducible nitric oxide synthase
GAS
γ-interferon activated sequence
IRF-1
Interferon regulatory factor-1
Bcl3
B cell Lymphoma 3

REFERENCES

1. Gourdy P, Araujo LM, Zhu R, Garmy-Susini B, Diem S, Laurell H, Leite-de-Moraes M, Dy M, Arnal JF, Bayard F, Herbelin A. Relevance of sexual dimorphism to regulatory T cells: estradiol promotes IFN-gamma production by invariant natural killer T cells. Blood. 2005;105:2415–2420. [PubMed]
2. Karpuzoglu-Sahin E, Hissong BD, Ansar Ahmed S. Interferon-gamma levels are upregulated by 17-beta-estradiol and diethylstilbestrol. J Reprod Immunol. 2001;52:113–127. [PubMed]
3. Calippe B, Douin-Echinard V, Laffargue M, Laurell H, Rana-Poussine V, Pipy B, Guery JC, Bayard F, Arnal JF, Gourdy P. Chronic estradiol administration in vivo promotes the proinflammatory response of macrophages to TLR4 activation: involvement of the phosphatidylinositol 3-kinase pathway. J Immunol. 2008;180:7980–7988. [PubMed]
4. Dai R, Phillips RA, Zhang Y, Khan D, Crasta O, Ahmed SA. Suppression of LPS-induced IFN{gamma} and nitric oxide in splenic lymphocytes by select estrogen-regulated miRNA: A novel mechanism of immune modulation. Blood. 2008;112:4591–4597. [PubMed]
5. Karpuzoglu E, Fenaux JB, Phillips RA, Lengi AJ, Elvinger F, Ansar Ahmed S. Estrogen up-regulates inducible nitric oxide synthase, nitric oxide, and cyclooxygenase-2 in splenocytes activated with T cell stimulants: role of interferon-gamma. Endocrinology. 2006;147:662–671. [PubMed]
6. Dai R, Phillips RA, Ahmed SA. Despite inhibition of nuclear localization of NF-kappa B p65, c-Rel, and RelB, 17-beta estradiol up-regulates NF-kappa B signaling in mouse splenocytes: the potential role of Bcl-3. J Immunol. 2007;179:1776–1783. [PubMed]
7. Karpuzoglu E, Phillips RA, Dai R, Graniello C, Gogal RM, Jr., Ahmed SA. Signal transducer and activation of transcription (STAT) 4beta, a shorter isoform of interleukin-12-induced STAT4, is preferentially activated by estrogen. Endocrinology. 2009;150:1310–1320. [PubMed]
8. Karpuzoglu E, Ansar Ahmed S. Estrogen regulation of nitric oxide and inducible nitric oxide synthase (iNOS) in immune cells: implications for immunity, autoimmune diseases, and apoptosis. Nitric Oxide. 2006;15:177–186. [PubMed]
9. Bogdan C, Rollinghoff M, Diefenbach A. The role of nitric oxide in innate immunity. Immunol Rev. 2000;173:17–26. [PubMed]
10. Bogdan C. Nitric oxide and the immune response. Nat Immunol. 2001;2:907–916. [PubMed]
11. MacMicking J, Xie QW, Nathan C. Nitric oxide and macrophage function. Annu Rev Immunol. 1997;15:323–350. [PubMed]
12. Kroncke KD, Fehsel K, Kolb-Bachofen V. Inducible nitric oxide synthase in human diseases. Clin Exp Immunol. 1998;113:147–156. [PubMed]
13. Singh VK, Mehrotra S, Narayan P, Pandey CM, Agarwal SS. Modulation of autoimmune diseases by nitric oxide. Immunol Res. 2000;22:1–19. [PubMed]
14. Vladutiu AO. Role of nitric oxide in autoimmunity. Clin Immunol Immunopathol. 1995;76:1–11. [PubMed]
15. Blanchette J, Jaramillo M, Olivier M. Signalling events involved in interferon-gamma-inducible macrophage nitric oxide generation. Immunology. 2003;108:513–522. [PubMed]
16. Jana M, Anderson JA, Saha RN, Liu X, Pahan K. Regulation of inducible nitric oxide synthase in proinflammatory cytokine-stimulated human primary astrocytes. Free Radic Biol Med. 2005;38:655–664. [PubMed]
17. Kleinert H, Pautz A, Linker K, Schwarz PM. Regulation of the expression of inducible nitric oxide synthase. Eur J Pharmacol. 2004;500:255–266. [PubMed]
18. Xie QW, Kashiwabara Y, Nathan C. Role of transcription factor NF-kappa B/Rel in induction of nitric oxide synthase. J Biol Chem. 1994;269:4705–4708. [PubMed]
19. Ghisletti S, Meda C, Maggi A, Vegeto E. 17beta-estradiol inhibits inflammatory gene expression by controlling NF-kappaB intracellular localization. Molecular and cellular biology. 2005;25:2957–2968. [PMC free article] [PubMed]
20. Gao J, Morrison DC, Parmely TJ, Russell SW, Murphy WJ. An interferon-gamma-activated site (GAS) is necessary for full expression of the mouse iNOS gene in response to interferon-gamma and lipopolysaccharide. J Biol Chem. 1997;272:1226–1230. [PubMed]
21. Meraz MA, White JM, Sheehan KC, Bach EA, Rodig SJ, Dighe AS, Kaplan DH, Riley JK, Greenlund AC, Campbell D, Carver-Moore K, DuBois RN, Clark R, Aguet M, Schreiber RD. Targeted disruption of the Stat1 gene in mice reveals unexpected physiologic specificity in the JAK-STAT signaling pathway. Cell. 1996;84:431–442. [PubMed]
22. Martin E, Nathan C, Xie QW. Role of interferon regulatory factor 1 in induction of nitric oxide synthase. J Exp Med. 1994;180:977–984. [PMC free article] [PubMed]
23. Xiong H, Zhu C, Li H, Chen F, Mayer L, Ozato K, Unkeless JC, Plevy SE. Complex formation of the interferon (IFN) consensus sequence-binding protein with IRF-1 is essential for murine macrophage IFN-gamma-induced iNOS gene expression. J Biol Chem. 2003;278:2271–2277. [PubMed]
24. Blair LA, Maggi LB, Jr., Scarim AL, Corbett JA. Role of interferon regulatory factor-1 in double-stranded RNA-induced iNOS expression by mouse islets. J Biol Chem. 2002;277:359–365. [PubMed]
25. Shiraishi A, Dudler J, Lotz M. The role of IFN regulatory factor-1 in synovitis and nitric oxide production. J Immunol. 1997;159:3549–3554. [PubMed]
26. Lowenstein CJ, Alley EW, Raval P, Snowman AM, Snyder SH, Russell SW, Murphy WJ. Macrophage nitric oxide synthase gene: two upstream regions mediate induction by interferon gamma and lipopolysaccharide. Proc Natl Acad Sci U S A. 1993;90:9730–9734. [PubMed]
27. Xie QW, Whisnant R, Nathan C. Promoter of the mouse gene encoding calcium-independent nitric oxide synthase confers inducibility by interferon gamma and bacterial lipopolysaccharide. J Exp Med. 1993;177:1779–1784. [PMC free article] [PubMed]
28. Lengi AJ, Phillips RA, Karpuzoglu E, Ansar Ahmed S. 17beta-estradiol downregulates interferon regulatory factor-1 in murine splenocytes. J Mol Endocrinol. 2006;37:421–432. [PubMed]
29. Ansar Ahmed S, Verthelyi D. Antibodies to cardiolipin in normal C57BL/6J mice: induction by estrogen but not dihydrotestosterone. J Autoimmun. 1993;6:265–279. [PubMed]
30. Ansar Ahmed S, Dauphinee MJ, Montoya AI, Talal N. Estrogen induces normal murine CD5+ B cells to produce autoantibodies. J Immunol. 1989;142:2647–2653. [PubMed]
31. Lengi AJ, Phillips RA, Karpuzoglu E, Ahmed SA. Estrogen selectively regulates chemokines in murine splenocytes. J Leukoc Biol. 2007;81:1065–1074. [PubMed]
32. Karpuzoglu-Sahin E, Zhi-Jun Y, Lengi A, Sriranganathan N, Ansar Ahmed S. Effects of long-term estrogen treatment on IFN-gamma, IL-2 and IL-4 gene expression and protein synthesis in spleen and thymus of normal C57BL/6 mice. Cytokine. 2001;14:208–217. [PubMed]
33. Wang Y, Rangan GK, Goodwin B, Tay YC, Harris DC. Lipopolysaccharide-induced MCP-1 gene expression in rat tubular epithelial cells is nuclear factor-kappaB dependent. Kidney Int. 2000;57:2011–2022. [PubMed]
34. Bonizzi G, Karin M. The two NF-kappaB activation pathways and their role in innate and adaptive immunity. Trends Immunol. 2004;25:280–288. [PubMed]
35. Hendry L, John S. Regulation of STAT signalling by proteolytic processing. Eur J Biochem. 2004;271:4613–4620. [PubMed]
36. Straub RH. The complex role of estrogens in inflammation. Endocr Rev. 2007;28:521–574. [PubMed]
37. Lang TJ. Estrogen as an immunomodulator. Clin Immunol. 2004;113:224–230. [PubMed]
38. Hayashi T, Yamada K, Esaki T, Muto E, Chaudhuri G, Iguchi A. Physiological concentrations of 17beta-estradiol inhibit the synthesis of nitric oxide synthase in macrophages via a receptor-mediated system. Journal of cardiovascular pharmacology. 1998;31:292–298. [PubMed]
39. Kauser K, Sonnenberg D, Diel P, Rubanyi GM. Effect of 17beta-oestradiol on cytokine-induced nitric oxide production in rat isolated aorta. British journal of pharmacology. 1998;123:1089–1096. [PMC free article] [PubMed]
40. Ogando D, Farina M, Ribeiro ML, Perez Martinez S, Cella M, Rettori V, Franchi A. Steroid hormones augment nitric oxide synthase activity and expression in rat uterus. Reproduction, fertility, and development. 2003;15:269–274. [PubMed]
41. Mershon JL, Baker RS, Clark KE. Estrogen increases iNOS expression in the ovine coronary artery. American journal of physiology. 2002;283:H1169–1180. [PubMed]
42. Lim CP, Cao X. Structure, function, and regulation of STAT proteins. Mol Biosyst. 2006;2:536–550. [PubMed]
43. Gregory DJ, Godbout M, Contreras I, Forget G, Olivier M. A novel form of NF-kappaB is induced by Leishmania infection: involvement in macrophage gene expression. Eur J Immunol. 2008;38:1071–1081. [PubMed]
44. Fujita T, Nolan GP, Liou HC, Scott ML, Baltimore D. The candidate proto-oncogene bcl-3 encodes a transcriptional coactivator that activates through NF-kappa B p50 homodimers. Genes Dev. 1993;7:1354–1363. [PubMed]
45. Bours V, Franzoso G, Azarenko V, Park S, Kanno T, Brown K, Siebenlist U. The oncoprotein Bcl-3 directly transactivates through kappa B motifs via association with DNA-binding p50B homodimers. Cell. 1993;72:729–739. [PubMed]
46. Abraham S, Sweet T, Sawaya BE, Rappaport J, Khalili K, Amini S. Cooperative interaction of C/EBP beta and Tat modulates MCP-1 gene transcription in astrocytes. J Neuroimmunol. 2005;160:219–227. [PubMed]
47. Spooner CJ, Sebastian T, Shuman JD, Durairaj S, Guo X, Johnson PF, Schwartz RC. C/EBPbeta serine 64, a phosphoacceptor site, has a critical role in LPS-induced IL-6 and MCP-1 transcription. Cytokine. 2007;37:119–127. [PubMed]
48. Akira S, Kishimoto T. IL-6 and NF-IL6 in acute-phase response and viral infection. Immunol Rev. 1992;127:25–50. [PubMed]
49. Shpacovitch V, Feld M, Hollenberg MD, Luger TA, Steinhoff M. Role of protease-activated receptors in inflammatory responses, innate and adaptive immunity. J Leukoc Biol. 2008;83:1309–1322. [PubMed]