PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Dev Dyn. Author manuscript; available in PMC 2010 September 1.
Published in final edited form as:
PMCID: PMC2779334
NIHMSID: NIHMS153534

Improved Cre reporter transgenic Xenopus

Abstract

We have produced and characterized improved transgenic reporter lines for detection of Cre recombinase activity during Xenopus development. Improvements include choice of fluorophores, which make these Cre reporter lines generally suitable for lineage tracing studies. We also include data for several new parameters affecting survival and transgenesis efficiency using the recently developed meganuclease method of frog transgenesis. These transgenic frogs express cyan fluorescent protein (CFP) under control of the ubiquitous promoter CMV, where CFP is replaced by DsRed2 (a red fluorescent protein) in the presence of Cre. Three independent, high expression, Cre-sensitive lines have been identified that maintain robust fluorophore expression across generations and lack DsRed2 expression in the absence of Cre. A novel use of these lines is to indelibly mark embryonic blastomeres by Cre mRNA injection for permanent fate mapping. Similarly, transgenically expressed Cre under control of tissue-specific promoters will allow detailed analysis of cell lineage relationships throughout embryogenesis, metamorphosis, and adulthood.

Keywords: Xenopus laevis, frog transgenesis, Cre recombinase, lineage tracing

Introduction

A fundemental component of studies in developmental biology is determination of cell lineage relationships during normal development and after experimental manipulation (Stern and Fraser, 2001). For most adult cell types including stem cells, the precise source populations and developmental pathways are unknown. The model frog Xenopus laevis has been at the forefront of embryonic lineage tracing, where a detailed fate map from embryonic blastomeres to early organogenesis was described using cell-impermeant fluorescent dyes (Dale and Slack, 1987; Chalmers and Slack, 2000). However, fluoresence diminishes with cell division and animal growth.

Two sorts of permanent lineage tracing have been used in frogs, namely grafting and genetic marking using Cre/loxP. Embryonic grafting of GFP-labelled transgenic tissue into wild-type host was used to follow fate of neural crest (Gross and Hanken, 2005) or tissue type in regenerating tail (Gargioli and Slack, 2004; Lin et al., 2007). Tissue recombination of intestinal tissue layers in vitro between GFP transgenic and wild-type animals was used to identify source tissue of adult intestinal stem cells (Ishizuya-Oka et al., 2009). A special case of lineage tracing of transgenic cells in wild-type host involved introduction of GFP reporter construct by injection into tail spinal cord (Lin et al., 2007) and muscle (Nakajima and Yaoita, 2003) or by electroporation into tail muscle (Boorse et al., 2006) of premetamorphic tadpoles to follow fate during tail resorption or regeneration. These studies take advantage of Xenopus as an excellent system for embryological studies, but innaccessible cells and tissue types, such as internal organs in late stage tadpoles, require different techniques.

The Cre/loxP system used extensively in mice can genetically label any cell type in principle. Cre recombinase activity results in a permanent genetic change in a cell, thereby “marking” it and all its progeny to enable cell lineage “tracing” for the study of lineage relationships between cells at different stages of development. The Cre/loxP system labels a cell when Cre recombinase recognizes two loxP sites and deletes or inverts intervening DNA when the loxP sites are oriented in the same or opposite direction, respectively. More than ten Cre reporter lines have been characterized in mice (Branda and Dymecki, 2004). For example, the Rosa26-Reporter contains a floxed translation stop codon upstream of β-galactosidase (i.e., a stop codon flanked between two loxP sites such that Cre activity removes the stop codon allowing β-galactosidase expression) (Soriano,1999), or Z/EG mice where Cre deletes a floxed alkaline phosphotase upstream of GFP (Novak et al., 2000).

The Cre/loxP system has been shown to work as a proof of principle in frogs, but generally suitable transgenic Cre reporter lines are not currently available. Gargioli and Slack (2004) used a CRE reporter with floxed stop codons between the CMV promoter and GFP, but F0 tadpoles were used and no F1 transgenic lines were characterized (Gargioli and Slack, 2004). Ryffel et al. (2003) characterized a floxed CFP reporter that switched to YFP in the presence of CRE (Ryffel et al., 2003). However, CFP is visible in both CFP and YFP fluorescence filter sets confounding unambiguous analysis. Also, CFP and YFP are too similar for antibodies or in situ hybridization to reliably distinguish them. Waldner et al. (2006) characterized two additional CRE reporter lines, floxed GFP giving rise to DsRed2 or lacZ in the presence of CRE (Waldner et al., 2006). However, the GFP-DsRed2 line showed unexpected activation of both GFP and DsRed2 upon CRE activation. In addition, the lacZ in the GFP-lacZ line exhibited mosaic expression as well as ectopic activation in other cell types when crossed to a muscle-specific CRE inducer line. Also, lacZ may not be appropriate for all cases of lineage tracing because live animal observation is not possible. Furthermore, some tissues (such as the gut) have considerable endogenous β-galactosidase activity, which can cause background problems. Overall, these results and the experience of the mouse community suggests that in order to obtain a really useful transgenic model, it is critical to optimize and characterize a number of independent germ line transmitting transgenic lines – which was a goal of work presented in this brief report.

Our strategy was based on the constructs from Ryffel's lab (Ryffel et al., 2003), which we optimized by using CFP and DsRed2 to aovid problems associated with YFP and lacZ. Importantly, we characterized several independent lines and present them here as a resource to the frog community. In order to generate these transgenic lines, we used the newly developed meganuclease method of transgenesis in Xenopus laevis (Pan et al., 2006) and X. tropicalis (Ogino et al., 2006) which is easier to perform, gives higher survival after injection and similar transgenesis efficiency compared to the more laborious REMI technique (restriction enzyme-mediated integration) (Chesneau et al., 2008). Another benefit of the meganuclease method for the current project is the difference in number of insertion sites and copy number per insertion site, which are smaller for the meganuclease method (1-8 copies in 1-2 insertion sites) compared to the REMI method (1-8 copies in 1-6 insertion sites) (Kroll and Amaya, 1996; Offield et al., 2000; Sparrow et al., 2000; Chesneau et al., 2008; Ogino and Ochi, 2009). A low copy number and number of insertion sites (ideally one each in a euchromatic genomic region) is important to avoid complications from Cre activity removing or inverting genomic DNA between loxP sites present due to multiple insertions of the transgenesis construct. Few Xenopus papers have been published since the original meganuclease descriptions (Seo et al., 2007; Tazumi et al., 2008). Therefore we also tested serveral parameters of the meganuclease protocol in order to optimize the efficiency, the results of which should be generally useful to the Xenopus community.

Results and Discussion

Transgenesis using meganuclease methodology

The SceI meganuclease binds to and cleaves DNA sequences containing the 18-base pair site TAGGGATAACAGGGTAAT. This sequence is not found in the sequenced vertebrate genomes of frog, zebrafish, human, or mouse. DNA cleavage by SceI is asymmetric resulting in a smaller upstream portion and a larger downstream portion to which the enzyme may remain bound as a monomer after cleavage (Perrin et al., 1993; Beylot and Spassky, 2001). The reason why SceI endonuclease works in transgenesis and typical restriction enzymes do not is not known, but a possible explanation is that SceI may facilitate random integration of a transgene construct by binding to the cleavage products and protecting the foreign DNA from rapid degradation allowing longer time for DNA repair enzymes to work. SceI sites are generally placed on either side of the transgene of interest, and in a cell culture system, the orientation of SceI sites with respect to the intervening sequence affected the assay results (de Piedoue et al., 2005). To examine the importance of SceI site orientation in frog transgenesis, we created a double promoter construct where a ubiquitously expressed CMV:GFP cassette was “outside” of the SceI sites (oriented away from each other) and eye-specific CRY:DsRed1 was “inside” (Fig. 1A). Transgenesis with this construct resulted in tadpoles with various combinations of red eyes and green bodies (Fig. 2A, Table 1 row 1), clearly indicating that SceI sites facing the transgene is not a requirement for integration. Multiple integrations are common in REMI procedure where co-injection of two plasmids resulted in 80% of transgenic tadpoles containing both plasmids (Marsh-Armstrong et al., 1999) and would not be unexpected with SceI. In fact, a full transgenic will occasionally have different intensity fluoresence on the left and right sides suggesting independent integrations at the two cell stage (data not shown). However, SceI site orientation with respect to the transgene may have affected integration efficiency of CMV:GFP compared to CRY:DsRed1 because in no case was there a green body lacking red-eyes. In any case, subsequent constructs have the downstream portion of the SceI sites oriented towards the transgene to increase integration efficiency.

Figure 1
Constructs used for transgenesis. Gray arrows represent 18 base pair SceI recognition sequence with arrowhead at larger downstream cleavage product. In pDR>CG<-SceI, SceI will remain bound to the portion of the plasmid containing CRY:DsRed1 ...
Figure 2
Exemplar tadpole fluorescence patterns. Top: Tadpole injected with pDR>CG<SceI is fully transgenic for CRY:DsRed1 cassette and half transgenic for CMV:GFP cassette. See text for alternate possibilities. Bottom: Tadpole fully transgenic ...
Table 1
Transgenesis Conditions and Results.

Because DNA quantity has a major effect on tadpole survival and transgenesis efficiency (Ogino et al., 2006), we examined these effects using two transgenesis constructs pDRCG-SceI and pDPCG-SceI, which differ only in the eye color marker for transgenesis (Fig. 1B,C). pDPCG-SceI has two GFP genes, one controlled by the ubiquitous promober CMV and the other by the lens-specific promoter gamma-crystallin. GFP expression from CMV in the eyes is weaker compared to the gamma-crystallin promoter (unpubl. data), but distinguishing them is not a requirement for our purpose here. For pDRCG-SceI, we injected 40 vs. 80 pg per zygote and found reduced tadpole survival at stage NF45 at the higher DNA quantity: 95% survival (n = 122 embryos) for uninjected, 70% (n = 141) for 40 pg, and 46% (n = 128) for 80 pg. For pDPCG-SceI, we observed a similar pattern with the higher DNA amount (60 pg) reducing survival: 89% (n = 109) for uninjected, 87% (n = 107) for 60 pg, and 61% (n = 100) for 40pg. After two weeks of development, we scored transgenesis efficiency in the tadpoles (Table 1, rows 2-5). As previously reported (Ogino et al., 2006; Pan et al., 2006), we observed a high rate of transgene integration into one cell of the two-cell stage (“half transgenics”). The higher 80 pg did not increase the percentage of transgenic embryos with consistent transgene expression but, rather resulted in more embryos being catagorized as “Other” because of mosaic expression patterns, perhaps due to episomal expression (Table 1, compare rows 2 and 3). The 60 pg injections resulted in higher transgenesis efficiency compared to 40 pg and appears best overall, suggesting that DNA amount per embryo results in a trade-off between mortality and DNA integration efficiency (Table 1, rows 4 and 5). Fluorescence from DsRed1 protein was delayed by at least two days relative to when the crystallin promoter is known to be expressed, and often only a streak of red was observed in the eyes. This delay was probably owing to the longer maturataion time of this protein, and thus DsRed1 is regarded as inferior to GFP3 as a transgenesis marker.

Because a significant portion of the transgenic animals are half transgenic, we tested whether injecting during the first half of the first cell cycle improves the efficiency of production of full transgenics. At the same time, we tested whether buffer concentration (1× vs. 0.5×) affects transgenesis efficiency. Injecting early in the cell division increased the frequency of full and half transgenics (26% and 47% in the first 30′ vs. 17% and 31% in the second 30′) (Table 1, rows 6 and 7). The 0.5× buffer concentration improved the transgenesis efficiency (56% in 0.5× vs 36% in 1×) (Table 1, rows 8 and 9), unlike the previous report where buffer concentration made little difference (Ogino et al., 2006). Additional data are required to explain this discrepancy, but the available data attest to the robustness of the method to readily produce large numbers of transgenic tapdoles. These data also suggest that injection within the first 30 minutes of fertilization improves the chances that the transgene integrates into the genome.

We next verified that the meganuclease method also works well with the heat-shock inducible promotoer using the construct, pDRHG-SceI (Fig. 1D) (Fu et al., 2002). This construct still had the less reliable CRY:DsRed1 transgenesis marker, so we randomly selected 23 of 36 tadpoles that underwent the meganuclease procedure without regard for eye color but lacked green in the body and heat shocked them for two days (Fu et al., 2002). The 13 non-heat-shocked tadpoles still lacked green, but 52% (12 of 23) in the heat shock group had half or full green bodies indicating heat-shock inducibility using this method (Table 1, row 10). Of the heat-shocked tadpoles, a majority gave the expected correlation of red eyes with green body (full and half transgenics, Table 1 Row 10), but three tadpoles had red eyes and no green in the body after heat shock, suggesting integration site variation in transgene expressibility.

Production and testing of CRE reporter lines

We modified the orignial plasmid pCLFY (Ryffel et al., 2003) by including the SceI sites and changing the fluorophores. We changed the fluorophores because CFP is visible in the most common CFP and GFP filter sets, whereas YFP is visible only in the GFP filter set (Ryffel et al., 2003; Waldner et al., 2006). Thus, fluorescence in the CFP filter set would prove presence of CFP, but fluorescence in the GFP filter set could be CFP, YFP, or both. Thus, we replaced YFP with DsRed2 (matures faster than DsRed1 according to the manufacturer) to avoid fluorophore ambiguity. We performed meganuclease with the modified plasmid pCLFR-SceI (Fig. 1E) or pCLFR-SceI and Cre mRNA. Tadpoles injected with only pCLFR-SceI resulted in the expected proportions of full and half transgenics (Table 1, row 11), and importantly had no DsRed2 expression. Surprisingly, only 30% of the full transgenics and 50% of the half transgenics expressed DsRed2 in the animals also receiving Cre mRNA (Fig. 3, Table 1, row 12). This result suggests variability in access to loxP sites on pCLFR-SceI likely due to insertion site variation and indicates the need to characterize founders.

Figure 3
Cre activity in pCLFR-SceI in F0 transgenic tadpole. Tadpole subjected to meganuclease injection followed by Cre mRNA injection at the one cell stage is half transgenic for pCLFR-SceI as visualized in the CFP filter set. Red fluorescence in the RFP filter ...

To develop a high expression, Cre-sensitive pCLFR-SceI reporter line, the strongest blue F0 tadpoles were reared to adulthood and outcrossed to wild type animals to check for germ line transmission. We tested five independant founders for transgene expression levels and Cre-sensitivity in their F1 progeny. Germline transmission frequency was 50% or less, such that a single insertion site and/or epigenetic effects, such as transgene silencing in some of the offspring, could account for the transmission frequencies (Fig. 4, Table 2). Mosaicism in the germ line seems less likely to accout for the low transmission frequency because the founders were uniformly blue throughout the body. Cre mRNA was injected to test for recombination ability, and offspring from all but one founder changed from blue to red (Fig. 5A, Table 2). The exception (Male #3), which remains unexplained, had no blue offspring, but when injected with Cre, the offspring became strongly blue with no red. The multiple matings indicated in Table 2 show similar frequency of germline transmission for Male #5 and Female #1. For Male #1, the two different transmission frequencies could be an artifact of the low sample size for the second mating or possible silencing of transgene expression in the offspring dependent on genetic background of mating partners.

Figure 4
F1 offspring of pCLFR-SceI founder. Brightfield (top), blue fluorescence (middle), and red fluorescence (bottom) showing transgenic and non-transgenic siblings from Male #4. No red fluorescence was seen in F1 offspring in the absence of Cre activity.
Figure 5
Lineage tracing via Cre mRNA injection into pCLFR-SceI transgenic embryos. Cre mRNA was injected into one cell of two-cell stage embryos (A) or the A1 blastomeres of the 32-cell stage embryo (B). (A) Brightfield, CFP, and RFP images show half of the body ...
Table 2
Germline transmission and Cre-sensivity of pCLFR-SceI founders.

Cre activity on the transgene results in a permanent genetic change in that cell. Because Cre mRNA can be injected into blastomeres or expressed tissue-specifcally by developmentally regulated promoters, subsets of cell populations can be followed indefinitely throughout development. We tested the ability to mark a defined cell lineage, A1 blastomeres, which give rise to anterior structures, mostly the brain and epidermis and to a much lesser extent spinal cord and head mesenchyme (Fig. 5B)(Dale and Slack, 1987). This feature of permanance is an advantage compared to injecting lineage tracing dyes which get dilluted with each cell division during development. Also, transgenic expression of Cre in a pCLFR-SceI background was examined by mixing a SceI digest of pCLFR-SceI with pCSCRE2 (Fig. 1F). This co-injection procedure resulted in animals transgenic for pCLFR-SceI and non-integrated mosaic expression of Cre. Only when both pCLFR-SceI and pCSCRE2 were co-injected were red cells observed (Fig. 6).

Figure 6
Transgenic expression of Cre in pCLFR-SceI induces blue to red conversion. Meganuclease transgenesis procedure was performed with co-injection of pCSCRE2 lacking SceI sites to allow mosaic expression of Cre. Brightfield image shows mid-section of tapole ...

In conclusion, we found the meganuclease method a robust procedure for production of transgenic frogs expressing fluorescent proteins. We used this procedure to make and characterize pCLFR-SceI transgenic lines that can serve as an improved reporter for Cre recombinase activity. The use of CFP and DsRed2 is advantageous over CFP and YFP for visual observation because they do not bleed into each other's filter set and for histological analysis because they differ at the mRNA and protein levels so that distinction between them using in-situ hybridization and antibody detection is possible. Cre can be introduced via mRNA injection in the embryo to enable lineage tracing from blastomeres beyond early organogenesis to the feeding tadpole through metamorphosis to adulthood. Furthermore, expression of CRE using tissue-specific promoters will enable detailed fate mapping for all cell-types for which transgenic promoters are developed. We have 15-20 F1 adults from each pCLFR-SceI transgenic line, and these lines are freely available to the frog community.

Experimental Procedures

Plasmid Construction

The transgenesis plasmid pDR>CG<-SceI was made by PCR amplification using the primers DRB134 5′ GGGGGTCGACATTACCCTGTTATCCCTACATAGCCAATTCAAT-ATGGCGTAT and DRB135 5′ GGGGGCGGCCGCATTACCCTGTTATCCCTAGAAT-TAAAAAACCTCCCACACCTC on the template pDRCG (gift from L. Fu and Y.-B. Shi) and then cloning the SalI/NotI-digested PCR product back into pDRCG digested with the same enzymes. To make pDRHG-SceI, the primers I-SceI-HSP-F 5′> AATGTCGA-CTAGGGATAACAGGGTAATGGTATCGATAAGCTTCGAGAAAGCTCG and I-SceI-CrySV40-R 5′ AATACGCGTTAGGGATAACAGGGTAATTATGACCATGATTACGC-CAAGCGCGCG were used on the template pDRHG (gift from L. Fu and Y.-B. Shi). The PCR product was digested with SalI and MluI and inserted into pDRHG digested with SalI and BssHII. To make pDRCG-SceI, the primers DRB132 5′ GGGGGTCGACTAGG-GTAACAGGGTAATCATAGCCAATTCAATATGGCGTAT and I-SceI-CrySV40-R were used on the template pDRCG. The PCR product was digested with SalI and MluI and inserted into pDRCG digested with SalI and BssHII. For pDPCG-SceI, the CRY:GFP3 cassette from pDPHG (gift from L. Fu and Y.-B. Shi) was excised using SphI and SpeI and inserted into pDRCG-SceI digested with the same enzymes. The plasmids pCLFY and pCSCRE2 were gifts (C. Walden and G. Ryffel). A DsRed2-SV40 polyA fragment amplified by PCR from DsRed2-N1 (Clontech) using primers DRB84 5′ CATCATCCCG-GGACCGGTCGCCACCATGGCCTCCTCCGA and DRB85 5′ CATCATCCGCGGGCG-GCCGCGCAGTGAAAAAAATGCTTTAT was cloned into SmaI and SacII sites of pCLFY to make pCLFR. The HindIII(blunt) - BssHII fragment from pCLFR was cloned into the AgeI(blunt) - BssHII sites of pDPCG-SceI to make pCLFR-SceI. A CRE recombinase fragment amplified by PCR from pCSCRE2 using DRB192 5′ CATCATGAATTCATGTC-CAATTTACTGACCGTACACC and DRB193 5′ CATCATGAATTCCTATAGTTCTA-GAGAACCATCGCCAT was cloned into the EcoRI site of pSP64RI (gift from S. Sato) to make pSP64-CRE for mRNA injections. All clones made using PCR were sequence verified.

Transgenesis, mRNA injections, transgene expression

Injections and SceI reaction conditions were based on the original descriptions (Ogino et al., 2006; Pan et al., 2006). The SceI reaction (200 ng DNA, 2.3 μL SceI buffer, 2.3 μL 10× BSA, 2 μL SceI in 23 μL of total volume of the reaction mixture) was incubated at 37C for 40 min. then injected into dejellied zygotes at room temperature, resulting in 2×10-3 U of SceI and 40 pg of DNA per embryo with a 4-10 nL injection using NanoJect injection apparatus (Drummond) or Picospritzer III (Parker Hannifin Corp). Reaction conditions, when altered, are noted in Table 1. Embryos were cultured at 18C and sorted to remove dead or dying embryos 1-2 times per day. Feeding tadpoles were reared at 26-28C for observation and founders were returned to 18C for breeding after sexual maturity after 12-18 mo. SceI was treated like any other restriction enzyme, and no special storage of SceI was done. Specifically, we stored SceI at -20C without aliquoting and kept the enzyme on ice during use. In our hands, SceI was stable under these conditions at least one year of frequent use. For testing Cre sensitivity, Cre mRNA (Ambion mMessage mMachine) was injected at the 1-2 cell stage (200pg/cell) in F1 embryos or subsequent to meganuclease injections. For blastomere lineage tracing, Cre mRNA was injected at the 16-32 cell stage (50pg/cell) in F1 embryos. Transgene expression was observed using a Leica fluorescence dissection microscope with CFP, GFP2, and RFP filter sets.

Acknowledgments

We thank L. Fu, Y.-B. Shi, C. Waldner, and G. Ryffel for gifts of plasmids. Funding came from NIH DK070858 to AMZ.

Grant sponsor, Grant number: NIH DK070858 to AMZ

References Cited

  • Beylot B, Spassky A. Chemical probing shows that the intron-encoded endonuclease I-SceI distorts DNA through binding in monomeric form to its homing site. J Biol Chem. 2001;276:25243–25253. [PubMed]
  • Boorse GC, Kholdani CA, Seasholtz AF, Denver RJ. Corticotropin-releasing factor is cytoprotective in xenopus tadpole tail: Coordination of ligand, receptor, and binding protein in tail muscle cell survival. Endocrinology. 2006;147:1498–1507. [PubMed]
  • Branda CS, Dymecki SM. Talking about a revolution: The impact of site-specific recombinases on genetic analyses in mice. Dev Cell. 2004;6:7–28. [PubMed]
  • Chalmers AD, Slack JM. The xenopus tadpole gut: Fate maps and morphogenetic movements. Development. 2000;127:381–392. [PubMed]
  • Chesneau A, Sachs LM, Chai N, Chen Y, Du Pasquier L, Loeber J, Pollet N, Reilly M, Weeks DL, Bronchain OJ. Transgenesis procedures in xenopus. Biol Cell. 2008;100:503–521. [PMC free article] [PubMed]
  • Dale L, Slack JM. Fate map for the 32-cell stage of xenopus laevis. Development. 1987;99:527–551. [PubMed]
  • de Piedoue G, Maurisse R, Kuzniak I, Lopez B, Perrin A, Negre O, Leboulch P, Feugeas JP. Improving gene replacement by intracellular formation of linear homologous DNA. J Gene Med. 2005;7:649–656. [PubMed]
  • Fu L, Buchholz D, Shi YB. Novel double promoter approach for identification of transgenic animals: A tool for in vivo analysis of gene function and development of gene-based therapies. Mol Reprod Dev. 2002;62:470–476. [PubMed]
  • Gargioli C, Slack JM. Cell lineage tracing during xenopus tail regeneration. Development. 2004;131:2669–2679. [PubMed]
  • Gross JB, Hanken J. Cranial neural crest contributes to the bony skull vault in adult xenopus laevis: Insights from cell labeling studies. J Exp Zoolog B Mol Dev Evol. 2005;304:169–176. [PubMed]
  • Ishizuya-Oka A, Hasebe T, Buchholz DR, Kajita M, Fu L, Shi Y. The origin of the adult intestinal stem cells induced by thyroid hormone in xenopus laevis. FASEB J. 2009 in press. [PubMed]
  • Kroll KL, Amaya E. Transgenic xenopus embryos from sperm nuclear transplantations reveal FGF signaling requirements during gastrulation. Development. 1996;122:3173–3183. [PubMed]
  • Lin G, Chen Y, Slack JM. Regeneration of neural crest derivatives in the xenopus tadpole tail. BMC Dev Biol. 2007;7:56. [PMC free article] [PubMed]
  • Marsh-Armstrong N, Huang H, Berry DL, Brown DD. Germ-line transmission of transgenes in xenopus laevis. Proc Natl Acad Sci U S A. 1999;96:14389–14393. [PubMed]
  • Nakajima K, Yaoita Y. Dual mechanisms governing muscle cell death in tadpole tail during amphibian metamorphosis. Dev Dyn. 2003;227:246–255. [PubMed]
  • Novak A, Guo C, Yang W, Nagy A, Lobe CG. Z/EG, a double reporter mouse line that expresses enhanced green fluorescent protein upon cre-mediated excision. Genesis. 2000;28:147–155. [PubMed]
  • Offield MF, Hirsch N, Grainger RM. The development of xenopus tropicalis transgenic lines and their use in studying lens developmental timing in living embryos. Development. 2000;127:1789–1797. [PubMed]
  • Ogino H, McConnell WB, Grainger RM. Highly efficient transgenesis in xenopus tropicalis using I-SceI meganuclease. Mech Dev. 2006;123:103–113. [PubMed]
  • Ogino H, Ochi H. Resources and transgenesis techniques for functional genomics in xenopus. Dev Growth Differ. 2009;51:387–401. [PubMed]
  • Pan FC, Chen Y, Loeber J, Henningfeld K, Pieler T. I-SceI meganuclease-mediated transgenesis in xenopus. Dev Dyn. 2006;235:247–252. [PubMed]
  • Perrin A, Buckle M, Dujon B. Asymmetrical recognition and activity of the I-SceI endonuclease on its site and on intron-exon junctions. EMBO J. 1993;12:2939–2947. [PubMed]
  • Ryffel GU, Werdien D, Turan G, Gerhards A, Goosses S, Senkel S. Tagging muscle cell lineages in development and tail regeneration using cre recombinase in transgenic xenopus. Nucleic Acids Res. 2003;31:e44. [PMC free article] [PubMed]
  • Seo S, Lim JW, Yellajoshyula D, Chang LW, Kroll KL. Neurogenin and NeuroD direct transcriptional targets and their regulatory enhancers. EMBO J. 2007;26:5093–5108. [PubMed]
  • Soriano P. Generalized lacZ expression with the ROSA26 cre reporter strain. Nat Genet. 1999;21:70–71. [PubMed]
  • Sparrow DB, Latinkic B, Mohun TJ. A simplified method of generating transgenic xenopus. Nucleic Acids Res. 2000;28:E12. [PMC free article] [PubMed]
  • Stern CD, Fraser SE. Tracing the lineage of tracing cell lineages. Nat Cell Biol. 2001;3:E216–8. [PubMed]
  • Tazumi S, Yabe S, Yokoyama J, Aihara Y, Uchiyama H. PMesogenin1 and 2 function directly downstream of Xtbx6 in xenopus somitogenesis and myogenesis. Dev Dyn. 2008;237:3749–3761. [PubMed]
  • Waldner C, Sakamaki K, Ueno N, Turan G, Ryffel GU. Transgenic xenopus laevis strain expressing cre recombinase in muscle cells. Dev Dyn. 2006;235:2220–2228. [PubMed]