PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Exp Hematol. Author manuscript; available in PMC 2010 June 1.
Published in final edited form as:
PMCID: PMC2778316
NIHMSID: NIHMS98924

Factor VIII-Pulsed Dendritic Cells Reduce Anti-F.VIII Antibody Formation in the Hemophilia A Mouse Model

Margaret V. Ragni, M.D., M.P.H.,1,2 Wenhu Wu, M.D.,3 Xiaoyan Liang, M.D, Ph.D,3 Ching-Chuan Hsieh, M.D.,4 Andrea Cortese-Hassett, PhD.,5 and Lina Lu, M.D.3,*

Abstract

Objective

Hemophilia inhibitor formation is a T-cell dependent immune response to infused factor VIII (F.VIII). As immature dendritic cells (DCre) regulate immune response and promote tolerance, we evaluated F.VIII-pulsed DCre, propagated from bone marrow in the presence of GM-CSF and TGFβ, in achieving F.VIII tolerance.

Methods

The effects of intravenous F.VIII-pulsed DCre in C57BL/6 hemophilia A mice were determined by total F.VIII inhibitory antibodies, T cell proliferation, thymidine uptake, cytokine profile, and surface molecule expression.

Results

After tail vein injection of 2.5 U recombinant F.VIII (rF.VIII) on day 0, 2, and 4, anti-F.VIII antibody peaked on day 6, and increased further on day 17 following rF.VIII re-challenge on day 12, 14, and 16, with increased T cell proliferative response to in vitro F.VIII. When mice were pretreated with 2×106 F.VIII-pulsed immature DCre (deficient NF-kB nuclear protein binding, low CD80, low CD86, high IL-10 phenotype) 7 days before rF.VIII challenge, anti-F.VIII was reduced on day 6 and on day 8, 0.1±0.0 BU/ml (Bethesda units/ml) vs. control PBS-treated hemophilia A mice, 2.0±0.1 BU/ml, p<0.01. Re-challenge with rF.VIII on day 12 produced no increase in anti-F.VIII antibody response. This was associated with high serum IL-10 and low IL-2 levels by ELISA, and splenic T cell hyporesponsivess to F.VIII, with IL-10 production, high FoxP3 expression by qT-PCR, and T regulatory cell expansion, confirmed in OVA-TCR transgenic mice.

Conclusions

These findings suggest F.VIII-pulsed DCre reduce anti-F.VIII antibody formation in hemophilia A mice by induction of regulatory T cell-mediated hyporesponsiveness of T helper cells to F.VIII.

Keywords: Hemophilia, anti-F.VIII antibody, dendritic cells, regulatory T cells

Introduction

Hemophilia A is an X-linked bleeding disorder caused by deficiency of coagulation factor VIII (F.VIII), and characterized by spontaneous and traumatic bleeding. A major complication of hemophilia treatment is inhibitor formation, in which alloantibodies directed against infused factor VIII develop in up to 25% of hemophilia A patients after 9 or 10 factor VIII treatment exposures. The anti-F.VIII antibody interferes with clinical response to factor VIII infusion, resulting in significant morbidity and early mortality in affected patients [1,2]. Anti-F.VIII antibody formation is a T cell-dependent immune response [36], involving F.VIII peptide binding to HLA class II molecules, antigen presentation to CD4+ T cells, and recognition by the T cell receptor (TCR) [79]. Thus, there has been a growing interest in suppressing inhibitor formation by blocking F.VIII-specific T cell response.

Among professional antigen presenting cells that play a major role in immune response to foreign antigens are dendritic cells (DCs), which serve as initiators and regulators of immune response to antigen [1013]. DCs promote immune response to foreign antigens through costimulatory molecule signaling, production of immunostimulatory cytokines, and migration to regional lymphoid tissue to interact with T cells specifically responsive to the foreign antigen, once internalized from the periphery [10,11,13].

In contrast to mature or effector DC (DCe) which promote antigen-specific immunity, regulatory DC, DCre, exhibit low level co-stimulatory CD80, low CD86 expression, and IL-10 positive, IL-12 negative phenotype, and promote self tolerance [10,11]. Recently, FoxP3, a forkhead family transcription factor [12], was shown to be highly expressed by T regulatory cells [14,15] and linked to T cell suppression [15]. Indeed, the exploitation of immature dendritic cells to prevent transplant rejection [16] and diabetes [17] in animal models, has suggested the potential role of these cells in suppression of inhibitor formation in hemophilia. We, therefore, hypothesized that administration of F.VIII-pulsed DCre in the hemophilia A exon 16 knockout C57BL/6 mouse, a model which predictably develops anti-F.VIII antibodies after F.VIII injection [18,19], would reduce or prevent hemophilia anti-F.VIII antibody formation.

Materials and methods

Mice and reagents

Hemophilia A C57BL/6 exon 16 knockout mice (referred to as hemophilia A mice) [18], non-hemophilic mice, C57BL/6 (B6 mice), and ovalbumin (OVA)-specific T cell (OT-II) receptor transgenic (OT-II OVA-TCR Tg) mice, all 10–12 weeks old, were obtained from The Jackson Laboratory (Bar Harbor ME) and maintained in a specific pathogen-free facility at the University of Pittsburgh Medical Center. The protocol was approved by the Institutional Animal Care and Use Committee (IACUC), University of Pittsburgh. Granulocyte-macrophage colony stimulating factor (GM-CSF), TGF-β, and IL-4 were obtained from Schering Plough Research Institute (Kenilworth NJ). Full-length recombinant F.VIII (rF.VIII, Advate®), kindly provided by Baxter Bioscience, Inc. (Westlake Village CA), was injected into the tail vein of hemophilia A mice at a dose of 2.5 U per injection, a dose previously shown to induce anti-F.VIII antibody formation in 80% of hemophilia C57Bl/6 mice [46]. OVA 323–339 (ISQAVHAAHAEINEAGR) was kindly provided by Dr. Fen Lin, Case Western University (Cleveland OH). Plasma samples were obtained by tail vein. T cells were isolated from mouse spleen and enriched through a nylon wool column. Three to five hemophilia mice and three to five control mice were included in each experiment.

Dendritic cell (DC) propagation and purification

Bone marrow cells (BM) harvested from femurs of B6 mice or hemophilia A mice were cultured in 24-well plates (2×106/well) in RPMI-1640 media supplemented with antibiotics and 10% (vol/vol) fetal calf serum (FCS), referred to subsequently as complete medium, and GM-CSF+IL-4 or GM-CSF+TGF-β. Dendritic cells were selected and purified from the cultures, as previously described [16]. Thus, two dendritic cell (DC) populations were propagated, one of predominantly immature DC with immunoregulatory activities (DCre) and the other of conventional DC with immunoeffector activity (DCe). DCre were propagated from mouse bone marrow and cultured in RPMI-1640 containing GM-CSF (4 ng/ml) and TGF-β (0.2 ng/ml) for 5–7 days [20]. To derive rF.VIII-pulsed DCre, the DCre were then pulsed with rF.VIII 20 U/ml for 24 hr, a dose we determined to be optimal in T proliferation assays. Collection and purification procedures were as previously described [21]. For comparison, conventional DC, professional antigen presenting cells (DCe), were propagated from bone marrow in RPMI-1640 media supplemented with antibiotics and 10% vol/vol FCS containing GM-CSF (4 ng/ml) plus IL-4 (1,000 U/ml). To derive rF.VIII-pulsed DCe, the DCe were pulsed with rF.VIII 20 U/ml for 24 hr, as above [20].

T cell proliferative assays

Purified splenic T cells were assessed for proliferative response to factor VIII by 3H-thymidine incorporation in day 4 cultures. In this assay, T cells from hemophilia A mice treated with DCre or DCe (as described below) were incubated with rF.VIII and irradiated B6 spleen cells in vitro, and T cell proliferative responses were measured by thymidine uptake [20,22].

T cell labeling with CFSE and suppression assay

T cells (107/ml) were labeled with 1μM carboxyfluorescein diacetate succinimidyl ester (CFSE) (Molecular Probes, Eugene OR) for 10 minutes at 37°C, and washed before culture. The intensity of CFSE was determined via flow cytometric analysis. To determine the T regulatory cell inhibitory activity, T regulatory cells (Treg) were purified using a CD4+ CD25+ regulatory T cell kit (Miltenyi Biotec, Auburn CA), and were added into CFSE-labeled reporter T cells (105/well in 100μl), which were stimulated by anti-CD3 monoclonal antibody (mAb) (2 μg/ml) in the presence of antigen presenting cells (APC). In some experiments, purified spleen T cells from OVA-specific TCR transgenic (OT-II) mice were used as reporter T cells, which were re-stimulated by APC in the presence or absence of OVA peptide 323-339 (0.3μM × 3h). The suppressive effects of T regulatory cells were determined by CFSE dilution assay.

Flow cytometry

Expression of DC surface antigens was analyzed by cytofluorography, using an EPICS ELITE flow cytometer (Coulter, Hialeah FL). Cells were stained with primary hamster or rat monoclonal antibodies directed against CD11c, CD40, CD80, CD86 (BD PharMingen, San Diego CA), followed by FITC- or PE-conjugated goat anti-hamster or goat anti-rat IgG2a, as previously described [20,23].

To determine the effect of DCre on T regulatory cell expansion, DCe or DCre propagated from B6 mice bone marrow and co-cultured with splenic CD4+Tcells isolated from OVA-specific TCR transgenic (OT-II) T cells, in the absence or presence of OVA 323–339, were stained with monoclonal antibodies against CD4 (BD, Franklin Lakes NJ) and FoxP3 (eBioscience, San Diego CA), as previously described [24]. For in vivo studies, DC subsets were pulsed with OVA 323–339. After washing in PBS, 5×105 DC were injected subcutaneously into the footpads of naïve B6 mice, followed immediately thereafter by tail vein injection of 1×106 splenic T cells from OVA transgenic (OVA Tg, OT-II) mice, isolated with anti-CD4-conjugated magnetic beads (Miltenyi Biotec, Auburn CA). Three days later, mice were sacrificed and cells from draining popliteal lymph nodes were harvested and stained with monoclonal antibodies to FoxP3 and TCR Vα2 (BD Biosciences, San Jose CA), as previously described [24].

Cytokine profile assays

Serum samples and supernatants from splenic T cells stimulated with rF.VIII were assayed for interleukin-10 (IL-10), interleukin-2 (IL-2), interferon-gamma (IFN-γ), and transforming growth factor beta (TGF-β) by enzyme linked immunosorbent assay (ELISA) kits (BioSource, Camarillo CA) [17].

Electrophoretic mobility shift assay (EMSA)

Electrophoretic mobility shift assay (EMSA) was performed using a commercially available kit (Promega, Madison WI) supplied with an NF-κB probe oligonucleotide (sense sequence: 5′AGTTGAGGGGACTTTCCCAGGC3′) end-labeled with γ-32P ATP (NEN, Boston MA). A 25-fold excess of unlabeled oligonucleotide was used as cold probe. Nuclear proteins (1μg) were loaded in each lane. NF-κB translocation in nuclear protein was measured by mobility shift, detected by running the mixture on a 4% acrylamide gel, with visualization of shifted bands by autoradiography [17].

Anti-F.VIII antibody assay

Anti-F.VIII antibody titer was determined by Bethesda assay [25]. This was carried out by incubating mouse plasma samples with 1.25 μg/ml recombinant human factor VIII in 0.1 mol/L carbonate-bicarbonate (pH 9.6).factor VIII, and measuring residual F.VIII by one-stage F.VIII activity, with one Bethesda unit/ml (BU/ml) defined as the amount of inhibitory activity producing 50% inhibition of F.VIII activity.

FOXP3 quantitative RT-PCR assay

FoxP3 was quantitated by real-time PCR (qT-PCR) in splenic T cells as previously described [14]. Total RNA was purified using TRIzol reagent: 1 μg aliquot of RNA was treated with deoxyribonuclease I (Invitrogen, Carlsbad, CA). The FoxP3 specific primers (forward: GGC CCT TCT CCA GGA CAG A, reverse: GGC ATG GGC ATC CAC AGT) and 18S rRNA control primers were used in quantitative real-time PCR with an ABI Prism 7500 machine (Applied Biosystems, Foster City CA). The cycle quantity was determined with a standard curve, and expression levels were normalized to 18S rRNA.

Statistical analysis

Results are expressed as mean ± S.E.M. Comparison of two means was by Student’s t test. Comparison of more than two means was by ANOVA, and Student-Newman-Keuls test. Significance was set at p<0.05.

Results

Hemophilia A mouse anti-F.VIII antibody model

Following injection of 2.5 U (0.2 μg) recombinant factor VIII (rF.VIII) into the tail vein of hemophilia A mice on days 0, 2, and 4, the anti-F.VIII antibodies peaked on day 6, 9.8±2.2 BU/ml vs. 0±0 BU/ml pre-treatment, p<0.01 (Figure 1A). On re-challenge with 2.5 U rF.VIII intravenously on days 12, 14, and 16, there was a further increase in anti-F.VIII on day 16, 15.0±1.3 BU/ml, p<0.05, and on day 17, 24±0.2 BU/ml, p<0.01. Consistent with the previously recognized T cell-dependent antibody response, the development of anti-F.VIII antibody to rF.VIII treatment in vivo was associated with high level splenic T cell proliferation in response to rF.VIII stimulation in vitro, as measured by 3H-thymidine incorporation in T cell proliferation assay (Figure 1B). At all time points, in vitro proliferative response to rF.VIII by T cells from F.VIII-treated hemophilia A mice was significantly greater, p<0.01, than proliferative response by T cells from control PBS-treated hemophilia A mice (Figure 1B).

Figure 1A
Recombinant F.VIII induces F.VIII antibody inhibitor formation in the hemophilia A mouse
Figure 1B
Splenic T cells from hemophilia A mice show strong response to rF.VIII

Characterization of immature dendritic cells (DCre)

DCre propagated from hemophilia A mouse bone marrow with GM-CSF and TGFβ exhibited low level co-stimulatory molecules CD80 and CD86 (Figure 2A). By contrast, mature DCe, propagated from hemophilia A mouse bone marrow with GM-CSF+IL-4 exhibited high level co-stimulatory molecules, CD80 and CD86. Further, DCre also demonstrated deficient NF-κB binding activity in nuclear protein in gel shifting assay (Figure 2B), as compared with DCe, which demonstrated enhanced NF-κB binding (Figure 2B). These data indicate that TGF-β contributes to suppression of co-stimulatory molecule expression on DCre, which is associated with inhibition of NF-κB translocation in nuclear protein.

Figure 2A
Dendritic cells express low level of co-stimulatory molecules
Figure 2B
NF-κB binding activity in nuclear protein of DCre

rF.VIII-pulsed DCre reduce anti-F.VIII antibody in hemophilia A mice

To determine whether DCre regulate immune responses to F.VIII, 2×106 rF.VIII-pulsed DCre (20 IU/ml × 24 h) were injected by tail vein into hemophilia A mice 7 days before rF.VIII was given on day 0, 2, and 4. By day 6 (day 13 after DCre), there was a reduction in anti-F.VIII antibody, mean 2.0±0.1 BU/ml, (with 75% of the mice developing anti-F.VIII antibody) compared with control (PBS-treated) hemophilia A mice, 3.0±0.3 BU/ml (with 90% of the mice anti-F.VIII positive) and further reduction on day 8, mean 0.1±0.0 BU/ml (with 50% of the mice anti-F.VIII antibody free) vs. 2.0±0.1 BU/ml, in the control group (75% remaining anti-F.VIII antibody positive) both p<0.01 (Figure 3A). By contrast, high levels of anti-F.VIII antibody were detected in mice pretreated with rF.VIII-pulsed DCe, on day 6, mean 16.4±0.2 BU/ml (100% anti-F.VIII antibody positive), and on day 8, mean 11±0.5 BU/ml (75% anti-F.VIII antibody positive), as compared with control, each p<0.01. These data indicate that rF.VIII-pulsed DCre induce reduced anti-F.VIII immune responses in hemophilia mice. By contrast, administration of F.VIII-pulsed DCe markedly augmented anti-F.VIII immune responses.

Figure 3Figure 3Figure 3Figure 3
Figure 3A. Pretreatment of hemophilia A mice with rF.VIII-pulsed DCre inhibits anti-F.VIII antibody formation. Hemophilia A mice received 2×106 rF.VIII-pulsed DCre intravenously at day -7, followed by rF.VIII 2.5 U on day 0, 2, and 4. Blood was ...

Reduced T cell proliferation is associated with reduced anti-F.VIII antibody after DCre treatment

Re-challenge of DCre–treated mice with rF.VIII in vivo on day 12 resulted in no increase in the anti-F.VIII antibody by day 17 (data not shown), suggesting that rF.VIII-pulsed DCre induce hyporesponsiveness to in vivo F.VIII challenge (injection) in hemophilia A mice. To determine the mechanism of the reduced anti-F.VIII antibody response, we evaluated immunoregulatory activity of DCre by measuring T cell proliferative responses in T proliferation assay. In this assay, splenic T cells obtained from hemophilia mice 7 days after in vivo treatment with 2×106 rF.VIII-pulsed DCre (or DCe) were restimulated in vitro with and without rF.VIII (Figure 3B). Splenic T cells from rF.VIII-pulsed DCre-treated mice showed significantly lower proliferative responses to in vitro rF.VIII restimulation than did splenic T cells from rF.VIII-pulsed DCe-treated mice, p<0.01 (Figure 3B, right). Splenic T cells from control PBS-treated mice demonstrated low proliferative responses to in vitro r.FVIII restimulation (Figure 3B, right). In the absence of rF.VIII restimulation in vitro, the proliferative responses of T cells from all groups, including from rF.VIII-pulsed DCre-treated and r.FVIII-pulsed DCe-treated hemophilia mice, remained low (Figure 3B, left). These findings indicate that T cell proliferation in culture is antigen-dependent, and that administration of rF.VIII-pulsed DCre induces T cell hyporesponsiveness that is antigen (rF.VIII)-dependent.

Cytokine profile of T cells from mice treated in vivo with rF.VIII-pulsed DCre

The reduction in anti-F.VIII antibody formation in mice following treatment with rF.VIII-pulsed DCre was also associated with changes in the serum cytokine profile measured by ELISA. There were significantly higher serum IL-10 levels in rF.VIII-pulsed DCre-treated mice as compared with rF.VIII-pulsed DCe-treated mice or DCre-treated mice, both p<0.01 (Figure 3C). By comparison, no significant differences in IFN-γ, IL-2 or TGF-β levels between these groups were observed.

To further characterize the T cell differentiation induced by DC, the cytokine profile of T cells in response to F.VIII stimulation were analyzed. Splenic T cells from hemophilia A mice, 7 days after rF.VIII-pulsed-DCre or rF.VIII-pulsed-DCe or PBS treatment, were re-stimulated in vitro with rF.VIII and irradiated spleen cells as antigen presenting cells (APC). Cytokine profiles were analyzed on the T cell supernatants by ELISA. T cells from the rF.VIII-pulsed DCre-treated mice produced significantly higher IL-10 and lower IL-2 in T cell supernatants from the rF.VIII-pulsed DCre-treated mice, as compared with the rF.VIII-pulsed DCe treated group, p<0.01 (Figure 3D). These findings suggest that rF.VIII-pulsed-DCe and -DCre treatments promote differences in T cell differentiation in hemophilia A mice, and, possibly, that rF.VIII-pulsed DCre induce T regulatory cells.

FoxP3 expression increases in response to rF.VIII-pulsed DCre

Consistent with these findings, Foxp3 levels measured by real time PCR (qT-PCR) on RNA isolated from splenic T cells from rF.VIII-pulsed DCre-treated hemophilia A mice were significantly higher than from rF.VIII-pulsed DCe-treated mice, p<0.01, DCe-treated mice, p<0.001, or control PBS-treated mice, p<0.001 (Figure 3E).

Antigen-pulsed DCre preferentially promote T regulatory cell differentiation

To determine whether antigen-pulsed DCre preferentially promote antigen-specific T regulatory cell differentiation, in vitro and in vivo experiments were conducted on antigen-specific DCe and DCre, specifically with OVA peptide as antigen and splenic CD4+ T cells isolated from OVA-specific TCR transgenic mice (OT-II mice). In the in vitro experiments, DCe and DCre propagated from B6 mice bone marrow were cultured with splenic CD4+ T cells isolated from OT-II mice at 1:10 ratio DC:T cells, in the presence or absence of 0.3μM OVA 323–339. After 4 days, DCre presenting OVA peptide to OT-II T cells induced greater T regulatory cell expansion, by FoxP3+ and CD4+ double staining, than DCe, 12.4% vs.7.2% (Figure 3F). In the in vivo experiments, DCe and DCre from B6 mice were incubated with OVA 323–339, washed, and injected subcutaneously, at 5×105, into the footpads of naïve B6 mice, immediately followed by tail vein injection of 1×106 splenic CD4+ T cells from OT-II mice, identified with Vα2 mAb. Cells harvested 3–4 days later from draining popliteal lymph nodes were analyzed by flow cytometry. As can be seen in Figure 3G, more Vα2+T cells from OVA-pulsed DCre-treated mice were FoxP3+, than from OVA-pulsed DCe-treated mice, 9.0% vs. 2.7%., or from control PBS-treated mice, 0.8%, indicating OVA-pulsed DCre administration favors expansion of T regulatory cells in antigen-specific CD4+ T cells.

The immunoregulatory activity of T regulatory cells elicited by DCre was further determined in a suppressive assay in vitro. T regulatory cells isolated from 4 day culture of OT-II T cells and OVA 323–339-pulsed DCre were added into CFSE-labeled OT-II T cells in the presence or absence of OVA 323–339. As shown in Figure 3H, the isolated CD4+CD25+ T regulatory cells effectively suppressed proliferative responses of OT-II T cells to OVA peptide stimulation, with decreasing effect associated with decreasing T regulatory cell dose. These findings suggest that T regulatory T cells elicited by DCre are capable of inhibiting T cell response, and in a dose-dependent manner.

To verify whether the inhibitory activity of DCre-expanded T regulatory cells was antigen-specific, the OT-II T regulatory T cells were added into CFSE-labeled B6 splenic T cells in the presence of anti-CD3 mAb and irradiated B6 spleen cells (providing co-stimulation). As noted in Figure 3I, the OVA-pulsed CDre expanded T regulatory cells demonstrated comparable inhibitory effect on T cell proliferation induced by anti-CD3 mAb, indicating the inhibitory effect is not antigen specific.

Discussion

The role of CD4+ T cell activation in immune response to F.VIII, which was initially recognized in AIDS patients with CD4+ T cell counts below 200/μl whose anti-F.VIII antibody disappeared and response to exogenous F.VIII was restored [3], has been confirmed in the hemophilia A mouse model [4,5]. Despite this, suppression of anti-F.VIII antibody formation remains an unsolved clinical challenge, with significant morbidity and limited treatment options in those affected. The findings of this study demonstrate that manipulation of the immune response may suppress anti-F.VIII inhibitor antibody formation. Specifically, we demonstrate that immature dendritic cells (DCre), pulsed with rF.VIII, are effective in suppressing anti-F.VIII antibody formation in the hemophilia A mouse model when given prior to factor VIII challenge. The approach used in this study was adapted from the successful prevention of transplant rejection [16] and diabetes [17] in animal models, specifically by induction of T cell hyporesponsiveness to antigen by immature dendritic cells. In this study, dendritic cells were modified to have an immature phenotype (low expression of co-stimulatory molecules and high production of IL-10), and then pulsed with rF.VIII. Injection of these rF.VIII-pulsed DCre into hemophilia A mice resulted in reduced anti-F.VIII antibody levels following in vivo rF.VIII challenge (injection). Concomitant with the reduction in anti-F.VIII antibodies, splenic T cells from these mice demonstrated reduced proliferative responses to rF.VIII in vitro, and the reduced anti-F.VIII antibody response persisted after in vivo re-challenge with rF.VIII. The increase in IL-10 production observed in mouse T cell supernatants following rF.VIII-pulsed DCre is consistent with the immunoregulatory role of the IL-10 gene in immune response and antibody production in autoimmune disorders [26], as well as the recent identification of polymorphisms in and near the IL-10 gene associated with hemophilia inhibitor development in mice [27] and humans [28]. Whether IL-10 production is a marker for inhibitor antibody formation in humans, however, remains unknown.

The mechanism by which DCre prevent the antibody response to rF.VIII, although not proven, appears to involve induction of hyporesponsiveness to rF.VIII arising from increased expression of FoxP3, a mediator of T cell suppression. Specifically, the observed serum cytokine profile pattern in DCre-treated mice is consistent with suppression of T cell-dependent immune response and induction of rF.VIII unresponsiveness. The concomitant high level FoxP3 expression by splenic T cells suggests that the reduction in anti-F.VIII antibody levels and T cell hyporesponsiveness to factor VIII arises as a result of expansion of T regulatory cells by DCre, consistent with the recently recognized role of FoxP3 in T cell immunosuppression [11,14,15]. Further, this response appears to be antigen-specific, as FoxP3 staining identified that while both DCre and DCe are capable of presenting antigen that leads to OT-II proliferation, DCre are more potent antigen-specific T regulatory inducers. However, the inhibitory activity of T regulatory cells expanded by antigen-pulsed DCre is antigen non-specific, since the T regulatory cells expanded by OVA-pulsed DCre are capable of suppressing the proliferation of both OVA-activated OT-II CD4+ and anti-CD3 mAb-activated CD4+ T cells.

There are some limitations to this study. First, even though a smaller proportion of rF.VIII-pulsed DCre-treated mice developed anti-F.VIII antibody and anti-F.VIII antibody titers were reduced, it is important to note that not all hemophilia mice receiving rF.VIII-pulsed DCre showed complete suppression of anti-F.VIII antibody formation. This could suggest suboptimal inhibition of immune reactivity due to an inadequate number of injected tolerogenic dendritic cells (DCre), or limited persistence of these immature cells in tissues to maintain the immune response. While immature DC propagated from mouse BM with GM-CSF and TFG-β are not stable, they may mature under the condition of inflammation. Similar numbers of DCs with immature phenotype, propagated from BM with oligodeoxyribonucleotides (ODNs) which contain binding sites for NF-κB, have been successfully used in other immunologic diseases [20]. These NF-κB decoy-propagated DC (NF-κB DC) are stable immature DC, more resistant to inflammation-induced maturation due to blockage of the NF-κB signaling pathway. It has been shown that administration of NF-κB DC more effectively prolongs heart allograft survival [20]. Whether decoys may improve the response rate in hemophilia mice is currently under study. Alternatively, an inadequate dose of rF.VIII for pulsing dendritic cells might also play a role in failure to suppress anti-F.VIII antibodies in all mice. It should be noted, though, that the rF.VIII concentration used to incubate DCs was physiologic. Secondly, although F.VIII specific CD4+ T cells were not available to determine if the increase in T regulatory cell expansion was antigen specific, we were able to study this question using OVA 323–339 peptide as specific antigen and OVA-specific CD4+ T cells (OT-II), which could be identified by Vα2+ monoclonal antibody. Specifically, the greater FoxP3+ Vα2+ levels in the antigen (OVA)-pulsed DCre group, as compared with the OVA-pulsed DCe group, both in vitro and in vivo, suggests but does not prove that increased FoxP3 mRNA levels in the hemophilia A mouse model treated with rF.VIII-pulsed DCre are due to T regulatory cell expansion, which suppressed anti-F.VIII inhibitor antibody response.

Whether the use of modified dendritic cells to reduce anti-F.VIII antibody response in the hemophilia A mouse model equates to suppression of anti-F.VIII antibody in humans with hemophilia remains unknown. Specifically, we evaluated DCre in the prevention of anti-F.VIII response, but not in the suppression of an already existing anti-F.VIII response, e.g. immune tolerance, nor the duration of such a response. Future studies will be needed to address these issues as well as to determine if findings in mice apply to humans, given the immunologic differences anticipated in scale up from mice to men, as recognized in hemophilia gene transfer [29]. The recent successful induction of transplant tolerance by immature DC in mouse transplant models, is currently being studied in larger animal models [30], including rhesus monkeys; and a clinical trial of immature DC, shown to be successful in the treatment of diabetes in mouse models has been initiated in patients with type 1 diabetes [31]. Hopefully, these preliminary studies of DC immunotherapy will provide preliminary insights into the application of this strategy in the prevention and suppression of anti-F.VIII antibodies in individuals with hemophilia.

Acknowledgments

This study was supported by National Institutes of Health Grant NHLBI R01 HL 61937 (MVR), and by Baxter Bioscience Grant P07-000411 (LL, MVR). The work was presented, in part, as an oral abstract at the American Society of Hematology Meeting, December 12, 2005, Atlanta GA and as a poster session at the Federation Clinical Immunology Societies (FOCIS) Meeting, June 4, 2006, San Francisco CA.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

1. Astermark J. Basic aspects of inhibitors to factor VIII and IX and the influence of non-genetic risk factors. Haemophilia. 2006;12(Suppl 6):8–14. [PubMed]
2. Ehrenforth S, Kruetz W, Sharrer I, et al. Incidence of development of FVIII and factor IX inhibitors in hemophiliacs. Lancet. 1992;339:594–598. [PubMed]
3. Ragni MV, Bontempo FA, Lewis JH. Disappearance of inhibitor to factor VIII in HIV-infected hemophiliacs with progression to AIDS, severe ARC. Transfusion. 1989;29:447–449. [PubMed]
4. Hoyer LW, Qian J. Characterization of the immune response to factor VIII using hemophilia A mice. Haemotologica. 2000;85:100–102. [PubMed]
5. Qian J, Collins M, Sharpe AH, et al. Prevention and treatment of factor VIII inhibitors in murine hemophilia A. Blood. 2000;95:1324–1329. [PubMed]
6. Qian J, Borovok M, Bi L, Kazazian HH, Hoyer LW. Inhibitor antibody development and T cell response to human factor VIII in murine hemophilia A. Thromb Haemost. 1999;81:240–244. [PubMed]
7. Mukovozov I, Sablijc T, Hortelano G, Ofosu FA. Factors that contribute to the immunogenicity of therapeutic recombinant human proteins. Thromb Haemost. 2008;99:874–882. [PubMed]
8. Reisner JM, Clark A, Levin L. Immunogenetics of the human immune response to factor VIII. Adv Exp Biol Med. 1993;386:65–78. [PubMed]
9. Hu G, Guo D, Key NS, Conti-Fine BM. Cytokine production by CD4+ T cells specific for coagulation factor VIII in healthy subjects and haemophilia A patients. Thromb Haemost. 2007;97:788–794. [PubMed]
10. Powrie F, Maloy KJ. Immunology: Regulating the regulators. Science. 2003;299:1030–1031. [PubMed]
11. Jiang H, Chess L. Regulation of immune responses by T cells. N Engl J Med. 2006;354:1166–1176. [PubMed]
12. Hori S, Nomura T, Sakaguchi S. Control of regulatory T cell development by the transcription factor Foxp3. Science. 2003;299:1057–1061. [PubMed]
13. Lu L, Thomson AW. Manipulation of dendritic cells for tolerance induction in transplantation and autoimmune disease. Transplantation. 2002;73(Suppl 1):S19–S22. [PubMed]
14. Fontenot JD, Rudensky AY. A well adapted regulatory contrivance: regulatory T cell development and the forkhead family transcription factor Foxp3. Nat Immunol. 2005;6:331–337. [PubMed]
15. Fontenot JD, Gavin MA, Rudensky AY. Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat Immunol. 2003;4:330–336. [PubMed]
16. Macedoo C, Popescu I, Abu-Elmagd K, et al. Augmentation of type 1 polarizing ability of monocyte-derived dendritic cells from chronically immunosuppressed organ transplant recipients. Transplantation. 2005;79:451–459. [PubMed]
17. Ma L, Qian S, Liang X, Wang L, et al. Prevention of diabetes in NOD mice by administration of dendritic cells deficient in nuclear transcription factor-κB activity. Diabetes. 2003;52:1976–1985. [PubMed]
18. Bi L, Lawler AM, Antonarakis SE, et al. Targeted disruption of the mouse factor VIII gene produces a model of hemophilia A. Nature Genetics. 1995;10:119–121. [PubMed]
19. Bi L, Sarkar R, Haas T, et al. Further characterization of factor VIII-deficient mice created by gene targeting: RNA and protein studies. Blood. 1996;88:3446–3450. [PubMed]
20. Bonham CA, Peng L, Liang X, et al. Marked prolongation of cardiac allograft survival by dendritic cells genetically engineered with NF-κB oligodeoxyribonucleotide decoys and adenoviral vectors encoding CTLA4-Ig. J Immunol. 2002;169:3382–3391. [PubMed]
21. Lu L, McCaslin D, Starzl TE, et al. Bone Marrow-derived dendritic cell progenitors (NLDC 145+, MHC class II+, B7-1dim, B7-2) induce alloantigen-specific hyporesponsiveness in murine T lymphocytes. Transplantation. 1995;60:1539–1545. [PMC free article] [PubMed]
22. Lu L, Qian S, Hershberger PA, et al. Fas ligand (CD95L) and B7 expression on dendritic cells provide counter-regulatory signals for T-cell survival and proliferation. J Immunol. 1997;158:5676–5684. [PubMed]
23. Ling M, Duncan EM, Rodgers SE, et al. Low detection rate of antibodies to nonfunctional epitopes on factor VIII in patients with hemophilia A and negative for inhibitors by Bethesda assay. J Thromb Haemost. 2003;1:2548–2553. [PubMed]
24. Sun CM, Hall JA, Blank RB, et al. Small intestine lamina propria dendritici cells promote de novo generation of FoxP3 T reg cells via retinoic acid. J Exp Med. 2007;204:1775–1785. [PMC free article] [PubMed]
25. Kasper CK, Aledort LM, Counts RB, et al. A more uniform measurement of factor VIII inhibitors. Thromb Diath Haemorrh. 1975;34:869–872. [PubMed]
26. Llorente L, Zou W, Levy Y, et al. Role of interleukin-10 in the B lymphocyte hyperactivity and autoantibody production of human systemic lupus erythematosus. J Exp Med. 1995;181:839–844. [PMC free article] [PubMed]
27. Lozier JN, Tayebi N, Zhang P. Mapping of genes that control the antibody response to human factor IX in mice. Blood. 2005;105:1029–1035. [PubMed]
28. Astermark J, Oldenburg J, Parlova A, Berntorp E, Lefvert AK. Polymorphisms in the IL-10 but not in the IL1β and IL4 genes are associated with inhibitor development in patients with hemophilia A. Blood. 2006;107:3167–3172. [PubMed]
29. Mingozzi F, Maus MV, Hui DJ, et al. CD8+ T-cell responses to adeno-associated virus capsid in humans. Nature Med. 2007;13:419–422. [PubMed]
30. Morelli AE, Coates PTH, Shufesky WJ, et al. Growth factor-induced mobilization of dendritic cells in kidney and liver of rhesus macaques: implications for transplantation. Transplantation. 2007;83:656–662. [PubMed]
31. Trucco M, Giannoukakis N. Immunoregulatory dendritic cells to prevent and reverse new-onset type 1 diabetes mellitus. Expert Opin Biol Ther. 2007;7:951–963. [PubMed]