PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of molcellbPermissionsJournals.ASM.orgJournalMCB ArticleJournal InfoAuthorsReviewers
 
Mol Cell Biol. 2009 November; 29(21): 5671–5678.
Published online 2009 August 24. doi:  10.1128/MCB.00773-09
PMCID: PMC2772750

Cwc25 Is a Novel Splicing Factor Required after Prp2 and Yju2 To Facilitate the First Catalytic Reaction[down-pointing small open triangle]

Abstract

Cwc25 has previously been identified to associate with pre-mRNA splicing factor Cef1/Ntc85, a component of the Prp19-associated complex (nineteen complex, or NTC) involved in spliceosome activation. We show here that Cwc25 is neither tightly associated with NTC nor required for spliceosome activation but is required for the first catalytic reaction. The affinity-purified spliceosome formed in Cwc25-depleted extracts contained only pre-mRNA and could be chased into splicing intermediates upon the addition of recombinant Cwc25 in an ATP-independent manner, suggesting that Cwc25 functions in the final step of the first catalytic reaction after the action of Prp2. Yju2 and a heat-resistant factor of unknown identity, HP, have previously been shown to be required for the same step of the splicing pathway. Cwc25, although resistant to heat treatment, is not sufficient to replace the function of HP, indicating that another heat-resistant factor, which we named HP-X, is involved. The requirement of Cwc25 and HP-X for the first catalytic reaction could be partially compensated for when the affinity-purified spliceosome was incubated in the presence of low concentrations of Mn2+. These results have implications for the possible roles of Cwc25 and HP-X in facilitating juxtaposition of the 5′ splice site and the branch point during the first catalytic reaction.

Precursor mRNAs (pre-mRNAs) excise their introns via two steps of a transesterification reaction. The reaction takes place on a large ribonucleoprotein complex called the spliceosome, which consists of five small nuclear RNAs (snRNAs), U1, U2, U4, U5, U6, and numerous protein factors. The spliceosome is a highly dynamic structure, formed by stepwise binding to the pre-mRNA of snRNAs in the form of small nuclear ribonucleoprotein complexes (snRNPs) (for a review, see references 3, 29, and 35-37). Following the binding of all snRNAs, the spliceosome undergoes a major structural change, leading to the release of U1 and U4 and the formation of the active spliceosome that is able to carry out the catalytic reaction.

Spliceosome activation also requires a large protein complex, the Prp19-associated complex (nineteen complex, or NTC), which is added to the spliceosome after the release of U1 and U4 to stabilize the association of U5 and U6 with the spliceosome (5). The NTC plays an important role in promoting or stabilizing high-specificity interactions between U6 and the 5′ splice site and between U5 and the exon sequence at the splice junctions after U1 and U4 have dissociated (4, 5). Eight components of the NTC have been identified, including Prp19, Ntc90/Syf1, Ntc85/Cef1, Ntc77/Clf1, Ntc31/Syf2, Ntc30/Isy1, Ntc25/Snt309, and Ntc20 (7-9, 32). Prp45, Prp46, and Cwc2 have also been identified as putative NTC components (1, 21). Proteomic analyses of proteins associated with Cef1 and its orthologues have identified similar complexes in humans and Schizosaccharomyces pombe, suggesting evolutionary conservation of the complex (22). At least 26 proteins (named Cwc for complexed with Cef1) are found to be associated with Cef1, in addition to U2, U5, and U6 snRNAs, in Saccharomyces cerevisiae. They include all the identified NTC components and may represent an expanded repertoire of NTC components (22).

After NTC-mediated spliceosome activation, several proteins are further required for the first catalytic reaction. A key player in this step is the DExD/H-box RNA helicase Prp2, which is thought to function as a molecular motor to restructure the spliceosome by hydrolyzing ATP (18, 19). Another protein, Spp2, originally identified as a multicopy suppressor of the prp2-1 mutation, interacts with Prp2 and is required for the function of Prp2 (24, 28). After the ATP-dependent Prp2 action, two other proteins, Yju2 and a heat-resistant protein factor of unknown identity, HP, are required to complete the first catalytic step independently of ATP (18, 20). Despite its function in the post-Prp2 step, Yju2 may be recruited to the spliceosome before or after the action of Prp2 through its interaction with the NTC (20). How HP acts or is recruited to the spliceosome remains unknown.

To compare the proteins that are associated with Cef1 with those associated with Prp19, we analyzed uncharacterized CWC components to see whether they function in the same step as the NTC. Here, we report the characterization of Cwc25 and show that Cwc25 is not tightly associated with the NTC and that its function is distinct from the NTC. Like Yju2, Cwc25 is required for the first catalytic reaction after the ATP-dependent Prp2 step but cannot substitute for the function of HP, suggesting that at least three proteins are involved in this ATP-independent step of the first catalytic reaction. Unlike Yju2, the recruitment of Cwc25 to the spliceosome is dependent on the function of Prp2, and also on the presence of Yju2. We also show that the requirement of Cwc25 and the other heat-resistant protein could be partially compensated for by incubation of the affinity-purified spliceosome lacking Cwc25 or HP under proper conditions, suggesting that factors involved in the final step of the first catalytic reaction might facilitate fine-tuning the structure of the spliceosome for precise alignment of splice sites.

MATERIALS AND METHODS

Yeast strains.

Yeast strains used were BJ2168 (MATa prc1 prb1 pep4 leu2 trp1 ura3), YSCC1 (MATa prc1 prb1 pep4 leu2 trp1 ura3 PRP19HA), YSCC12 (MATa his3 his7 ade3 ura3 prp2-1 PRP19-HA), and YSCC25 (MATa prc1 prb1 pep4 leu2 trp1 ura3 CWC25HA).

Oligonucleotides.

The following oligonucleotides were used: C25-1, GATCCGACATATGGGGTCGGGCGATTT; C25-2, GGCCGACGTCGTATGGGTAGTAGTCTAGGTCCGGAG; C25-3, GGCCGACGTCCCAGACTACGCTTAAACTTTCCTTTTCTTAGAGCTTGG; C25-4, CCGGCTCGAGAGTCACCAAGGTGTTCC; and R13, GAGTGACGATTCCTATAG.

Antibodies and reagents.

The antihemagglutinin (anti-HA) monoclonal antibody 8G5F was produced by immunizing mice with a keyhole limpet hemocyanin-conjugated HA peptide (our unpublished results), and the anti-Cwc25 polyclonal antibody was produced by immunizing rabbits with the full-length protein expressed in Escherichia coli. Protein A-Sepharose was obtained from Amersham Inc., and streptavidin-Sepharose was obtained from Sigma-Aldrich.

Construction of the CWC25 HA-tagged strain.

Construction of the HA-tagged strain was done as described in Tsai et al. (31). For construction of pRS406.CWC25-HA, DNA fragments A and B were generated by PCR using primers C25-1 and C25-2 and primers C25-3 and C25-4, respectively. Following digestion with BamHI and AatII and with AatII and XhoI, respectively, fragments A and B were ligated with BamHI- and XhoI-digested pRS406. Plasmid pRS406.CWC25-HA was linearized with BglII and transformed into yeast strain BJ2168 to displace the wild-type allele with the tagged allele by the pop-in and pop-out gene displacement method (20).

Splicing extracts, substrates, and assays.

Yeast whole-cell extracts were prepared according to the work of Cheng et al. (11). Actin precursors were synthesized in vitro using SP6 RNA polymerase, according to the work of Cheng and Abelson (10). Biotinylated pre-mRNA was synthesized by following the procedure described by Chan et al. (5). Splicing assays were carried out according to the work of Cheng and Abelson (10).

Immunodepletion, immunoprecipitation, and precipitation of the spliceosome by streptavidin agarose.

Immunodepletion of the NTC was performed as described by Chan et al. (5). Immunodepletion of Yju2 and Cwc25 was performed by incubation of 100 μl of splicing extracts with 100 μl of the anti-Yju2 or anti-Cwc25 antiserum coupled to 50 μl of protein A-Sepharose. Immunoprecipitation was performed as described by Tarn et al. (30) with anti-HA or anti-Ntc20 antibody. Precipitation of the spliceosome with streptavidin-agarose was carried out according to the work of Chan et al. (5).

Purification of Cwc25 and Yju2 and preparation of heat-resistant extract fractions.

Recombinant Yju2 was purified as described previously (20). His-tagged Cwc25 was purified by an Ni affinity column (Novagen), according to the manufacturer's manual. For purification of Cwc25-HA from yeast, CWC25-HA extracts (600 μl) were incubated with 50 μl protein A-Sepharose conjugated with 100 μl of the anti-HA antibody at 4°C for 1 h. After unbound materials were washed off, the resin was resuspended in 50 μl of buffer DK (20 mM HEPES [pH 7.9], 60 mM KPO4 [pH 7.0], 0.2 mM EDTA, 50 mM NaCl with 10% glycerol). The bound materials were then eluted by incubation at room temperature for 5 min with the HA peptide at a final concentration of 0.1 mM in buffer DK. For preparation of heat-resistant extract fractions (ΔE), Yju2-depleted or Cwc25-depleted extracts or both Yju2- and Cwc25-depleted extracts were incubated at 100°C for 5 min, and insoluble materials were removed by centrifugation. The supernatant was then transferred to a new Eppendorf tube, and KPO4 (pH 7.0) was added to a final concentration of 60 mM. ΔE was concentrated using Amicon Ultra centrifugal filter devices (Millipore), according to the recommended procedure.

Complementation of the affinity-purified spliceosome formed in Yju2- or Cwc25-depleted extracts.

Splicing reactions were carried out in Yju2- or Cwc25-depleted extracts under normal conditions. Each 20-μl sample of the reaction mixture was precipitated with 1 μl of anti-Ntc20 antibody conjugated to 10 μl of protein A-Sepharose. After being washed, the precipitates were incubated at 25°C for 20 min with 30 μl of buffer DK without glycerol, containing 4 mM MgCl2 and/or 0.1 mM MnCl2, 0.8 units/μl RNasin (Promega), and 50 μg/ml tRNA, in the presence or absence of 100 ng of recombinant Yju2, 150 ng of recombinant Cwc25, 4 μl of affinity-purified Cwc25, or 4 μl of ΔE.

RESULTS

Cwc25 is not tightly associated with the NTC but is required for pre-mRNA splicing both in vivo and in vitro.

Cwc25 was identified as a component associated with Cef1 (Ntc85) in a proteomic study (22). To examine whether Cwc25 is an intrinsic component of the NTC, we tagged Cwc25 with the HA epitope at its carboxy terminus for immunoprecipitation analysis. Extracts prepared from PRP19-HA and CWC25-HA were immunoprecipitated with anti-HA antibody, followed by Western blotting with antibodies against NTC components as probes. As shown in Fig. Fig.1,1, anti-HA antibody precipitated Prp19-HA and Cwc25-HA from PRP19-HA and CWC25-HA extracts, respectively, but NTC components were not coprecipitated with Cwc25 in significant amounts (lane 2) when normalized to the same amounts of Prp19-HA and Cwc25-HA. Even Ntc85/Cef1, with which Cwc25 was originally identified to be associated in the proteomic study (22), was not coprecipitated in any greater amounts. Furthermore, Cwc25 was not coprecipitated with Prp19 when the blot was probed with antibodies raised against recombinant Cwc25. This indicates that Cwc25 is not stably associated with Prp19 and is not an intrinsic component of the NTC.

FIG. 1.
Cwc25 is not tightly associated with the NTC. Extracts prepared from PRP19-HA (lane 1), CWC25-HA (lane 2), and nontagged strains (lane 3) were immunoprecipitated with anti-HA antibody, followed by Western blotting using antibodies against the HA epitope ...

CWC25 is reported to be essential for yeast vegetative growth. To see whether Cwc25 is essential for splicing, we constructed a yeast strain in which the CWC25 gene was placed under the control of an inducible galactose promoter. As shown in Fig. Fig.2A,2A, a shift of cells to glucose-containing medium led to growth arrest after 24 h, indicating that CWC25 is essential for cellular viability. Total RNA was then extracted from cells harvested at 0, 8, or 24 h grown in glucose- or galactose-supplemented media and subjected to primer extension analysis using a 5′-end-labeled primer complementary to a region in the second exon of the U3 gene (31). As shown in Fig. Fig.2B,2B, precursor U3 accumulated in large amounts after 24 h of growth in glucose-containing medium (Fig. (Fig.2B,2B, lane 5), and in smaller amounts after 8 h (Fig. (Fig.2B,2B, lane 4), indicating that Cwc25 is required for pre-mRNA splicing in vivo. Interestingly, cells grown in galactose-containing medium also accumulated small amounts of precursor U3 (Fig. (Fig.2B,2B, lanes 7 and 8) as opposed to no accumulation of U3 in wild-type cells (Fig. (Fig.2B,2B, lane 2). Since Cwc25 was expressed at a much higher level from the GAL-1 promoter than from the authentic promoter, it is speculated that overexpression of Cwc25 might moderately inhibit the splicing reaction. Consistently, the in vitro splicing reaction was inhibited when recombinant Cwc25 was added in excessive amounts (data not shown).

FIG. 2.
Cwc25 is essential for pre-mRNA splicing in vivo. (A) Growth curves of GAL-CWC25 cells in glucose medium (YPD) and galactose medium (YPG). Cells were grown in galactose medium to mid-log phase and then either maintained in galactose medium or shifted ...

To see in which step of the splicing reaction Cwc25 is involved, anti-Cwc25 antibody was used to deplete the protein from splicing extracts and to perform in vitro splicing assays. As shown in Fig. Fig.3A,3A, the splicing activity was nearly completely abolished in Cwc25-depleted extracts (lane 2) but was restored upon addition of recombinant Cwc25 (lane 3). This indicates that Cwc25 is required for the in vitro splicing reaction, and depletion of Cwc25 did not codeplete other essential splicing factors to any significant extent. We then examined whether Cwc25 is associated with the spliceosome during the splicing reaction by immunoprecipitation of the spliceosome with anti-HA antibody using CWC25-HA extracts. Figure Figure3B3B shows that while precipitation with anti-Ntc20 antibody precipitated pre-mRNA, splicing intermediates, and lariat intron, precipitation with anti-HA antibody precipitated only splicing intermediates, indicating that Cwc25 is associated only with splicing complexes containing splicing intermediates. These results suggest that Cwc25 is involved in the first catalytic step and is destabilized from the spliceosome after the first catalytic reaction.

FIG. 3.
Cwc25 is a spliceosomal component and essential for in vitro splicing. (A) Splicing reactions in mock-depleted (lane 1) or Cwc25-depleted (lanes 2 and 3) extracts with (lane 3) or without (lanes 1 and 2) the addition of recombinant Cwc25. (Lower panel) ...

Cwc25 is required for the first catalytic reaction after the action of Prp2.

To further define the step of Cwc25 action, we isolated the spliceosome formed in Cwc25-depleted extracts by precipitation with anti-Ntc20 antibody to see which proteins were needed to chase the reaction to yield splicing intermediates. The results show that the addition of recombinant Cwc25 was sufficient to promote the first catalytic reaction on the spliceosome formed in Cwc25-depleted extracts (Fig. (Fig.4A,4A, lane 5), and the reaction required Mg2+ but not ATP (Fig. (Fig.4B,4B, lanes 6 to 9). This indicates that Cwc25 acts in the final step of the first catalytic reaction either by itself or in concert with other splicing factors already present on the spliceosome to mediate the reaction. Another protein, Yju2, and an unidentified heat-resistant factor, HP, have been shown to function in the first catalytic step after the action of Prp2 (18, 20). Therefore, Cwc25 is likely the heat-resistant factor.

FIG. 4.
Cwc25 is required for the first catalytic reaction after Prp2 action. Splicing reactions were carried out in Cwc25-depleted extracts, and the reaction mixtures were precipitated with anti-Ntc20 antibody. (A) Precipitates were incubated under splicing ...

Cwc25 is a component of the heat-resistant factors.

To see whether Cwc25 is HP, we examined whether Cwc25 could substitute for the function of HP by complementation assays. Spliceosomes formed in Yju2-depleted extracts were isolated by precipitation with anti-Ntc20 antibody (Fig. (Fig.5A,5A, lane 4). While addition of recombinant Yju2 and the soluble fraction of heat-treated Yju2-depleted extracts (ΔE-d2) promoted the first catalytic reaction (lane 8), addition of both the Yju2 and Cwc25 proteins gave only marginal activity (lane 5), indicating that Cwc25 could not substitute for the function of HP. This result suggests that ΔE-d2 might contain at least one other heat-resistant factor, which we named HP-X, required for the first catalytic reaction besides Cwc25. Western blot analysis revealed that approximately 40% of Cwc25 remained soluble after heat treatment (data not shown). Purified recombinant Cwc25 retained around 20% of the complementation activity after heat treatment (data not shown), confirming the heat-resistant property of Cwc25. HP has previously been demonstrated to be sensitive to proteinase K digestion (18), undoubtedly with Cwc25 being a constituent. Addition of Cwc25 to proteinase K-treated HP did not restore the HP activity (data not shown), suggesting that HP-X is also a protein(s). Since Cwc25 is a component of the heat-resistant factors prepared from Yju2-depleted extracts (ΔE-d2), we anticipated that HP-X could be prepared from extracts depleted of both Yju2 and Cwc25 (ΔE-d2d25). Surprisingly, when recombinant Yju2 and Cwc25 were added to the spliceosome along with ΔE-d2d25, splicing did not proceed any more extensively than when recombinant Yju2 and Cwc25 were added alone (lane 7). This indicates that depletion of both Yju2 and Cwc25 from the extract resulted in depletion of the HP-X activity.

FIG. 5.
Cwc25 is a component of the heat-resistant factor. Splicing was carried out in Yju2-depleted extracts, and the reaction mixture was precipitated with anti-Ntc20 antibody. (A) The precipitate was incubated under splicing conditions in the presence and ...

Codepletion of the HP-X activity with Cwc25 suggests that HP-X might be associated with Cwc25 in the extract and that the HP-X activity could be copurified with Cwc25 from yeast extracts upon affinity chromatography. Indeed, when Cwc25 was affinity purified from CWC25-HA extracts using anti-HA antibody for the complementation assay, the splicing activity was greatly stimulated in the presence of Yju2 (Fig. (Fig.5B,5B, lane 10), whereas recombinant Cwc25 gave only marginal activity (lane 9). In the absence of Yju2, the yeast-purified Cwc25 supported splicing at a marginal level (Fig. (Fig.5B,5B, lane 6), suggesting that a slight amount of Yju2 might be copurified with Cwc25. However, HP-X did not appear to be entirely associated with Cwc25, since recombinant Cwc25 was sufficient to rescue the splicing activity from Cwc25-depleted extracts (Fig. (Fig.3A)3A) as well as to promote the first catalytic reaction on the spliceosome formed in Cwc25-depleted extracts (Fig. (Fig.4A).4A). The fact that depletion of both Yju2 and Cwc25 resulted in depletion of the HP-X activity suggests that HP-X is associated either with Cwc25 or with Yju2 in the extract. We have indeed noticed the association of HP with Yju2, since the affinity-purified Yju2 from yeast extracts contains a small amount of HP activity (20).

Binding of Cwc25 to the spliceosome requires the presence of Prp2 and Yju2.

The fact that recombinant Cwc25 alone was sufficient to promote the catalytic reaction of the spliceosome formed in Cwc25-depleted extracts suggests that Yju2 and HP-X could bind to the spliceosome independently of Cwc25. We tested whether the association of Yju2 with the spliceosome is necessary for the binding of Cwc25. Spliceosomes were formed with biotinylated pre-mRNA in Cwc25-depleted, Yju2-depleted, or NTC-depleted extracts and isolated by precipitation with streptavidin-Sepharose. The 3′ splice site mutant ACAC pre-mRNA was used to prevent cycling of the spliceosome and accumulate larger amounts of the spliceosome. Proteins on the isolated spliceosome were examined by Western blotting with antibodies against Yju2, Cwc25, Ntc85, and Snu114 as probes. The result showed that depletion of Cwc25 did not prevent binding of Yju2 but that depletion of Yju2 prevented binding of Cwc25 (Fig. (Fig.6A,6A, lanes 6 and 8). Furthermore, depletion of the NTC prevented binding of Yju2 and Cwc25 (lane 4). This indicates that Cwc25 may act in the final step of the first catalytic reaction and that its recruitment also requires Yju2. Notably, the amount of Yju2 associated with the spliceosome from Cwc25-depleted extracts was larger than that from mock-depleted extracts, indicating that Yju2 is destabilized from the spliceosome after completion of the first catalytic reaction but before the second reaction, which is blocked in the splicing of ACAC pre-mRNA (20).

FIG. 6.
The binding of Cwc25 to the spliceosome requires Prp2 and Yju2. The spliceosome formed with biotinylated ACAC pre-mRNA was isolated by precipitation with streptavidin-Sepharose, and the components were analyzed by Western blotting. (A) Splicing was carried ...

Yju2 has previously been shown to interact with the NTC in a dynamic manner, which is proposed to serve in recruiting Yju2 to the spliceosome. Furthermore, Yju2 can be recruited to the spliceosome either before or after the action of Prp2 (20). Since Cwc25 was not seen to be tightly associated with NTC components, it is unlikely that Cwc25 is recruited in a similar way. We then examined whether the binding of Cwc25 to the spliceosome is Prp2 dependent. The spliceosome formed in heat-inactivated prp2-1 mutant extracts with or without the addition of recombinant Prp2 was isolated, and the protein components were examined by Western blotting (Fig. (Fig.6B).6B). Interestingly, while the association of Yju2 was independent of Prp2, the association of Cwc25 required the presence of Prp2, indicating that Yju2 and Cwc25 are recruited to the spliceosome in different ways. The temporal control of Cwc25 recruitment is more stringent than that of Yju2.

The requirement for Cwc25 and HP-X was partially relieved in the presence of the Mn2+ ion.

We have recently demonstrated that the spliceosome is in a highly dynamic state during catalytic steps and undergoes structural rearrangements to direct splicing reactions in response to the environment. The affinity-purified spliceosome can catalyze the second transesterification reaction in the forward and reverse directions, depending on the incubation conditions, without the need of adding extra splicing factors (33). In the presence of Mn2+, the spliceosome can also catalyze the hydrolytic spliced exon reopening reaction, cleaving the mature mRNA precisely at the splice junction. The reverse of the first catalytic reaction has also been observed (33). Since Yju2, Cwc25, and HP-X are required to mediate the first catalytic reaction after the action of Prp2, they presumably act to facilitate juxtaposition of the 5′ splice site and the branch site under normal splicing conditions. Conceivably, under circumstances where spliceosome dynamics may increase, the chance of attaining a catalytically competent conformation will correspondingly increase to allow catalysis without needing some of these proteins.

We addressed this question by examining whether splicing can proceed in the absence of Yju2, Cwc25, or HP-X under modified splicing conditions on affinity-purified spliceosomes arrested after the Prp2 step. The spliceosome formed in Cwc25- or Yju2-depleted extracts was precipitated with anti-Ntc20 antibody and then incubated in the presence or absence of recombinant Yju2, Cwc25, or ΔE-d2 under various conditions (Fig. (Fig.7).7). When the spliceosome was isolated from Cwc25-depleted extracts and incubated in a splicing buffer containing 1 mM MgCl2, Cwc25 was required to promote the first catalytic reaction (Fig. (Fig.7A,7A, lanes 2 and 3). The reaction could proceed at a lower efficiency in the absence of Cwc25 if MgCl2 was replaced with MnCl2 (Fig. (Fig.7A,7A, lane 4). Change of the incubation buffer pH to 8.8 did not further enhance the efficiency (Fig. (Fig.7A,7A, lane 8), but the addition of Cwc25 increased the efficiency by approximately two- to threefold (Fig. (Fig.7A,7A, compare lanes 4 and 5 and lanes 8 and 9). These results indicate that Cwc25 is dispensable when Mn2+ is present, regardless of the pH during the incubation.

FIG. 7.
The requirement of Cwc25 and HP-X is partially relieved in the presence of Mn2+. (A) Spliceosomes formed in Cwc25-depleted extracts were precipitated with anti-Ntc20 antibody. The precipitates were incubated under splicing conditions (lanes 2 ...

The spliceosome formed in Yju2-depleted extracts requires the addition of Yju2 and ΔE-d2, which presumably provide Cwc25 and HP-X, to drive the first catalytic reaction (Fig. (Fig.6B,6B, lane 11) (20). When the spliceosome was incubated in a buffer of pH 8.8 containing 0.1 mM MnCl2, the addition of recombinant Yju2 alone was sufficient to give a basal level of the catalytic activity (Fig. (Fig.7B,7B, lanes 4 and 8), indicating that neither Cwc25 nor HP-X was required under this condition. The addition of ΔE-d2 further stimulated the activity to a higher level, comparable to that in the splicing buffer (Fig. (Fig.7B,7B, lanes 5 and 9). In contrast, no splicing activity was detected when the spliceosome was incubated with ΔE-d2 alone in the presence of MnCl2 at pH 8.8 (Fig. (Fig.7B,7B, lane 7), indicating that Yju2 was more strictly required and still indispensable under these conditions. To see whether Cwc25 and HP-X are dispensable under the same conditions, we added both recombinant Cwc25 and Yju2 to various buffers for incubation of the spliceosome formed in Yju2-depleted extracts (Fig. (Fig.7C).7C). While Cwc25 could be dispensable in the splicing buffer containing MnCl2 (Fig. (Fig.7A),7A), HP-X was dispensable only when incubated at pH 8.8 (Fig. (Fig.7C,7C, lane 12) but not in the splicing buffer (lane 6) containing MnCl2. Thus, although both Cwc25 and HP-X can be dispensable in the presence of MnCl2, the requirement for HP-X is more stringent than for Cwc25.

DISCUSSION

In this study, we demonstrate that Cwc25 is a novel splicing factor essential for pre-mRNA splicing both in vivo and in vitro. Although Cwc25 was previously identified to be associated with an NTC component, Cef1 (22), our studies demonstrate that Cwc25 is not tightly associated with identified components of the NTC, and distinct from the NTC, it functions in the first catalytic reaction rather than in spliceosome activation. Furthermore, Cwc25 acts at the same step as Yju2 after the ATP-dependent action of Prp2. Although Cwc25 is partially heat resistant, it does not substitute for the function of HP, suggesting the presence of another heat-resistant factor, HP-X, required for the first catalytic reaction.

It is interesting that both Cwc25 and HP-X may play only auxiliary roles in facilitating the first catalytic reaction. A low level of splicing activity was reproducibly observed when both recombinant Yju2 and Cwc25 were added to the spliceosome formed in Yju2-depleted extracts in the absence of HP-X (Fig. (Fig.5A,5A, lane 5, and B, lane 9). Similarly, depletion of Cwc25 consistently left a residual amount of activity, despite the protein not being detected by Western blotting (Fig. (Fig.3A).3A). It is possible that Cwc25 and HP-X each alone may be sufficient to give a basal level of the activity, and upon addition of the other, the activity is greatly enhanced. This notion is supported by the observation that Cwc25 and/or HP-X became dispensable under certain conditions that require the presence of MnCl2.

The fact that Cwc25 alone was sufficient to chase the spliceosome formed in Cwc25-depleted extracts suggests that Yju2 and HP-X either had already functioned or had already been recruited to the spliceosome waiting to act in concert with Cwc25 to promote the first transesterification reaction. Analysis of components of the affinity-purified spliceosome revealed that the binding of Cwc25 to the spliceosome was dependent on the presence of Yju2 and the NTC. While the association of Yju2 is independent of the function of Prp2, the association of Cwc25 with the spliceosome is Prp2 dependent, suggesting that a structural change of the spliceosome mediated by Prp2 is required for the binding of Cwc25. Furthermore, the recruitment of Cwc25 is temporally under more-stringent control than that of Yju2. Yju2 has been shown to interact with the NTC in a dynamic manner, which is postulated to function in recruiting Yju2 to the spliceosome (20). Two-hybrid analysis has revealed strong interactions of Yju2 with Ntc90 and Ntc77 (20), and Ntc90 has further been shown to be required for Yju2 recruitment (6). No interaction of Cwc25 with NTC components was observed, except for a weak interaction with Ntc77 (data not shown). How Cwc25 is recruited to the spliceosome remains unknown.

Similarly, the binding of HP-X to the spliceosome does not require prior association of Cwc25. Since the identity of HP-X is not known, how HP-X interacts with the spliceosome for its recruitment cannot be known. We have previously demonstrated that affinity-purified Yju2 from yeast extracts is associated with a small amount of HP activity, suggesting that HP, presumably including Cwc25 and HP-X, may interact with Yju2 (20) and that HP may be recruited to the spliceosome in part through its interaction with Yju2. The fact that the stable association of Cwc25 with the spliceosome requires the presence of Prp2, whereas the binding of Yju2 is independent of Prp2, suggests that Yju2 cannot be the major player in recruiting Cwc25. Cwc25 was not found to interact with Yju2 by two-hybrid assays (data not shown). The association of Cwc25 with Yju2 may require the presence of HP-X. Two lines of evidence support the association of HP-X with Cwc25. First, the HP-X activity was lost when Cwc25 was also depleted from the extract prior to heat treatment (Fig. (Fig.5A).5A). Second, while recombinant Cwc25 gave only a low level of activity, affinity-purified Cwc25 from yeast extracts gave a much higher level of activity with less Cwc25 in chasing the spliceosome formed in Yju2-depleted extracts when added together with recombinant Yju2 (Fig. (Fig.5B).5B). These results suggest that HP-X is associated with either Yju2 or Cwc25 or with both in a small amount.

Immunoprecipitation of the spliceosome revealed that Cwc25 was primarily associated with the spliceosome containing splicing intermediates. This suggests that Cwc25 might become associated with the spliceosome prior to the catalytic step, more stably associated after the first catalytic reaction, and destabilized from the spliceosome prior to or during the second catalytic reaction. This mode of spliceosome association is highly similar to that of Yju2 and may reflect a concerted action of the factors involved in this particular step of the spliceosome pathway, where they are destabilized from the spliceosome after completing their functions. It will be of interest to see whether HP-X also acts in the same way. The factors involved in the ATP-dependent step, Prp2 and Spp2, are also only transiently associated with the spliceosome. Prp2 is only detected on the spliceosome when the ATP-dependent function of Prp2 is disrupted either by removing ATP from the reaction mixture prior to its binding or by using dominant-negative mutants of Prp2 carrying mutations in the helicase motif (23). Upon ATP hydrolysis, Prp2 completes its function and leaves the spliceosome. Thus, all the step 1 factors are only transiently associated with the spliceosome during the process of their actions and need to be removed so that the spliceosome pathway can proceed.

Five proteins are involved in the second catalytic step (14, 15, 25, 27, 34). Like Prp2, the DExD/H-box RNA helicase Prp16 is required to restructure the spliceosome prior to the catalytic reaction (26), and the action of Prp16 may be facilitated by Prp17 (17). Following the ATP-dependent step, another DExD/H-box RNA helicase, Prp22, is required to drive the catalytic reaction, but its function here does not require ATP (25). Slu7 and Prp18, which are recruited to the spliceosome prior to Prp22, help to stabilize the association of Prp22 with the spliceosome (16) and act in concert with Prp22 to facilitate the transesterification reaction (16, 38). These three proteins are likely to interact with U5 snRNP directly or indirectly to stabilize the interaction of both exons with U5 snRNA (12, 15). Interestingly, Slu7 and Prp18 are dispensable when the 3′ splice site is in close proximity to the branch point. It is proposed that Slu7 and Prp18 might play roles in facilitating the identification and positioning of distal 3′ splice sites (2, 13, 38).

Similarly, under conditions such as low MnCl2 concentrations, the first catalytic reaction could proceed at a low efficiency in the absence of Cwc25 and/or HP-X. Yju2 is more strictly required and remains indispensable under all conditions tested. The requirement for Cwc25 is the most flexible, as Cwc25 is dispensable as long as Mn2+ is present, whereas HP-X is dispensable only at a higher pH in the presence of Mn2+. Mn2+ has been shown to relax the specificity of the spliceosome, albeit by increasing its efficiency in catalyzing the second reaction, possibly by increasing the structural dynamics of the spliceosome to facilitate positioning of splice sites (33). It is conceivable that Cwc25 and HP-X might function in facilitating the alignment of the 5′ splice site and the branch site, and such a function is less important when the structural dynamics of the spliceosome increases. Although primer extension analysis revealed that the reaction in the absence of Cwc25 yielded lariat intron-exon 2 largely at correct positions of the 5′ splice site and the branch point (data not shown), the precision of the transesterification reaction under such conditions requires more-careful evaluation.

We have recently shown that the spliceosome is in a highly dynamic state during catalytic steps and that the catalytic reaction can proceed in the forward or reverse direction in response to the environment (33). The affinity-purified spliceosome containing lariat intron and mature mRNA is able to undergo reverse splicing by two steps to yield pre-mRNA in the presence of monovalent cations without adding exogenous factors. Since Yju2 and Cwc25 are destabilized from the spliceosome after the first catalytic reaction, they are not present on the purified spliceosome. Thus, reverse splicing likely proceeds through a pathway different from that of the forward reaction. This notion together with conditional dispensability of Cwc25 and HP-X strongly suggests that these factors play roles in facilitating or stabilizing splice site alignment to facilitate the forward reaction under normal splicing conditions.

Acknowledgments

We thank members of Cheng's laboratory for helpful discussions and H. Wilson for English editing.

This work was supported by a grant from the Academia Sinica and National Science Council (Taiwan), NSC96-2321-B-001-006.

Footnotes

[down-pointing small open triangle]Published ahead of print on 24 August 2009.

REFERENCES

1. Albers, M., A. Diment, M. Muraru, C. S. Russell, and J. D. Beggs. 2003. Identification and characterization of Prp45p and Prp46p, essential pre-mRNA splicing factors. RNA 9:138-150. [PubMed]
2. Brys, A., and B. Schwer. 1996. Requirement for SLU7 in yeast pre-mRNA splicing is dictated by the distance between the branchpoint and the 3′ splice site. RNA 2:707-717. [PubMed]
3. Burge, C. B., T. H. Tuschl, and P. A. Sharp. 1999. Splicing of precursors to mRNAs by the spliceosome. In R. F. Gesteland, T. R. Cech, and J. F. Atkins (ed.), RNA world II. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
4. Chan, S.-P., and S.-C. Cheng. 2005. The Prp19-associated complex is required for specifying interactions of U5 and U6 with pre-mRNA during spliceosome activation. J. Biol. Chem. 280:31190-31199. [PubMed]
5. Chan, S.-P., D.-I. Kao, W.-Y. Tsai, and S.-C. Cheng. 2003. The Prp19p-associated complex in spliceosome activation. Science 302:279-282. [PubMed]
6. Chang, K.-J., H.-C. Chen, and S.-C. Cheng. 2009. Ntc90 is required for recruiting first step factor Yju2 but not for spliceosome activation. RNA 15:1729-1739. [PubMed]
7. Chen, C.-H., W.-Y. Tsai, H.-R. Chen, C.-H. Wang, and S.-C. Cheng. 2001. Identification and characterization of two novel components of the Prp19p-associated complex, Ntc30p and Ntc20p. J. Biol. Chem. 276:488-494. [PubMed]
8. Chen, C.-H., W.-C. Yu, T. Y. Tsao, L.-Y. Wang, H.-R. Chen, J.-Y. Lin, W.-Y. Tsai, and S.-C. Cheng. 2002. Functional and physical interactions between components of the Prp19p-associated complex. Nucleic Acids Res. 30:1029-1037. [PMC free article] [PubMed]
9. Chen, H.-R., S.-P. Jan, T. Y. Tsao, Y.-J. Sheu, J. Banroques, and S.-C. Cheng. 1998. Snt309p, a component of the Prp19p-associated complex that interacts with Prp19p and associates with the spliceosome simultaneously with or immediately after dissociation of U4 in the same manner as Prp19p. Mol. Cell. Biol. 18:2196-2204. [PMC free article] [PubMed]
10. Cheng, S.-C., and J. Abelson. 1986. Fractionation and characterization of a yeast mRNA splicing extract. Proc. Natl. Acad. Sci. USA 83:2387-2391. [PubMed]
11. Cheng, S.-C., A. Newman, R.-J. Lin, G. D. McFarland, and J. N. Abelson. 1990. Preparation and fractionation of yeast splicing extract. Methods Enzymol. 181:89-96. [PubMed]
12. Crotti, L. B., D. Bacikova, and D. S. Horowitz. 2007. The Prp18 protein stabilizes the interaction of both exons with the U5 snRNA during the second step of pre-mRNA splicing. Genes Dev. 21:1204-1216. [PubMed]
13. Frank, D., and C. Guthrie. 1992. An essential splicing factor, SLU7, mediates 3′ splice site choice in yeast. Genes Dev. 6:2112-2124. [PubMed]
14. Frank, D., B. Patterson, and C. Guthrie. 1992. Synthetic lethal mutations suggest interactions between U5 small nuclear RNA and four proteins required for the second step of splicing. Mol. Cell. Biol. 12:5197-5205. [PMC free article] [PubMed]
15. Horowitz, D. S., and J. Abelson. 1993. A U5 small nuclear ribonucleoprotein particle protein involved only in the second step of pre-mRNA splicing in Saccharomyces cerevisiae. Mol. Cell. Biol. 13:2959-2970. [PMC free article] [PubMed]
16. James, S., W. Tirmer, and B. Schwer. 2002. How Slu7 and Prp18 cooperate in the second step of yeast pre-mRNA splicing. RNA 8:1068-1077. [PubMed]
17. Jones, M. H., D. N. Frank, and C. Guthrie. 1995. Characterization and functional ordering of Slu7p and Prp17p during the second step of pre-mRNA splicing in yeast. Proc. Natl. Acad. Sci. USA 92:9687-9691. [PubMed]
18. Kim, S.-H., and R.-J. Lin. 1996. Spliceosome activation by PRP2 ATPase prior to the first transesterification reaction of pre-mRNA splicing. Mol. Cell. Biol. 16:6810-6819. [PMC free article] [PubMed]
19. Last, R. L., J. R. Maddock, and J. L. J. Woolford. 1987. Evidence for related functions of the RNA genes of Saccharomyces cerevisiae. Genetics 117:619-631. [PubMed]
20. Liu, Y.-C., H.-C. Chen, N.-Y. Wu, and S.-C. Cheng. 2007. A novel splicing factor, Yju2, is associated with NTC and acts after Prp2 in promoting the first catalytic reaction of pre-mRNA splicing. Mol. Cell. Biol. 27:5403-5413. [PMC free article] [PubMed]
21. Ohi, M. D., C. W. V. Kooi, J. A. Rosenberg, L. Ren, J. P. Hirsch, W. J. Chazin, T. Walz, and K. Gould. 2005. Structural and functional analysis of essential pre-mRNA splicing factor Prp19p. Mol. Cell. Biol. 25:451-460. [PMC free article] [PubMed]
22. Ohi, M. D., A. J. Link, L. Ren, J. L. Jennings, W. H. McDonald, and K. L. Gould. 2002. Proteomics analysis reveals stable multiprotein complexes in both fission and budding yeasts containing Myb-related Cdc5p/Cef1p, novel pre-mRNA splicing factors, and snRNAs. Mol. Cell. Biol. 22:2011-2024. [PMC free article] [PubMed]
23. Plumpton, M., M. McGarvey, and J. D. Beggs. 1994. A dominant negative mutation in the conserved RNA helicase motif ‘SAT’ causes splicing factor PRP2 to stall in spliceosomes. EMBO J. 13:879-887. [PubMed]
24. Roy, J., K. Kim, J. R. Maddock, J. G. Anthony, and J. L. Woolford, Jr. 1995. The final stages of spliceosome maturation require Spp2p that can interact with the DEAH box protein Prp2p and promote step 1 of splicing. RNA 1:375-390. [PubMed]
25. Schwer, B., and C. H. Gross. 1998. Prp22, a DExH-box RNA helicase, plays two distinct roles in yeast pre-mRNA splicing. EMBO J. 17:2086-2094. [PubMed]
26. Schwer, B., and C. Guthrie. 1992. A conformational rearrangement in the spliceosome is dependent on PRP16 and ATP hydrolysis. EMBO J. 11:5033-5040. [PubMed]
27. Schwer, B., and C. Guthrie. 1991. PRP16 is an RNA-dependent ATPase that interacts transiently with the spliceosome. Nature 349:494-499. [PubMed]
28. Silverman, E. J., A. Maeda, J. Wei, P. Smith, J. D. Beggs, and R.-J. Lin. 2004. Interaction between a G-patch protein and a spliceosome DEXD/H-box ATPase that is critical for splicing. Mol. Cell. Biol. 24:10101-10110. [PMC free article] [PubMed]
29. Staley, J. P., and C. Guthrie. 1998. Mechanical devices of the spliceosome: motors, clocks, springs, and things. Cell 92:315-326. [PubMed]
30. Tarn, W.-Y., K.-R. Lee, and S.-C. Cheng. 1993. The yeast PRP19 protein is not tightly associated with small nuclear RNAs, but appears to associate with the spliceosome after binding of U2 to the pre-mRNA and prior to formation of the functional spliceosome. Mol. Cell. Biol. 13:1883-1891. [PMC free article] [PubMed]
31. Tsai, R.-T., R.-H. Fu, F.-L. Yeh, C.-K. Tseng, Y.-C. Lin, Y.-H. Huang, and S.-C. Cheng. 2005. Spliceosome disassembly catalyzed by Prp43 and its associated components Ntr1 and Ntr2. Genes Dev. 19:2991-3003. [PubMed]
32. Tsai, W.-Y., Y.-T. Chow, H.-R. Chen, K.-T. Huang, R.-I. Hong, S.-P. Jan, N.-Y. Kuo, T. Y. Tsao, C.-H. Chen, and S.-C. Cheng. 1999. Cef1p is a component of the Prp19p-asociated complex and essential for pre-mRNA splicing. J. Biol. Chem. 274:9455-9462. [PubMed]
33. Tseng, C.-K., and S.-C. Cheng. 2008. Both catalytic steps of nuclear pre-mRNA splicing are reversible. Science 320:1782-1784. [PubMed]
34. Vijayraghavan, U., and J. Abelson. 1990. PRP18, a protein required for the second reaction in pre-mRNA splicing. Mol. Cell. Biol. 10:324-332. [PMC free article] [PubMed]
35. Wahl, M. C., C. L. Will, and R. L. Lührmann. 2009. The spliceosome: design principles of a dynamic RNP machine. Cell 136:701-718. [PubMed]
36. Will, C. L., and R. Lührmann. 1997. Protein functions in pre-mRNA splicing. Curr. Opin. Cell Biol. 9:320-328. [PubMed]
37. Will, C. L., and R. Lührmann. 2006. Spliceosome structure and function, p. 369-400. In R. F. Gesteland, T. R. Cech, and J. F. Atkins (ed.), The RNA world, 3rd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
38. Zhang, X., and B. Schwer. 1997. Functional and physical interaction between the yeast splicing factors Slu7 and Prp18. Nucleic Acids Res. 25:2146-2152. [PMC free article] [PubMed]

Articles from Molecular and Cellular Biology are provided here courtesy of American Society for Microbiology (ASM)