PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Immunity. Author manuscript; available in PMC 2010 October 16.
Published in final edited form as:
PMCID: PMC2767186
NIHMSID: NIHMS149545

Differential expression of IL-17A and IL-17F is coupled to TCR signaling via Itk-mediated regulation of NFATc1

Abstract

Th17 cells play major roles in autoimmunity and bacterial infections, yet how T cell receptor (TCR) signaling affects Th17 differentiation is relatively unknown. We demonstrate that CD4+ T cells deficient in Itk, a tyrosine kinase required for full TCR-induced activation of PLC-γ, exhibit decreased IL-17A expression, yet relatively normal expression of RORγT, RORα and IL-17F. IL-17A expression was rescued by pharmacologically-induced Ca2+ influx or expression of activated NFATc1. Conversely, decreased TCR stimulation or FK506 treatment preferentially reduced expression of IL-17A. The promoter of IL-17A but not IL-17F has conserved NFAT binding sites that bind NFATc1 in WT, but not Itk-deficient cells, even though both promoters exhibit epigenetic modifications consistent with open chromatin. Finally, defective IL-17A expression and differential regulation of IL-17A and IL-17F were observed in vivo in Itk−/− mice in an allergic asthma model. Our results suggest that Itk specifically couples TCR signaling strength to IL-17A expression through NFATc1.

INTRODUCTION

One of the hallmarks of adaptive immune responses is the differentiation of CD4+ T helper cells into distinct effector populations that are required for orchestrating responses to infection. First recognized and best studied are the Th1 and Th2 subclasses, which produce IFN-γ and IL-4, respectively and have distinct effector functions. However, it is now appreciated that there are multiple effector cell populations that can result from activation of naïve CD4+ T cells (Zhou et al., 2009; Zhu and Paul, 2008). One of these, the Th17 lineage has recently been recognized for its major role in autoimmunity and responses to bacterial infections (Bettelli et al., 2007; Weaver et al., 2007). Th17 cells were first identified by their ability to produce IL-17A, a cytokine that helps recruit neutrophils and is important for driving inflammatory responses. In the mouse, Th17 cells differentiate in response to TGF-β1 and IL-6 (Bettelli et al., 2006; Mangan et al., 2006; Veldhoen et al., 2006); additionally, IL-21 helps promote Th17 differentiation (Korn et al., 2007; Nurieva et al., 2007a; Wei et al., 2007; Zhou et al., 2007). These cytokines, via a pathway that requires STAT-3, turn on expression of the key transcription factors RORγT and RORα, which are critical for expression of IL-17A, as well as the closely-linked IL-17F gene, and IL-21 and IL-22 (Ivanov et al., 2006; Yang et al., 2008b).

Many studies have helped elucidate the key role of cytokines in regulating lineage specific transcription factors and the differentiation of distinct effector CD4+ cell populations (Zhu and Paul, 2008). However, in the Th1-Th2 paradigm, it is well established that signaling from the T cell receptor (TCR) also contributes to the development and establishment of cell fate. T cells need to be activated through the TCR in order to produce effector cytokines and multiple lines of evidence, including the use of different antigen concentrations and altered peptide ligands, have demonstrated that varying conditions of TCR ligation induce differential patterns of cytokines both in vitro and in vivo (Constant and Bottomly, 1997). Furthermore, distinct components of TCR signaling have also been linked to differentiation or establishment of effector cell function, including proximal signaling components and more distally, transcription factors (Glimcher and Murphy, 2000; Mowen and Glimcher, 2004). How TCR signaling affects IL-17 production is relatively unknown. Moreover, whether these signaling pathways contribute to the regulation of the distinct Th17 cytokines is unclear.

The Tec family tyrosine kinase Itk is a critical modulator of TCR signaling, where it functions to regulate PLC-γ activation, as well as actin polarization and cell adhesion (Berg et al., 2005). Mutations affecting Itk reduce TCR-induced PLC-γ phosphorylation and downstream Ca2+ mobilization—these defects are worsened by mutations affecting both Itk and the related kinase Rlk (Berg et al., 2005; Liu et al., 1998; Schaeffer et al., 1999). Accordingly, cells from Itk−/− and Itk−/−Rlk−/− mice show decreased responses to TCR stimulation that are associated with impaired TCR-induced activation of the Ca2+ sensitive Nuclear Factor of Activated T cell (NFAT) transcription factors (Fowell et al., 1999; Liao and Littman, 1995; Schaeffer et al., 2001). However, unlike mutations affecting more proximal TCR signaling molecules, mutations affecting the Tec kinases do not completely prevent or eliminate TCR signals, but rather lead to graded defects in T cell function, permitting evaluation of T cell function under conditions of partial or impaired TCR signaling (Gomez-Rodriguez et al., 2007; Schwartzberg et al., 2005).

To evaluate how TCR signaling affects Th17 differentiation, we examined cytokine production by TCR stimulated sorted naïve CD4+ cells isolated from Itk−/−, Itk−/− Rlk−/− and WT mice. We find that Itk−/− cells show reduced expression of IL-17A, but, surprisingly, expression of the other Th17 cytokines including the closely-linked IL-17F gene is relatively intact. Moreover, Itk−/− cells show normal expression of the master regulators RORγT and RORα. Although Itk−/− cells have reduced responses to IL-6, expression of IL-17A was only poorly rescued by expression of a constitutively-activated STAT-3 construct. Instead, IL-17A expression could be rescued by treatment with a Ca2+ ionophore or expression of an activated mutant of NFATc1. Conversely, specific decreases in expression of IL-17A (yet relatively normal expression of IL-17F) could be recapitulated by either low dose TCR stimulation or treatment with low-dose inhibition of Calcineurin. Consistent with these findings, we show that the region upstream of the promoter of IL-17A, but not IL-17F has a NFAT binding site that is conserved across species and is occupied by NFATc1 in WT but not Itk−/− Th17 cells, despite both promoters having open chromatin conformations. Finally, Itk−/− mice also show evidence for impaired production of IL-17A in vivo, despite relatively normal expression of IL-17F. Together, these data argue that the expression of IL-17A is specifically coupled to TCR signaling via Itk-mediated regulation of NFAT.

RESULTS

Itk−/− CD4 T cells show defective IL-17A production

To evaluate how TCR signaling affects Th17 differentiation, we examined intracellular cytokine production from sorted naïve (CD44loCD62Lhi) CD4+ cells isolated from Itk−/−, Itk−/−Rlk−/− and WT mice that were stimulated with anti-CD3 plus anti-CD28 in the presence of WT antigen-representing cells and polarizing cytokines. Both Itk−/− and Itk−/−Rlk−/− CD4+ T cells were capable of differentiating into IFNγ producing cells under Th1 differentiation conditions (IL-12 plus anti-IL-4), although at slightly lower levels than WT cells (Fig. 1a). In contrast, after exposure to TGF-β1 and IL-6, potent inducers of Th17 differentiation, there were marked reductions in the percentage of cells that had differentiated into IL-17A-producing cells from both Itk−/− (16.5 +/− 1.9%) and Itk−/−Rlk−/−(11 +/− 1.9%) animals as compared to WT cells (50.4 +/− 4.0%) (Fig.1a). Similar results were seen with CD8+ cells, which can also differentiate to produce IL-17A under these conditions (data not shown). Similar to a recent report (Veldhoen et al., 2009), we find that growth in the IMDM media, which contains higher levels of aryl hydrocarbons, improves Th17 differentiation (Fig. 1a, data points in red). However, Itk−/− cells were defective in differentiation to IL-17A producing cells in either media. To focus our evaluation on the effects of Itk and TCR signaling during the differentiation to IL-17A producing cells, we restimulated cells with PMA and Ionomycin in these studies. However, the defects in IL-17A expression were even more severe when CD4+ cells were restimulated with anti-CD3 plus anti-CD28 (Fig. 1b), arguing that Itk- and Itk/Rlk-deficient cells show defects both in priming to IL-17A-producing cells and in TCR-induced expression of IL-17A.

Figure 1
Reduced IL-17A production from Itk−/− and Itk−/−Rlk−/− CD4+ T cells

Itk−/− and Itk−/−Rlk−/− CD4+ T cells have defects in TCR-induced proliferation (Berg et al., 2005; Liao and Littman, 1995; Schaeffer et al., 1999), which can be severe in the case of Itk−/−Rlk−/− T cells (greater than 10-fold lower cell yields under Th17 culture conditions, see Fig 1a). To evaluate the possibility that decreased IL-17A production resulted from poor proliferation, we stained cells with CFSE to follow cell division. Although Itk−/− cells did exhibit reduced cell division, decreased percentages of cells producing IL-17A were observed at each division compared to WT cells (Fig. 1c and Supplemental Fig 1). These results suggested that the defect in IL-17A expression in Itk−/−cells did not result solely from impaired cell division and reflected an actual defect in IL-17A production. However, to minimize the effects of decreased cell proliferation, we focused our further studies on Itk−/− rather than Itk−/−Rlk−/− cells.

Previous studies have shown that Itk-deficiency alters thymic development and selection so that a large number of innate-type memory phenotype CD8+ T cells develop in Itk−/− mice (Berg, 2007). To rule out the possibility that altered development contributes to the reduced production of IL-17A, we sorted naïve WT and Itk−/− CD4+ T cells, activated them under null conditions with blocking anti-cytokine antibodies and then retrovirally transduced them with a retrovirus expressing murine Itk for one day prior to exposing them to Th17-inducing cytokines. Re-expression of Itk completely rescued the defect in IL-17A production in Itk−/− cells during Th17 differentiation (Fig. 1d). Thus, efficient production of IL-17A requires Itk at the time of differentiation and does not appear to result from altered development.

Decreased IL-17A message in Itk-deficient cells

To evaluate potential mechanisms for the decreased IL-17A production, we examined IL-17A mRNA levels by q-RT-PCR after 3.5 days of stimulation in RPMI media. IL-17A message was decreased in Itk−/− cells, demonstrating that the reduction in IL-17A production occurred at the level of IL-17A mRNA (Fig. 2a). Surprisingly however, expression of the message of other Th17 cytokines, including IL-22 and IL-21 appeared normal at this time of analysis. Indeed, expression of the closely linked IL-17F gene was relatively intact, while expression of IL-17A was consistently depressed several-fold at all times examined from 24 to 84 h post-stimulation (Fig 2a and data not shown). The differential effects on IL-17A and IL-17F were further evaluated by intracellular staining for cytokine production and ELISA for secreted cytokines (Fig. 2b-d). Although intracellular staining did reveal statistically significant reductions in IL-17F production (Fig. 2c), the difference was much less than seen for IL-17A (Itk−/− 82% WT levels for IL-17F, verses 32% for IL-17A) and may reflect other defects in Itk−/− cells that, for example, may affect protein translation. Similar results were seen with secreted cytokines as evaluated by ELISA (Fig. 2d), where the differences in IL-17A secretion between WT and Itk−/− were much greater than the differences in IL-17F secretion. These results suggested that there may be distinct features of the regulation of the individual Th17 cytokines.

Figure 2
Itk is required for efficient transcription of IL-17A, but not Il-17F

Itk−/− mice show impaired production of IL-17A in vivo

Evaluation of allergic asthma responses have suggested that IL-17A contributes to pathology whereas IL-17F may be protective. Mice deficient in IL-17F show exacerbated responses associated with increased Th2 cytokine production in a model of allergic asthma, whereas mice deficient in IL-17A show decreased responses (Yang et al., 2008a). Interestingly, Itk−/− mice also have decreased responses to allergic asthma that have previously been associated with reduced Th2 cytokine production and T cell infiltrates (Ferrara et al., 2006; Mueller and August, 2003). To determine whether defects in IL-17A production were also observed in vivo, we examined responses to a model of allergic asthma. Evaluation of IL-17 expression confirmed that IL-17A mRNA was more severely reduced than IL-17F in lungs of challenged Itk−/− mice, even when normalized for decreased numbers of T cells (Fig. 3b). Thus, T cells from Itk−/− mice show decreased expression of IL-17A despite relatively normal levels of IL-17F expression in vivo, as well as in vitro.

Figure 3
Itk−/− mice show impaired production of IL-17A in vivo

Altered responses to cytokines

To further understand the nature of the defect in IL-17A production in Itk−/− cells, we evaluated responses to different cytokine mileaus. Defects in IL-17A production were observed in response to multiple cytokines, including IL-21 plus TGF-β1, IL-1 plus IL-6, TGF-β1 plus IL-1 and TGF-β1 plus IL-6 and IL-23, suggesting that the decrease in IL-17A production was a universal defect that occurred in response to many, if not all, Th17-inducing cytokines conditions (Fig. 4a, Supplemental Fig. 2 and data not shown).

Figure 4
IL-17A production in Itk−/− CD4+ T cells is reduced in response to multiple cytokines, yet normal expression of RORγT and RORα

We next evaluated the response of Itk−/− cells to individual cytokines. Exposure of CD4+ T cells to TGF-β1 induces their differentiation to FoxP3-expressing iTregs, especially in the context of IL-2 (Chen et al., 2003; Davidson et al., 2007). Itk−/− CD4+ cells were able to differentiate normally to FoxP3 expressing cells under these conditions, suggesting that responses to TGF-β1 were normal (Fig 4b). In contrast, while exposure of WT CD4+ T cells to IL-6 gave rise to a small percentage of IL-17A producing cells (presumably due to low levels of TGF-β1 in the serum or produced by cells in the culture since this differentiation could be blocked by anti-TGF-β antibodies), Itk−/− cells completely failed to differentiate into IL-17A producing cells under these conditions (Fig. 4a). In this experiment, Itk−/− CD4 cells also produced lower amounts of IFN-γ in response to IL-6 in the presence of anti-TGF-β. These results suggest that Itk-deficient cells do not respond optimally to IL-6 upon activation.

IL-6 activates STAT-3, a transcription factor that is required for expression of RORγT, a key transcription factor required for IL-17A production (Ivanov et al., 2006; Yang et al., 2007). Expression of an activated STAT-3 mutant can drive activated T cells to express RORγT and produce more IL-17A (Yang et al., 2007). To evaluate whether loss of Itk affected STAT-3, we examined phosphorylation of STAT-3, which is required for its activation. In response to IL-6, either alone or under Th17 stimulation conditions (in combination with TGF-β1), Itk-deficient T cells exhibited variable decreases in STAT-3 phosphorylation (Fig 4c). Nonetheless, we observed normal levels of RORγT and RORαmRNA in Itk−/− cells suggesting that this decreased phosphorylation of STAT-3 was not sufficient to affect expression of these transcription factors (Fig. 4d). Although we did observe early decreases in the expression of IL-21, which is also induced by IL-6 (Korn et al., 2007; Nurieva et al., 2007a; Wei et al., 2007; Zhou et al., 2007), these delays were only transient (data not shown). Moreover, while retroviral transduction of cells with an activated STAT-3 mutant increased expression of IL-17A in WT cells, it only minimally rescued IL-17A expression in Itk-deficient cells (Fig. 4e, see Figs. 1d and and7c7c for comparison). Thus, altered STAT-3 activation did not appear to be the major cause of defective IL-17A production in Itk−/− cells, suggesting that Itk helps regulate IL-17A expression by a different or additional mechanism.

Figure 7
The IL-17 locus has an open chromatin conformation: caNFATc1 rescues IL-17A defect in Itk−/− cells

TCR signaling affects IL-17A production

Itk is required for full TCR-induced activation of PLC-γ and downstream Ca2+ pathways (Berg et al., 2005). To evaluate whether TCR signaling affects IL-17A expression, we stimulated WT CD4+ T cells in the presence of decreasing amounts of anti-CD3. We found that optimal production of IL-17A required high dose anti-CD3 stimulation (Fig. 5a). Intriguingly, lowering the dose of anti-CD3 stimulation preferentially affected the expression of IL-17A over IL-17F, similar to what we observed in Itk−/− cells. To determine whether altered TCR signaling contributes to the effects we see in Itk−/− cells, we stimulated cells with anti-CD3 in the presence of Ionomycin, a Ca2+ ionophore that can rescue TCR-induced Ca2+ influx in Itk−/− cells (Liu et al., 1998). Stimulation with anti-CD3 plus Ionomycin completely rescued IL-17A production in Th17-polarized Itk−/− CD4+ cells, while only minimally affecting expression of IL-17F (Fig. 5b). In contrast, stimulation with anti-CD3 plus PMA, which rescues ERK activation in Itk−/− T cells, did not rescue IL-17A production (data not shown). These results suggest that defects in TCR-induced Ca2+ mobilization contribute to the specific defect in IL-17A production in Itk−/− cells.

Figure 5
IL-17A production is affected by TCR and NFAT activation

A role for NFATc1 in regulation of IL-17A

In T cells, Ca2+ signaling regulates activation and expression of a critical series of transcription factors, the NFATs, which are dephosphorylated by calcineurin, leading to their nuclear localization and activation (Gwack et al., 2007; Winslow et al., 2003). TCR stimulation in conjunction with costimulation further upregulates expression of NFATc1 which autoregulates its own expression (Nurieva et al., 2007b). We and others have previously shown that Itk−/− T cells exhibit defects in NFAT activation and nuclear localization, as well as the induction of NFATc1 expression observed upon activation with TCR with costimulation (Fowell et al., 1999; Nurieva et al., 2007b; Schaeffer et al., 2001). To evaluate whether NFAT activation affects IL-17A expression, we differentiated cells under Th17 conditions in the presence of increasing amounts of the calcineurin inhibitors, FK506 or Cyclosporin A (CsA), which affect NFAT activation. While treatment of cells with high levels of FK506, affected both IL-17A and IL-17F (data not shown), exposure of cells to low amounts of FK506 preferentially affected expression of IL-17A (Fig. 5c). Similar results were obtained with CsA (Supplementary Fig. 3). Thus, the extent of calcineurin inhibition appears to specifically affect expression of IL-17A compared to IL-17F.

To specifically evaluate the role of NFAT in regulating expression of IL-17, we examined the regions 20kb upstream of the IL-17A and IL-17F transcriptional start sites, as well as the entire genes for potential NFAT binding sites. Although both promoters showed multiple potential NFAT consensus binding sites in the mouse, only the IL-17A upstream region contained an NFAT binding site that was conserved cross-species (located 3085 bp upstream of the first exon, Fig. 6a–b. Location of the conserved ROR binding site (Yang et al., 2008b) is also indicated). Evaluation of mouse IL-17A promoter-luciferase constructs in the Jurkat T cell line revealed that expression of a 3.5 Kb construct that included the potential NFAT-binding site was specifically increased by co-expression of a constitutively-active NFATc1 mutant (Fig. 6c). This mutant is constitutively localized to the nucleus due to mutations affecting the negative-regulatory phosphorylation sites and does not require TCR activation for its nuclear localization (Neal and Clipstone, 2003). However, expression of activated NFATc1 did not affect expression of a similar length construct derived from the IL-17F promoter (Supplemental Fig. 4). Furthermore, deletion of the conserved putative NFAT binding site in the IL-17A promoter prevented the NFATc1-induced increase in luciferase activity (Fig. 6a), suggesting that this site was a bona fide NFAT binding site.

Figure 6
IL-17A expression is linked to NFAT activation

To evaluate whether this NFAT binding site was used in vivo, we performed chromatin-immunoprecipitation (CHIP) studies by amplifying this region after cross-linking and immunoprecipitating NFATc1, a major NFAT member expressed in mature T cells. CHIP analyses of WT cells differentiated under Th17 conditions demonstrated a large enrichment of NFATc1 binding to the conserved NFAT binding site in the IL-17A promoter (Fig 6d). However, we saw no enrichment of amplification in samples from Itk−/− cells. Nonetheless, both WT and Itk−/− cells did show binding of acetylated histone H3 as well as K4-trimethylated Histone H3 to the proximal promoter region upstream of the transcriptional start sites of both IL-17A and IL-17F genes, as well as to multiple conserved non-coding regions (CNS) in this locus (Fig. 7a,b and data not shown). These results suggest that the entire IL-17 gene locus had undergone epigenetic modification consistent with open chromatin in both WT and Itk−/− cells. Thus, Itk−/− cells show a selective defect in the binding of NFATc1 to the IL-17A promoter despite having an open chromatin conformation.

Finally, to determine whether the defect in NFATc1 activation causes the impaired IL-17A transcription in Itk−/− cells, we transduced cells with a retroviral construct expressing activated NFATc1 (Neal and Clipstone, 2003). Transduction of the activated NFATc1 construct significantly rescued IL-17A production in Itk−/− CD4+ cells, supporting the idea that defective NFAT activation is the cause of the defect in IL-17A transcription in these cells (Fig. 7c).

DISCUSSION

Our results suggest that Itk specifically couples effective TCR signaling to the expression of IL-17A through its effects on the activation and expression of NFATc1. This defect in IL-17A expression is seen in response to multiple cytokines and is not the result of altered development since it can be rescued by re-expression of Itk in pre-activated cells. Our results agree with recent reports showing that high dose CsA blocks IL-17A expression (Liu et al., 2005; Zhang et al., 2008a) and that interference with NFAT DNA binding activity can affect IL-17A production (Hermann-Kleiter et al., 2008). However, we demonstrate here that, interestingly, expression of other Th17 cytokines, including IL-22, IL-21 and the closely linked IL-17F gene, are not affected to the same extent as IL-17A in Itk−/− T cells. Consistent with these observations, we find that low-dose FK506 or CsA preferentially affects IL-17A and that there is a conserved NFAT binding site upstream of the IL-17A promoter, but not in the region 20kb upstream of the IL-17F gene. These results suggest that expression of IL-17A is particularly sensitive to the strength of TCR signaling, requiring full activation of Ca2+-mediated pathways, in addition to signals from cytokines required for the induction and activation of RORγT and STAT3. Consistent with this idea, we find that optimal expression of IL-17A requires high doses of anti-CD3 plus anti-CD28 (Fig 4a) or high-dose antigen stimulation (data not shown). Whether there are other factors that more specifically affect IL-17F production remains an interesting question. Intriguingly, sequence analyses demonstrate a conserved NF-κB binding site upstream of the start of the IL-17F gene. Consistent with our data that the absence of Itk less severely affects IL-17F expression, we have previously found that activation of Itk−/− CD4 cells in the presence of APCs has only modest effects on NF-κB activation (Schaeffer et al., 2001). We also note that high doses of FK506 or CsA can affect IL-17F production (although always to a lesser degree than IL-17A); however, these effects could result from secondary effects of NFATs or these inhibitors on expression of other genes, cell proliferation or cell viability.

Recent data demonstrate that in addition to RORγT (Ivanov et al., 2006), RORα (Yang et al., 2008b), and Interferon-Regulatory Factor 4 (Brustle et al., 2007), Runx1 also participates in the regulation of IL-17A via a complex that can affect RORγT inhibition by FoxP3 (Zhang et al., 2008b). NFATs have been shown to couple with other transcription factors to differentially affect T cell functional outcomes (Hermann-Kleiter et al., 2008; Hu et al., 2007). Whether NFAT family members affect transcription of IL-17A through secondary effects on these other transcription factors will be of interest. Our observation that multiple CNS in the IL-17 locus bind acetylated Histone H3 in Itk−/− T cells, suggests that the IL-17 locus is in an open chromatin conformation, which would be consistent with the proper expression and activation of these other transcription factors (Kouzarides, 2007). Indeed, we see normal expression of RORγT, RORα, IRF4 and Runx1 upon differentiation of cells from Itk−/− mice (Fig. 5b and data not shown). Nonetheless, we cannot rule out other contributions—although constitutively activated NFATc1 greatly improves IL-17A production in Itk−/− CD4 cells, other factors may also participate in pathways affecting IL-17A expression in these cells. For example, although we have not seen effects on SOCS3 expression (data not shown), a factor known to affect STAT3 phosphorylation and Th17 differentiation (Chen et al., 2006), it will be of interest to determine whether TCR signaling affects other aspects of Th17 differentiation, given the slightly reduced responses we observed to IL-6 in Itk−/− cells. However, given the mild decreases in STAT3 phosphorylation, normal expression of RORγT and RORα, and minimal rescue with activated STAT3 constructs that we observed, it is likely that the major effects we see on IL-17A production result from effects on NFAT.

Why IL-17A specifically requires maximal TCR signaling for its expression is not clear, but could be related to the functions of IL-17A, which is a powerful mediator of inflammation, strongly inducing inflammatory chemokines and neutrophil recruitment (Dong, 2008; Ouyang et al., 2008). Indeed recent comparisons of IL-17A and IL-17F function indicated that IL-17A played a distinct and more critical role in the induction of certain inflammatory and autoimmune responses (Ishigame et al., 2009; Yang et al., 2008a). Intriguingly, the responses of Itk−/− mice in a model of allergic asthma resemble those of mice deficient in IL-17A, but not IL-17F (Mueller and August, 2003). Consistent with this observation, we find that IL-17A expression is also decreased in lungs from Itk−/− mice relative to WT mice, even when we normalize to T cell numbers. Perhaps a secondary requirement for strong TCR signals provides a safety check to help regulate IL-17A responses, which while important for protection against bacterial infections, particularly in the gut, can also lead to pathological effects and more strongly promote autoimmunity than IL-17F.

These data support the idea that there may be sub-populations of Th17 cells that produce different cytokine patterns, which may be distinctly regulated. Indeed, regulation of IL-22, another Th17 cytokine appears to be particularly sensitive to aryl hydrocarbons (Veldhoen et al., 2008). It is also of interest that, in Th2 cell clones, differential sensitivity of IL-4 and IL-5 to CsA has been shown, linking differential regulation of Th2 cytokines to NFAT activation (Bohjanen et al., 1990; Naora et al., 1994). Our results suggest that cytokine production by Th17 cells, like the Th1 and Th2 effector cell lineages, is affected by the type and strength of TCR signals they receive. These findings open a new window in understanding the factors that control the expression of cytokines by this important lineage, which may be important for understanding therapeutic approaches to inflammatory and autoimmune diseases.

EXPERIMENTAL PROCEDURES

Mice

Itk−/− (Liao and Littman, 1995), Rlk−/−Itk−/− (Schaeffer et al., 1999) and wild-type (WT) mice, backcrossed 5 generations on C57BL/6 background, were used between 7–9 weeks of age. Patterns of cytokine production were confirmed and in vivo challenges performed with animals backcrossed to C57BL/6 mice for 10–12 generations. Animal husbandry and experiments were performed in accordance with approved protocols by the National Human Genome Research Institute Animal Use and Care Committee or the Office of Research Protection’s Institutional Animal Care and Use Committee at Pennsylvania State University.

Isolation of naïve CD4 T cells and cell culture

T cells were purified by T cell isolation columns (R&D) and then stained with anti-CD25-PE, anti-CD4-PerCPCy5.5, anti-CD8-APC, anti-CD44-FITC and anti-CD62L-Pacific blue (eBioscience) and sorted on a FACsAria to obtain naïve CD4+ CD44loCD62Lhi or CD4+ CD44loCD62Lhi CD25 at a purity greater than 99%. Similar results were obtained with either type of naïve population.

Cells were cultured in RPMI 1640 or IMDM media supplemented with 10% Fetal Calf Serum (Hyclone), 2 mM L-glutamine, 100 U/ml penicillin/100 ug/ml streptomycin, and 5 mM 2-B-mercaptoethanol (Invitrogen). Sorted naïve CD4 cells (2 x 105) were co-cultured at a ratio of 1:5 with mitomycin-treated T-depleted splenocytes as antigen presenting cells (APCs) for 1–4 days in 48-well plates containing 1 μg/ml of anti-CD3 (2C11) plus 3 μg/ml anti-CD28 (BioXcell) under different conditions: neutral conditions (Th0): anti-IL4, anti-IFNγ and anti–IL-12 antibodies (at 10 μg/ml). Th1: 40 ng/ml IL-12 and anti-IL4. Th17: 20 ng/ml of IL6, 5 ng/ml of TGF-β1, anti-IL4, anti-IFNγ and anti–IL-12. IL-21/TGF-β1: 100 ng/ml of IL-21 plus 5 ng/ml of TGF-β1, anti-IL4, anti-IFNγ and anti–IL-12. IL6: 20 ng/ml of IL6 plus anti-IL4, anti-IFNγ and anti–IL-12. IL-1α/β/IL-6: 100 ng/ml of either IL-1αor IL-1β plus 20 ng/ml IL-6, anti-IL4, anti-IFNγ and anti–IL-12. IL-23 was used at 20 ng/ml. Cytokines were purchased from Peprotech, with the exception of TGF-β and IL-23, which was from R&D. Anti-cytokine antibodies are from BioXcell. The calcineurin inhibitors CsA (Sigma) and FK506 (Sigma) were added to the naïve CD4 T cells and APCs co-cultures for 30 minutes before treatment with the Th17 cocktails and the cells were cultured for 48h. Cells were cultured with 1 μg/ml of anti-CD3 plus 1 uM Ionomycin for 48 h under Th17 conditions.

Cytokine analyses

For intracellular staining, cells were differentiated for 2–3.5 days, then stimulated with 50 ng/ml of PMA (Sigma) and 1 μg/ml of Ionomycin (Sigma) or with 1 μg/ml anti-CD3 and 3 μg/ml anti-CD28 in presence of golgi-plug for 4 hours. Intracellular cytokines were stained with anti-IL-17A, IL-17F, IFNγ or FoxP3 (eBioscience). Data acquisition was done on an LSRII (BD Biosciences) and analyzed by FlowJo software (Tree Star Inc.). ELISAs were performed on supernatants from 48 h cultures using Mouse IL-17A (eBioscience) and Duo Set IL-17F (R&D) ELISAs.

CFSE

CD4+ CD25 CD44lo CD62Lhi (3 x 106 cells/ml) were incubated in PBS containing 2.5 μM of CFSE (Molecular Probes) for 10 min at room temperature, the reaction was quenched by adding 1 ml of FBS for 1 min and cells washed twice with complete RPMI and stimulated for 3 days.

Reverse Transcription quantitative PCR

Total RNA was prepared from differentiated T cells at differing times post-stimulation and from lungs from immunized and OVA-challenged WT and Itk−/− mice using Trizol reagent (Invitrogen) and RNeasy Mini kit (QIAGEN). cDNA was synthesized using the Taqman Reverse kit (Applied Biosystems). Quantitative RT-PCR was performed on a 7500 Fast Real-Time PCR instrument (Applied Biosystems) using either TaqMan Universal PCR Master Mix (Applied Biosystems) for IL-17A, IL-17F, IL-21, IL-22, RORγT (Applied Biosystems) or Platinum SYBR Green qPCR Supermix (Invitrogen) for RORα(5′ TCT CCC TGC GCT CTC CGC AC 3′ and 5′ TCCACAGATCTTGCATGGA 3′). 18srRNA and Thy1 were used for normalization for in vitro differentiated CD4+ T cells and for lungs respectively (Thy1 was used to normalize for T cells numbers in the lungs). The data in differentiated CD4 T cells was expressed relative to naïve CD4 T cells; whereas mRNA expression in lungs from treated animals was expressed relative to a WT challenged mouse. The data were expressed as 2−ΔΔCT using the ABI 7500 SDS 1.3.1 software.

Ovalbumin-induced airway hypersensitivity

Mice were sensitized with ovalbumin (Sigma-Aldrich) complexed to aluminum hydroxide (10μg ovalbumin/1 mg alum; Pierce) intraperitoneally in a total volume of 200μl on days 0 and 5. Mice were later challenged intranasally with ovalbumin from days 12 through 15 (at a concentration of 2 mg/ml, for a total of 40μg total exposure). Development of allergic asthma was confirmed by analyzing airway hyperresponsiveness (AHR) on day 16 using a custom made mechanical ventilator as previously described. Mice were then sacrificed, and lungs used for RNA or sectioned and stained using periodic acid-Schiff (PAS) as detailed (Ferrara et al., 2006; Mueller and August, 2003).

Chromatin Immunoprecipitation (ChIP)

ChIP assays were performed using EZ-Magna ChIP A (Upstate) as recommended by the manufacturer. Briefly, after fixing in 1% formaldehyde T cells were lysed for 10 min at room temperature. Chromatin was sheared by sonication in Sonicator 3000 (Misonix). Lysates equivalent to 2 x 106 cells were used per immunoprecipitation at 4 C overnight with 5 μg of anti-NFATc1, (sc-7294, Santa Cruz Biotechnology), anti-acetylated Histone H3 (06-599B, Upstate), anti-trimethyl K4 Histone H3 (39159, Active Motif) or pre-immune mouse or rabbit IgG antibodies. Enrichment of chromatin was analyzed using Platinum SYBR Green qPCR Supermix (Invitrogen) and the 7500 Fast Real-Time PCR instrument (Applied Biosystems). Data were normalized to input values and expressed as fold enrichment relative to normal mouse or rabbit sera.

The primers sequences used for qPCR analysis of NFAT binding site in IL-17A promoter are: 5′AATAGATTCTCAATGGTAGCC 3′ and 5′ GAAAATTCTTACTTTTGTAAACAG 3′. Primers sequences for CNS-2–7 are indicated in (Akimzhanov et al., 2007). Conserved NFAT binding sites were found using Mulan software at NCBI DCODE.org.

Retrovirus production and infection

Constitutively active-STAT3-IRES-GFP pMIGR (gift from D. Littman), ca-NFATc1-IRES-GFP-pMIGR (gift of N. Clipstone) and ITK-IRES-GFP-pMIGR (gift of L. Berg) plasmids (12.5 μg) were used to transfect 293 T cells with Fugene (Roche). After 48 hours retroviral supernatants were collected.

Sorted naïve CD4+ T cells were co-cultured with T-depleted APC under Th0 conditions for 48 h. Retrovirus supernatants were added to the cells and spun at 2500 rpm for 1.5 hours at room temperature with 8 μg/ml of polybrene (Sigma). After 24 hours, infected cells were differentiated under Th17 conditions for 48 hours and stained for intracellular cytokines.

Western blot

After stimulation for the indicated times, 1 x 106 CD4 T cells were lysed in Laemlli buffer. Proteins were separated in 8% SDS-PAGE gel and transferred to nitrocellulose membranes which were blocked and incubated with either anti-phospho-STAT3 or anti-STAT3 (9145L, 9132L, Cell Signaling Technology) as per the manufacturer, washed, incubated with horseradish peroxidase (HPR)-labeled goat anti-rabbit (Amersham Pharmacia), and developed with the enhanced chemiluminescence detection system (Amersham Pharmacia).

Luciferase Reporter Assays

DNA fragments corresponding to (−3500 to +1) from mouse IL-17A and IL-17F promoters were subcloned into pGL3-basic (Promega) and designated as IL17Ap or IL17Fp. Plasmid IL17Ap-ΔNFAT was constructed by deleting the potential NFAT binding site (−3085 to −3077) from IL17Ap plasmid by overlapping PCR. 6 x106 Jurkat E6 cells were electroporated with 20 μg luciferase reporter construct and 1 μg pRL-TK (Renilla luciferase) plasmid with or without 5 μg of caNFATc1-pMIGR plasmid using BTX ECM 830 electroporator (BTX Technologies). After 24h, cells were lysed according to the manufacturer, and luciferase activity was quantified in triplicate in reaction mixtures containing 15 μl lysate and 100 μl reagent from Dual-Luciferase Reporter Assay System (Promega) using Lumat LB 9507 luminometer (Berthold Technologies). Each transfection was done in triplicate (or duplicate for Supplemental Figure 4).

Statistical analyses

Results were expressed as mean ±SEM. Statistical differences between the analyzed groups were calculated using the paired Student’s t test. Values of p < 0.05 are considered significant. Graphs were done in Excel (Microsoft) and Prism (GraphPad).

Supplementary Material

01

Supplemental Figure 1: Overlay of CFSE stains of WT and Itk−/− cell proliferation under Th17 conditions.

Supplemental Figure 2: IL-23 does not rescue defects in IL-17A production in Itk−/− CD4 cells. Cells were differentiated in the presence of IL-6, TGF-β and IL-23. Similar results were obtained if IL-23 was added after 24 or 48h culture.

Supplemental Figure 3: Treatment of cells with CsA preferentially inhibits expression of IL-17A. Cells were differentiated into IL-17 producing cells in the absence or presence of varying concentrations of CsA. Data is representative of three independent experiments using varying concentrations of inhibitors.

Supplemental Figure 4: Comparison of the effects of activated NFATc1 on equivalent IL-17A and IL-17F promoter constructs. Ca-NFATc1 fails to increase transcription from the IL-17F promoter construct.

Acknowledgments

We would like to thank members of the Schwartzberg laboratory, J. Zhu, H. Yamane and J. Cote-Sierra for advice and helpful discussions; D. Littman, N. Clipstone, and L. Berg for retroviral constructs and mice, J. Fekecs for graphics assistance, and J. O’Shea, J. Zhu, J. Cannons and W. Paul for critical reading of the manuscript. This work was supported by funding from the intramural research program of the NHGRI, NIH (to PLS) and grant A1051626 (to AA).

Footnotes

The authors have no conflicting financial interests.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • Akimzhanov AM, Yang XO, Dong C. Chromatin remodeling of interleukin-17 (IL-17)-IL-17F cytokine gene locus during inflammatory helper T cell differentiation. The Journal of biological chemistry. 2007;282:5969–5972. [PubMed]
  • Berg LJ. Signalling through TEC kinases regulates conventional versus innate CD8(+) T-cell development. Nature reviews. 2007;7:479–485. [PubMed]
  • Berg LJ, Finkelstein LD, Lucas JA, Schwartzberg PL. Tec family kinases in T lymphocyte development and function. Annual review of immunology. 2005;23:549–600. [PubMed]
  • Bettelli E, Carrier Y, Gao W, Korn T, Strom TB, Oukka M, Weiner HL, Kuchroo VK. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature. 2006;441:235–238. [PubMed]
  • Bettelli E, Korn T, Kuchroo VK. Th17: the third member of the effector T cell trilogy. Current opinion in immunology. 2007;19:652–657. [PMC free article] [PubMed]
  • Bohjanen PR, Okajima M, Hodes RJ. Differential regulation of interleukin 4 and interleukin 5 gene expression: a comparison of T-cell gene induction by anti-CD3 antibody or by exogenous lymphokines. Proceedings of the National Academy of Sciences of the United States of America. 1990;87:5283–5287. [PubMed]
  • Brustle A, Heink S, Huber M, Rosenplanter C, Stadelmann C, Yu P, Arpaia E, Mak TW, Kamradt T, Lohoff M. The development of inflammatory T(H)-17 cells requires interferon-regulatory factor 4. Nature immunology. 2007;8:958–966. [PubMed]
  • Chen W, Jin W, Hardegen N, Lei KJ, Li L, Marinos N, McGrady G, Wahl SM. Conversion of peripheral CD4+CD25− naive T cells to CD4+CD25+ regulatory T cells by TGF-beta induction of transcription factor Foxp3. The Journal of experimental medicine. 2003;198:1875–1886. [PMC free article] [PubMed]
  • Chen Z, Laurence A, Kanno Y, Pacher-Zavisin M, Zhu BM, Tato C, Yoshimura A, Hennighausen L, O'Shea JJ. Selective regulatory function of Socs3 in the formation of IL-17-secreting T cells. Proceedings of the National Academy of Sciences of the United States of America. 2006;103:8137–8142. [PubMed]
  • Constant SL, Bottomly K. Induction of Th1 and Th2 CD4+ T cell responses: the alternative approaches. Annual review of immunology. 1997;15:297–322. [PubMed]
  • Davidson TS, DiPaolo RJ, Andersson J, Shevach EM. Cutting Edge: IL-2 is essential for TGF-beta-mediated induction of Foxp3+ T regulatory cells. J Immunol. 2007;178:4022–4026. [PubMed]
  • Dong C. TH17 cells in development: an updated view of their molecular identity and genetic programming. Nature reviews. 2008;8:337–348. [PubMed]
  • Ferrara TJ, Mueller C, Sahu N, Ben-Jebria A, August A. Reduced airway hyperresponsiveness and tracheal responses during allergic asthma in mice lacking tyrosine kinase inducible T-cell kinase. The Journal of allergy and clinical immunology. 2006;117:780–786. [PubMed]
  • Fowell DJ, Shinkai K, Liao XC, Beebe AM, Coffman RL, Littman DR, Locksley RM. Impaired NFATc translocation and failure of Th2 development in Itk-deficient CD4+ T cells. Immunity. 1999;11:399–409. [PubMed]
  • Glimcher LH, Murphy KM. Lineage commitment in the immune system: the T helper lymphocyte grows up. Genes Dev. 2000;14:1693–1711. [PubMed]
  • Gomez-Rodriguez J, Readinger JA, Viorritto IC, Mueller KL, Houghtling RA, Schwartzberg PL. Tec kinases, actin, and cell adhesion. Immunological reviews. 2007;218:45–64. [PubMed]
  • Gwack Y, Feske S, Srikanth S, Hogan PG, Rao A. Signalling to transcription: store-operated Ca2+ entry and NFAT activation in lymphocytes. Cell Calcium. 2007;42:145–156. [PubMed]
  • Hermann-Kleiter N, Gruber T, Lutz-Nicoladoni C, Thuille N, Fresser F, Labi V, Schiefermeier N, Warnecke M, Huber L, Villunger A, et al. The nuclear orphan receptor NR2F6 suppresses lymphocyte activation and T helper 17-dependent autoimmunity. Immunity. 2008;29:205–216. [PMC free article] [PubMed]
  • Hu H, Djuretic I, Sundrud MS, Rao A. Transcriptional partners in regulatory T cells: Foxp3, Runx and NFAT. Trends in immunology. 2007;28:329–332. [PubMed]
  • Ishigame H, Kakuta S, Nagai T, Kadoki M, Nambu A, Komiyama Y, Fujikado N, Tanahashi Y, Akitsu A, Kotaki H, et al. Differential roles of interleukin-17A and -17F in host defense against mucoepithelial bacterial infection and allergic responses. Immunity. 2009;30:108–119. [PubMed]
  • Ivanov II, McKenzie BS, Zhou L, Tadokoro CE, Lepelley A, Lafaille JJ, Cua DJ, Littman DR. The orphan nuclear receptor RORgammat directs the differentiation program of proinflammatory IL-17+ T helper cells. Cell. 2006;126:1121–1133. [PubMed]
  • Korn T, Bettelli E, Gao W, Awasthi A, Jager A, Strom TB, Oukka M, Kuchroo VK. IL-21 initiates an alternative pathway to induce proinflammatory T(H)17 cells. Nature. 2007;448:484–487. [PMC free article] [PubMed]
  • Kouzarides T. Chromatin modifications and their function. Cell. 2007;128:693–705. [PubMed]
  • Liao XC, Littman DR. Altered T cell receptor signaling and disrupted T cell development in mice lacking Itk. Immunity. 1995;3:757–769. [PubMed]
  • Liu KQ, Bunnell SC, Gurniak CB, Berg LJ. T cell receptor-initiated calcium release is uncoupled from capacitative calcium entry in Itk-deficient T cells. The Journal of experimental medicine. 1998;187:1721–1727. [PMC free article] [PubMed]
  • Liu XK, Clements JL, Gaffen SL. Signaling through the murine T cell receptor induces IL-17 production in the absence of costimulation, IL-23 or dendritic cells. Mol Cells. 2005;20:339–347. [PubMed]
  • Mangan PR, Harrington LE, O'Quinn DB, Helms WS, Bullard DC, Elson CO, Hatton RD, Wahl SM, Schoeb TR, Weaver CT. Transforming growth factor-beta induces development of the T(H)17 lineage. Nature. 2006;441:231–234. [PubMed]
  • Mowen KA, Glimcher LH. Signaling pathways in Th2 development. Immunological reviews. 2004;202:203–222. [PubMed]
  • Mueller C, August A. Attenuation of immunological symptoms of allergic asthma in mice lacking the tyrosine kinase ITK. J Immunol. 2003;170:5056–5063. [PubMed]
  • Naora H, Altin JG, Young IG. TCR-dependent and -independent signaling mechanisms differentially regulate lymphokine gene expression in the murine T helper clone D10.G4.1. J Immunol. 1994;152:5691–5702. [PubMed]
  • Neal JW, Clipstone NA. A constitutively active NFATc1 mutant induces a transformed phenotype in 3T3-L1 fibroblasts. The Journal of biological chemistry. 2003;278:17246–17254. [PubMed]
  • Nurieva R, Yang XO, Martinez G, Zhang Y, Panopoulos AD, Ma L, Schluns K, Tian Q, Watowich SS, Jetten AM, Dong C. Essential autocrine regulation by IL-21 in the generation of inflammatory T cells. Nature. 2007a;448:480–483. [PubMed]
  • Nurieva RI, Chuvpilo S, Wieder ED, Elkon KB, Locksley R, Serfling E, Dong C. A costimulation-initiated signaling pathway regulates NFATc1 transcription in T lymphocytes. J Immunol. 2007b;179:1096–1103. [PubMed]
  • Ouyang W, Kolls JK, Zheng Y. The biological functions of T helper 17 cell effector cytokines in inflammation. Immunity. 2008;28:454–467. [PMC free article] [PubMed]
  • Schaeffer EM, Debnath J, Yap G, McVicar D, Liao XC, Littman DR, Sher A, Varmus HE, Lenardo MJ, Schwartzberg PL. Requirement for Tec kinases Rlk and Itk in T cell receptor signaling and immunity. Science (New York, NY) 1999;284:638–641. [PubMed]
  • Schaeffer EM, Yap GS, Lewis CM, Czar MJ, McVicar DW, Cheever AW, Sher A, Schwartzberg PL. Mutation of Tec family kinases alters T helper cell differentiation. Nature immunology. 2001;2:1183–1188. [PubMed]
  • Schwartzberg PL, Finkelstein LD, Readinger JA. TEC-family kinases: regulators of T-helper-cell differentiation. Nature reviews. 2005;5:284–295. [PubMed]
  • Veldhoen M, Hirota K, Christensen J, O'Garra A, Stockinger B. Natural agonists for aryl hydrocarbon receptor in culture medium are essential for optimal differentiation of Th17 T cells. The Journal of experimental medicine. 2009;206:43–49. [PMC free article] [PubMed]
  • Veldhoen M, Hirota K, Westendorf AM, Buer J, Dumoutier L, Renauld JC, Stockinger B. The aryl hydrocarbon receptor links TH17-cell-mediated autoimmunity to environmental toxins. Nature. 2008;453:106–109. [PubMed]
  • Veldhoen M, Hocking RJ, Atkins CJ, Locksley RM, Stockinger B. TGFbeta in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells. Immunity. 2006;24:179–189. [PubMed]
  • Weaver CT, Hatton RD, Mangan PR, Harrington LE. IL-17 family cytokines and the expanding diversity of effector T cell lineages. Annual review of immunology. 2007;25:821–852. [PubMed]
  • Wei L, Laurence A, Elias KM, O'Shea JJ. IL-21 is produced by Th17 cells and drives IL-17 production in a STAT3-dependent manner. The Journal of biological chemistry. 2007;282:34605–34610. [PMC free article] [PubMed]
  • Winslow MM, Neilson JR, Crabtree GR. Calcium signalling in lymphocytes. Current opinion in immunology. 2003;15:299–307. [PubMed]
  • Yang XO, Chang SH, Park H, Nurieva R, Shah B, Acero L, Wang YH, Schluns KS, Broaddus RR, Zhu Z, Dong C. Regulation of inflammatory responses by IL-17F. The Journal of experimental medicine. 2008a;205:1063–1075. [PMC free article] [PubMed]
  • Yang XO, Panopoulos AD, Nurieva R, Chang SH, Wang D, Watowich SS, Dong C. STAT3 regulates cytokine-mediated generation of inflammatory helper T cells. The Journal of biological chemistry. 2007;282:9358–9363. [PubMed]
  • Yang XO, Pappu BP, Nurieva R, Akimzhanov A, Kang HS, Chung Y, Ma L, Shah B, Panopoulos AD, Schluns KS, et al. T helper 17 lineage differentiation is programmed by orphan nuclear receptors ROR alpha and ROR gamma. Immunity. 2008b;28:29–39. [PMC free article] [PubMed]
  • Zhang C, Zhang J, Yang B, Wu C. Cyclosporin A inhibits the production of IL-17 by memory Th17 cells from healthy individuals and patients with rheumatoid arthritis. Cytokine. 2008a;42:345–352. [PubMed]
  • Zhang F, Meng G, Strober W. Interactions among the transcription factors Runx1, RORgammat and Foxp3 regulate the differentiation of interleukin 17-producing T cells. Nature immunology. 2008b;9:1297–1306. [PMC free article] [PubMed]
  • Zhou L, Chong MM, Littman DR. Plasticity of CD4(+) T Cell Lineage Differentiation. Immunity. 2009;30:646–655. [PubMed]
  • Zhou L, Ivanov II, Spolski R, Min R, Shenderov K, Egawa T, Levy DE, Leonard WJ, Littman DR. IL-6 programs T(H)-17 cell differentiation by promoting sequential engagement of the IL-21 and IL-23 pathways. Nature immunology. 2007;8:967–974. [PubMed]
  • Zhu J, Paul WE. CD4 T cells: fates, functions, and faults. Blood. 2008;112:1557–1569. [PubMed]