PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of molbiolevolLink to Publisher's site
 
Mol Biol Evol. 2009 October; 26(10): 2245–2259.
Published online 2009 July 14. doi:  10.1093/molbev/msp147
PMCID: PMC2766937

The Unique Morgue Ubiquitination Protein Is Conserved in a Diverse but Restricted Set of Invertebrates

Abstract

Drosophila Morgue is a unique ubiquitination protein that facilitates programmed cell death and associates with DIAP1, a critical cell death inhibitor with E3 ubiquitin ligase activity. Morgue possesses a unique combination of functional domains typically associated with distinct types of ubiquitination enzymes. This includes an F box characteristic of the substrate-binding subunit in Skp, Cullin, and F box (SCF)-type ubiquitin E3 ligase complexes and a variant ubiquitin E2 conjugase domain where the active site cysteine is replaced by a glycine. Morgue also contains a single C4-type zinc finger motif. This architecture suggests potentially novel ubiquitination activities for Morgue. In this study, we address the evolutionary origins of this distinctive protein utilizing a combination of bioinformatics and molecular biology approaches. We find that Morgue exhibits widespread but restricted phylogenetic distribution among metazoans. Morgue proteins were identified in a wide range of Protostome phyla, including Arthropoda, Annelida, Mollusca, Nematoda, and Platyhelminthes. However, with one potential exception, Morgue was not detected in Deuterostomes, including Chordates, Hemichordates, or Echinoderms. Morgue was also not found in Ctenophora, Cnidaria, Placozoa, or Porifera. Characterization of Morgue sequences within specific animal lineages suggests that gene deletion or acquisition has occurred during divergence of nematodes and that at least one arachnid expresses an atypical form of Morgue consisting only of the variant E2 conjugase domain. Analysis of the organization of several morgue genes suggests that exon-shuffling events have contributed to the evolution of the Morgue protein. These results suggest that Morgue mediates conserved and distinctive ubiquitination functions in specific cell death pathways.

Keywords: Morgue, F box, ubiquitin conjugase, apoptosis, gene evolution, exon shuffling

Introduction

In organisms ranging from yeast to humans, the modification of proteins by single or multiple ubiquitin or ubiquitin-like moieties can greatly influence protein stability, activity, and subcellular localization (reviewed in Glickman and Ciechanover 2002 and Pickart and Eddins 2004). In addition, disruptions in normal ubiquitination processes are associated with a diverse array of human pathological conditions, including congenital defects, cancer, and neurodegenerative disease. Significantly, ubiquitination processes play a key role in mediating cell survival decisions by influencing the relative levels of death inducers and death inhibitors. In particular, the inhibitor of apoptosis proteins (IAPs) are important regulators of this balance that promote cell survival at least in part by targeting proapoptotic caspases for ubiquitination and degradation via the proteasome (reviewed in Ni et al. 2005 and Steller 2008). In Drosophila, DIAP1 is a central regulator of cell survival whose functions are necessary for inhibiting apoptosis in healthy cells; in DIAP1 mutants, there is massive, ectopic cell death during early embryogenesis (reviewed in Xu et al. 2009). Inactivation of DIAP1 also occurs in normal cells stimulated to die as RHG proteins (Reaper, Hid, Grim, and Sickle) promote DIAP1 autoubiquitination and proteasome-mediated degradation. Interestingly, other ubiquitination proteins have also been implicated in influencing apoptosis (reviewed in Steller 2008). Given the importance of ubiquitination events in cell life and death, it is important to decipher the functions of the proteins that mediate this pathway.

Ubiquitination is mediated by an enzymatic cascade that involves the sequential actions of an E1 activator, an E2 conjugase, and an E3 ligase (reviewed in Hershko and Ciechanover, 1998; Glickman and Ciechanover 2002; Rose 2005). Each of these enzyme types is highly conserved and contains one or more characteristic functional domains. E1s are multidomain proteins that utilize ATP to adenylate a processed ubiquitin moiety; E1s contain a conserved active site cysteine residue that forms a covalent thioester linkage to the COOH-terminal glycine of ubiquitin (Lee and Shinedelin 2008). All E1s transfer the activated ubiquitin to an E2 ubiquitin conjugase. Most E2s are small, single domain polypeptides that also contain a conserved active site cysteine that forms a covalent thioester linkage with ubiquitin. Although organisms utilize a diverse array of distinct E2s, they each contain a highly conserved conjugase domain. The function of the E2 is to donate the ubiquitin moiety to a target protein via an isopeptide linkage between a lysine residue on the substrate and the ubiquitin COOH terminus. To facilitate this transfer, E2s typically act in conjunction with an E3 ubiquitin ligase. There exist several distinct types of E3s that display significant structural diversity. E3s may correspond either to individual polypeptides, such as HECT domain and some RING domain proteins or large heteromers such as the Skp, Cullin, and F box (SCF) and anaphase promoting complexes (reviewed in Pickart 2001; Willems et al. 2004; Thornton and Toczyski 2006). Organisms possess large numbers of different E3s that recognize a diverse range of ubiquitination substrates. Among the best studied E3 is the SCF E3 ligase complex which consists of multiple polypeptides including a Cullin scaffold protein that associates with distinct adaptor proteins (Zheng et al. 2002). One of these adaptors is an Rbx-type RING domain protein that recruits a charged E2 conjugase, whereas a Skp adaptor protein recruits an F-box protein. F-box proteins contain a Skp-binding F-box domain and a distinct protein interaction domain that associates with the ubiquitination substrate (reviewed in Ho et al. 2008). The existence of large numbers of distinct F-box proteins and multiple Cullin, Skp, and Rbx components permit formation of a diverse array of catalytically active SCF complexes with distinct substrate specificity.

Although the different ubiquitination enzyme activities are typically segregated onto discrete polypeptides, the Drosophila Morgue (modifier of reaper and grim, ubiquitously expressed) protein contains a unique combination of functional domains typically associated with an E2 conjugase and an E3 ligase (Hays et al. 2002; Wing et al. 2002). Morgue was identified in two genetic screens for modifiers of apoptosis phenotypes in the adult eye; Morgue expression enhanced the actions of Grim-Reaper cell death activators in fly tissue and induced apoptosis in cultured insect cells. The Morgue protein associates with DIAP1 and promotes its downregulation. Morgue is a highly modular protein that contains a zinc finger motif, an F box, and an E2 conjugase domain. The zinc finger is positioned near the NH2 terminus and exhibits a C4-type arrangement of CysX2CysX12CysX2Cys (Schreader et al. 2003). The F box is centrally positioned and an extended F-box region contains five stereotypically spaced tryptophan residues. Although Morgue differs from other F-box proteins where the F box is typically located at the NH2 terminus, it does associate with the Drosophila SkpA protein in an F box–dependent fashion (Wing et al. 2002). The conjugase domain is located at the COOH terminus of Morgue, and strikingly, it contains a glycine substitution for the active site cysteine. Morgue therefore resembles a Ubiquitin conjugase E2 Variant (UEV) that lacks an active site cysteine and is unable to form a thioester linkage to ubiquitin (reviewed in Hurley et al. 2006). UEVs may associate noncovalently with ubiquitin (Sundquist et al. 2004) and some function in a catalytically active heterodimer with a bona fide E2 enzyme (Hofmann and Pickart 1999). Morgue may thus function as a UEV to influence the activity of another E2 or could instead or additionally function as an F-box protein in an SCF complex.

The unique domain content and architecture of Morgue implies that it might have novel activities in ubiquitination pathways. How conserved are Morgue functions? When did Morgue arise and how did the three distinct domains of Morgue become linked in a single polypeptide? A Morgue homolog was previously identified in another insect, the mosquito Anopheles gambiae (Schreader et al. 2003). Anopheles gambiae Morgue also contains a conserved C4-type zinc finger, an F-box region with five conserved tryptophans, and a variant glycine/cysteine conjugase domain. Morgue is therefore minimally conserved in other dipterans and arose at least 250 Ma (Zdobnov et al. 2002). However, a Morgue homolog was not identified in several more distantly related species, including Caenorhabditis elegans, Homo sapiens, Arabidopsis thaliana, and Saccharomyces cerevisiae. Thus, the distribution of morgue is phylogenetically restricted and the overall extent of Morgue's distribution and functional conservation remains uncertain.

To gain additional insights into morgue gene evolution, we have further investigated the phylogenetic distribution of Morgue using a combination of bioinformatic and polymerase chain reaction (PCR)–based molecular approaches. Analysis of more extensive data sets of genomic DNA sequences and expressed sequence tags (ESTs) resulted in the identification of Morgue from a wide range of invertebrate animals representing five distinct phyla: Arthropoda, Annelida, Mollusca, Platyhelminthes, and Nematoda. These phyla span both the Ecdysozoan and Lophotrozoan supergroups (Halanych 2004; DeSalle and Schierwater 2008; Dunn et al. 2008). Among the Arthropods, we not only identified Morgue in numerous other insect species but also in members of the crustacean and chelicerate groups. Morgue homologs were also identified in polychaete and clitellate Annelids, gastropod and bivalve Molluscs, planarial and trematode Platyhelminthes, and a clade I Nematode. Morgue appears to be restricted to the Protostome division of the Bilateria as it is was not unambiguously identified in any Deuterostome, including Echinodermata, Chordata, Eurochordata, or Hemichordata. It was also not found in Cnidaria, Ctenophora, Placozoa, or Porifera. The current distribution of Morgue likely reflects gene deletion events during diversification of specific lineages; Morgue was identified in one nematode, Xiphinema index, but not in other nematode species. Interestingly, the spider Cupiennius salei was found to express a Morgue protein that consists solely of the variant E2 conjugase domain with the glycine/cysteine substitution; it lacks both an F box and a zinc finger. Finally, the Morgue-coding region is arranged on distinct numbers of exons in different species, and in some species, the three domains of Morgue are each encoded by a separate, symmetric phase exon. Taken together, these findings suggest that Morgue first arose during divergence of the protostomes approximately 500–600 Ma and that exon shuffling and gene rearrangement events have contributed to morgue gene evolution and distribution. Morgue likely mediates distinctive ubiquitination functions in a widespread but restricted set of invertebrates.

Materials and Methods

Characterization of Homarus americanus, Daphnia pulex, and Cupiennius salei Morgue Sequences

The cDNA clone EST 148: CN852669 (The Marine Genomics Project—http://www.marinegenomics.org/) from the American lobster H. americanus was obtained from David Towle and Chris Smith. The complete DNA sequence of the 2.2-kb EST was obtained via a primer-walking approach using primers derived from the pCMV Sport 6.1 plasmid vector (Invitrogen Corp.) and the insert.

Total RNA was extracted from approximately 30 D. pulex adult water fleas obtained from the Carolina Biological Supply Company (Burlington, NC) using the RNeasy Fibrous Tissue Mini Kit (QIAGEN Inc.). First strand cDNA was synthesized using SuperScript III Reverse Transcriptase (Invitrogen Corp.) and a poly-dT18 primer. PCR assays were utilized to isolate a full-length D. pulex morgue cDNA using primers derived from the D. pulex morgue gene sequence identified via wFleaBase resources (http://wfleabase.org/).

cDNA or genomic DNA libraries from the wandering spider Cupiennius salei were provided by Wim Damen, Michael Akam, and Carlo Brena. Cupiennius salei spiders, tissues, and RNA samples were provided by Clemens Schaber, Lucia Kuhn-Nentwig, Friedrich Barth, and Elisabeth Fritz. PCR assays were used to isolate a 363-bp cDNA fragment from the C. salei cDNA library using a degenerate primer 5′-CCDATYTCNGGYTCCATWCA-3′ corresponding to conserved sequences in the Morgue E2 conjugase domain and a T3 primer 5′- ATTAACCCTCACTAAAGGGA -3′ complementary to the Lambda ZAP plasmid vector (Stratagene, La Jolla, CA). Additional PCR assays were performed to identify the COOH-terminal region and 3′ untranslated regions (UTR) using the cDNA library, an internal Morgue primer (D1: 5′-GTTAGTCGCCATGGTGATAT-3′), and a T7 primer from the vector (5′-TAATACGACTCACTATAGGG-3′). The resulting PCR product was analyzed via DNA sequencing.

The 5′ end of the C. salei Morgue–coding region was identified via 5′- rapid amplification of cDNA ends (RACE) analysis using the 5′-Full RACE Core Set (TAKARA Bio Inc., Shiga, Japan). Total RNA was extracted from C. salei neural and muscle tissues using the Qiagen RNeasy Fibrous Tissue Mini Kit and the morgue-specific primer pTCGGGTTCCAATCA was used to synthesize first strand cDNA. The single-stranded cDNA was ligated by T4 RNA ligase, and two rounds of nested PCR were conducted to amplify the 5′ morgue sequences. The following nested PCR primers were

  • Round 1—D3: 5′-CTACCCAATGAAGCCACCT-3′
  • U7: 5′-AATGTGCCTCCTTCATAAGG-3′
  • Round 2—D1: 5′-GTTAGTCGCCATGGTGATAT-3′
  • U2: 5′-TTAGGACCTGTTATGGATGCT-3′

The resulting 5′-RACE product was analyzed via DNA sequencing. Reverse transcriptase–PCR analysis was used to confirm the sequence obtained via 5′ RACE. For this experiment, first strand cDNA was synthesized from C. salei RNA using SuperScript II Reverse Transcriptase or SuperScript III Reverse Transcriptase (Invitrogen Corp.) and a poly-dT18 primer. The cDNA was used as a template for PCR assays using one primer from the 5′ UTR (D15: 5′-ATGCTGTGTCTACATCAGATGCT-3′) and one primer from the 3′ UTR (U21: 5′-GCTTTGGCTCCCCAGTTCAG-3′) of C. salei morgue. The resulting PCR product was analyzed via DNA sequencing.

To analyze the genomic organization of the C. salei morgue gene, genomic DNA was isolated from C. salei muscle and neural tissues using the DNeasy Blood and Tissue kit (QIAGEN Inc.). PCR assays were performed on this genomic DNA using primer pairs spanning the entire C. salei morgue cDNA sequence. The PCR products were subjected to DNA sequence analysis.

DNA Subcloning and Sequencing

PCR products were resolved by agarose gel electrophoresis and DNA was recovered from excised gel bands using the QIAquick Gel Extraction Kit (QIAGEN Inc.). Purified DNA was ligated into the pGEM-T Easy plasmid vector (Promega Corp., Madison, WI) and transformed into competent DH5α Escherichia coli cells (Invitrogen Corp.). Transformed bacterial clones were grown in small liquid cultures and plasmid DNA purified using the QIAprep Spin Miniprep Kit (QIAGEN Inc.). Digestion of the plasmid subclone DNA with EcoRI and subsequent agarose gel electrophoresis were used to verify the insert size. All DNA sequencing was performed by Davis sequencing (Davis, CA).

Bioinformatics

Identification of Morgue DNA and protein sequences from different species were identified using BlastN, BlastP, and TBlastX search strategies and several distinct genomic DNA and EST data sets. The query sequences corresponded to Morgue amino acid or nucleotide sequences derived from the zinc finger, F box, and Gly/Cys variant conjugase domain alone or in various combinations.

Results

Phylogenetic Distribution of Morgue Is Widespread but Restricted

The Morgue protein was originally identified in Drosophila melanogaster (Hays et al. 2002; Wing et al. 2002) and contains a distinctive combination of domains, including an NH2-terminal C4-type zinc finger, a central F box with five conserved tryptophan residues, and a COOH-terminal variant ubiquitin E2 conjugase domain where the active site cysteine is replaced by glycine (fig. 1). This unique combination of domains is not found in any other protein and suggests that Morgue may mediate novel ubiquitination activities. Clarification of such activities would be facilitated by illumination of the evolutionary origins and conservation of Morgue. In previous studies, a Morgue homolog was identified only in another dipteran insect, the mosquito A. gambiae (Schreader et al. 2003). Morgue was not identified in the genomes of the mammals H. sapiens or Mus musculus, the nematode C. elegans, the plant A. thaliana, or the yeast S. cerevisiae. These findings indicated that Morgue has a limited phylogenetic distribution and suggested that Morgue might even be restricted to insects or arthropods. To better address this issue and clarify the evolution of Morgue, we have undertaken a molecular evolution study of the morgue gene using bioinformatics and molecular biology approaches. In particular, amino acid and nucleotide sequences corresponding to all or parts of the Morgue protein were used as queries in Blast sequence similarity searches of more extensive genomic DNA and EST databases now available in a wide range of species. In addition, we also utilized PCR approaches to amplify Morgue homologous sequences from several species. Together, these approaches led to the identification of Morgue homologs in a wide range of metazoans, including representatives of five distinct phyla: Arthropoda, Nematoda, Mollusca, Annelida, and Platyhelminthes (fig. 2). Morgue is well conserved in the Protostome division of the Bilateria and was identified in coelomates (e.g., Mollusca, Arthropoda, and Annelida), pseudocoelomates (e.g., Nematoda), and acoelomates (e.g., Platyhelminthes). Within the Ecdysozoan supergroup, Morgue was found in species within both the Panarthropoda (e.g., Arthropoda) and Cycloneuralia (e.g., Nematoda) divisions. Within the Lophotrochozoan supergroup, Morgue is present in members of the Trochozoan division (e.g., Mollusca and Annelida) as well as in Platyzoa (e.g., Platyhelminthes). In contrast to wide representation of Morgue among Protostomes, sequence similarity searches of several genomic DNA and EST data sets (e.g., NCBI, Wellcome Trust Sanger Institute Trypanosome brucei Genome Project; http://www.sanger.ac.uk/Projects/Tbrucei/, Human Genome Sequencing Center at Baylor College of Medicine; http://www.hgsc.bcm.tmc.edu/projects/seaurchin/) failed to identify a Morgue homolog in Deuterostomes, including Echinoderms (e.g., the sea urchin Strongylocentrotus purpuratus) and several Chordate types such as vertebrates (e.g., H. sapiens), urochordates (e.g., the tunicate Ciona intestinalis), and cephalochordates (e.g., the lancet Branchiostoma floridae). In addition, Morgue was also not identified in marine (e.g., the sea anemone Nematostella vectensis) or aquatic (the hydra Hydra sp.) species within the phylum Cnidaria. Morgue is apparently also absent in sponges (e.g., Reniera sp.), placozoans (e.g., Trichoplax adhaerens), higher plants (e.g., A. thaliana, Oryza sativa japonica, and Zea mays), algae (e.g., Chlamydomonas reinhardtii and Thalassiosira pseudonana), and unicellular eukaryotes including yeast (e.g., S. cerevisiae and Schizosaccharomyces pombe), fungi (e.g., Neurospora crassa), and trypanosomes (e.g., Trypanosoma brucei). Morgue thus exhibits a widespread but restricted phylogenetic distribution. Below we describe the representation of Morgue within each specific phyla where a homolog was identified.

FIG. 1.
Morgue is a unique multidomain ubiquitination protein. A schematic representation of the Morgue protein is presented that indicates the identified domains and flanking regions. The three domains include a CysX2CysX12CysX2Cys zinc finger (ZF) motif near ...
FIG. 2.
Distribution of Morgue in metazoans. A phylogenetic tree indicating major divisions of metazoan animals and the phyla where Morgue homologs have been identified (star). In addition, those phyla are also indicated where searches of genome DNA and EST data ...

Phylum Arthropoda

The highly diverse Arthropod phylum is contained within the Ecdysozoan supergroup and consists of four major groups/subphyla, the Hexapods, Crustaceans, Chelicerates, and Myriapods. Morgue was originally identified in the dipteran insect D. melanogaster, and sequence similarity searches were performed on 11 additional Drosophila species using resources at Flybase (http://flybase.org/) and NCBI Blast Trace Archives (http://blast.ncbi.nlm.nih.gov/Blast.cgi). These species range from other members of the melanogaster subgroup (e.g., Drosophila simulans and Drosophila sechellia) to the more distantly related virilis (e.g., Drosophila virilis) and repleta (e.g., Drosophila mojavensis) subgroups as well as a divergent Hawaiian species (Drosophila grimshawi). Analysis of genomic DNA sequences and ESTs identified a complete Morgue homolog in each species of similar size to D. melanogaster Morgue (data not shown). Each Morgue homolog includes a well-conserved CysX2CysX12CysX2Cys zinc finger, F-box region with five tryptophans in a stereotypic TrpX8TrpX12TrpX7TrpX11Trp arrangement, and a variant conjugase domain with the glycine substitution for the active site cysteine (Gly/Cys variant conjugase domain). Morgue homologs were also identified in other dipterans, including mosquitoes (e.g., A. gambiae Schreader et al. 2003, Aedes aegypti, and Culex pipiens) and a sand fly (Phlebotomus papatasi) using FlyBase, NCBI Trace Archive resources, and the Human Genome Sequencing Center at Baylor College of Medicine (http://www.hgsc.bcm.tmc.edu/projects/). Additional sequence similarity searches using these resources and VectorBase (http://www.vectorbase.org/index.php) identified Morgue homologs in representatives of other Hexapod orders, including the Coleopteran red flour beetle (Tribolium castaneum), the Hymenopteran jewel wasp (Nasonia vitripennis) and honeybee (Apis mellifera), the Lepidopteran silkmoth (Bombyx mori), and the Phthirapteran human louse (Pediculus humanus). These insect genomes also encode well-conserved Morgue homologs. Significantly, an incomplete EST corresponding to Morgue was also identified in a noninsect Hexapod, the springtail (Collembola) Onychiurus orientalis. The O. orientalis Morgue sequence includes an F-box region with three of the five conserved tryptophan residues and a Gly/Cys variant conjugase domain (data not shown). Thus, Morgue is well represented among disparate Hexapods and importantly, appears to maintain a highly conserved architecture.

Hexapods are closely aligned with Crustaceans (Mallatt et al. 2004; Mallatt and Giribet 2006) and complete or partial Morgue sequences were identified in three diverse Crustaceans; the Branchiopod water flea (D. pulex), the Malacostracan American lobster (H. americanus), and the Maxillopod salmon louse (Lepeophtheirus salmonis) using resources available at NCBI Blast Trace Archives, the Daphnia Genomics Consortium (https://dgc.cgb.indiana.edu/display/daphnia/Daphnia+genome+release), wFleabase (http://wfleabase.org/), and the Marine Genomics Project (http://www.marinegenomics.org/). Completion of D. pulex and H. americanus Morgue sequences was accomplished using supplemental PCR approaches. Daphnia pulex and H. americanus Morgue both closely resemble their Hexapod counterparts, with strong conservation of the overall protein architecture and sequences of the zinc finger, F box, and Gly/Cys variant conjugase domain. However, the 596 amino acid H. americanus Morgue (Supplementary Material online) contains a substantial insertion between the zinc finger and F box that is not present in the Morgue homolog from D. pulex, L. salmonis, or any hexapod. Similar to A. gambiae Morgue (Schreader et al. 2003), this region contains several short, imperfect, direct repeats. Although the L. salmonis Morgue sequence is incomplete, it nonetheless contains a well conserved Gly/Cys variant conjugase domain and a portion of the F box that includes the last two tryptophan residues.

Morgue sequences were also identified in two different Chelicerates, the deer tick (Ixodes scapularis) and the wandering spider (C. salei). In I. scapularis, analysis of genomic sequences and partial ESTs (available at VectorBase and provided by Vish Nene) identified a Morgue homolog similar to that from other Arthropods (data not shown). Interestingly, a very distinctive Morgue protein was characterized in C. salei. Initially, degenerate PCR primers derived from conserved regions of the Gly/Cys variant conjugase domain were used to amplify Morgue sequences from a C. salei cDNA library. To complete characterization of C. salei Morgue sequences, PCR, 5′ RACE, and RT-PCR was performed on this cDNA clone as well as RNA isolated from dissected C. salei tissue samples. These analyses defined a 1,253-nt sequence that includes 44 nucleotides of 5′ UTR which contains three stop codons that are in frame with the putative initiator Methionine (fig. 3). Strikingly, the predicted C. salei Morgue protein is only 190 amino acids in length and corresponds solely to the Gly/Cys variant conjugase domain; it lacks both the F box and zinc finger. Cupiennius salei Morgue exhibits approximately 60% identity to the other Arthropod Morgues, a higher level of sequence similarity than that shared with any other E2 conjugase. Extensive screening of C. salei cDNA and genomic DNA libraries as well as RT-PCR approaches all failed to provide evidence for a more complete C. salei Morgue homolog or any sequences corresponding to a Morgue zinc finger or F box. This finding suggests that a novel Morgue protein is expressed in C. salei.

FIG. 3.
Morgue sequences from a Chelicerate Arthropod, the wandering spider Cupiennius salei. (A) The nucleotide sequence of a C. salei morgue cDNA indicating the 5′ and 3′ untranslated regions (UTR; lowercase) and protein-coding region (uppercase). ...

Phylum Nematoda

The phylum Nematoda also resides in the Ecdysozoan supergroup and nematode species can be subdivided into six distinct clades (fig. 4A): I, II, III, IVa, IVb, and V (Blaxter et al. 1998). Previous studies (Wing et al. 2002; Schreader et al. 2003) failed to identify Morgue in the highly studied clade V species, C. elegans, suggesting that Morgue is not conserved in members of this phylum. However, as genomic DNA and EST data sets are now available from a wide range of additional nematode species, including representatives from most clades, we performed additional sequence similarity searches using resources available at Wormbase (http://www.wormbase.org/), Nematode.net (http://www.nematode.net/), Gold Genomes OnLine Database v 2.0 (http://www.genomesonline.org/), and the Washington University School of Medicine Genome Sequencing Center (http://genome.wustl.edu/home.cgi). Interestingly, a Morgue homolog was identified from a single nematode species, the California dagger nematode, X. index. Xiphinema index, a clade I species, is a parasitic plant pathogen and vector for the grape fanleaf virus (Andret-Link et al. 2004). Analysis of three overlapping X. index ESTs (CV509086, XI00517, and CV510246) revealed a predicted Morgue polypeptide that contains a partial zinc finger, F-box region with all five conserved tryptophan residues, and the Gly/Cys variant conjugase domain (fig. 4B). Although these ESTs are not full length, the 5′ end of CV509086 encodes a portion of the zinc finger that includes a single CysX2Cys motif as well as three other strongly conserved finger residues. XI00517 also encodes this same CysX2Cys motif and an F box with five conserved tryptophan residues; the sequence ends just prior to the variant conjugase domain. Finally, we completed the DNA sequence of EST CV510246 (kindly provided by Irina Ronko) and found that it contains an open reading frame encoding the entire F box and Gly/Cys variant conjugase domain.

FIG. 4.
Morgue sequences from the Adenophorea Nematoda, the California Dagger Nematode Xiphinema index. (A) The composite nucleotide sequence of two X. index ESTs (CV509086 and CV510246) encoding an incomplete Morgue homolog. The open reading frame (uppercase) ...

Additional attempts were made to identify other nematode Morgue sequences using searches performed with X. index Morgue amino acid and DNA queries on genomic DNA and EST data sets from clade V (e.g., Caenorhabditis briggsae and Caenorhabditis remanei), clade III (Brugia malayi), and clade I (Trichinella spiralis and Trichuris vulpis) species. However, all these searches failed to identify any other Morgue homolog. Thus, Morgue appears to be quite restricted within the phylum Nematoda. Importantly, identification of Morgue in Arthropods and a nematode indicates that it is represented in both the Panarthropoda and Cycloneuralia divisions of the Ecdysozoan supergroup.

Phylum Annelida

Annelids are members of the Lophotrochozoan supergroup and are divided into two major groups, the Polychaeta (mostly marine bristleworms) and the Oligochaeta/Clitellata (earthworms and leeches) (Martin 2001; Siddall et al. 2001). Sequence similarity searches were carried out using resources available at Gold Genomes OnLine Database v 2.0 and NCBI Trace Archives, JGI Eukaryotic Genomics (http://genome.jgi-psf.org/euk_cur1.html). ESTs and genomic DNAs were identified that encode Morgue in an aquatic leech (Helobdella robusta) and a marine polychaete (Capitella sp. I). Two overlapping H. robusta ESTs (gb|EY385252.1| and gb|EY337095.1) were identified that together encode a putative complete 378 amino acid Morgue protein that contains a conserved zinc finger, F box with five stereotypic tryptophans, and Gly/Cys variant conjugase domain (Supplementary Material online). In addition, two overlapping Capitella sp. I ESTs (gb|EY511424.1| and gb|EY646050.1|) were identified that also encode a partial Morgue protein with all three domains (data not shown). The Capitella sp. I Morgue is encoded by approximately 2.6 kb of genomic DNA (genomic scaffold 1423) that was identified via resources at the DOE Joint Genome Institute (http://www.jgi.doe.gov/). These findings indicate that a complete Morgue homolog is represented in members of both major Annelid groups.

Phylum Mollusca

Molluscs are a highly diverse phylum aligned with Annelids within the Lophotrochozoan supergroup. They include marine, aquatic, and terrestrial members divided into eight major classes: Aplacophora, Bivalvia (Pelecypoda), Caudofoveata, Cephalopoda, Gastropoda, Monoplacophora, Polyplacophora, and Scaphopoda (Sigwart and Sutton 2007). Morgue homologs were identified in several marine species, including the Gastropod sea hare (Aplysia californica) and giant limpet (Lottia gigantea), and the Pelecypod/Bivalve California mussel (Mytilus californianus) using resources available at NCBI and Gold Genomes OnLine Database v 2.0. In A. californica, a genomic DNA sequence (gb|AASC01165294.1|) was identified that encodes a conserved zinc finger, F box and five tryptophan residues, and Gly/Cys variant conjugase domain (Supplementary Material online). This gene is spread out over at least 9 kb and includes at least six coding exons. Although there is not yet sequence for a corresponding full length mRNA, an A. californica EST (gb|GD198836.1|) encodes a linked Morgue zinc finger and F box (data not shown). In L. gigantea, an EST (gb|FC687666.1|) was identified that encodes the apparent NH2-terminal region of a Morgue homolog including a conserved zinc finger and a F-box region with four of the five tryptophan residues conserved (data not shown). This EST is incomplete at the 3′ end and does not extend into a conjugase domain. In M. californianus, two ESTs (gb|ES738457.1| and gb|ES391720.1|) were identified that encode portions of a Morgue protein. The gb|ES738457.1| EST encodes a zinc finger and F box with five conserved tryptophans, whereas gb|ES391720.1| encodes the same F box and a Gly/Cys variant conjugase domain (data not shown). However, a frameshift between the F box and conjugase domain results in the F box and conjugase domains being located on distinct reading frames. Given the strong similarity of all three domains to other Morgue homologs, it is likely that this frameshift is due to a sequencing error and that these domains are all encoded as one contiguous polypeptide in a native mRNA. There is not yet corresponding M. californianus genomic DNA sequence available for comparison. Taken together, these findings imply that full-length Morgue proteins are conserved in the diverse members of the phylum Mollusca.

Phylum Platyhelminthes

The phylum Platyhelminthes resides in the Spiralia and is considered either a member of the Lophotrochozoan supergroup or a closely related Platyzoan supergroup. There are three major classes of Platyhelminthes (Carranza et al. 2008): Turbellaria (flatworms), Trematodes (flukes), and Cestoda (tapeworms). Although the Turbellaria are generally free living, most of the Trematode and Cestoda species are parasitic. Use of the resources at NCBI, Gold Genomes OnLine Database v 2.0, Washington University School of Medicine Genome Sequencing Center, and the Wellcome Trust Sanger Institute (http://www.sanger.ac.uk/) identified genomic sequences and ESTs encoding all or portions of Morgue homologs in the flatworm planaria (Dugesia ryukyuensis and Schmidtea mediterranea), the fluke (Schistosoma japonicum and Schistosoma mansoni), and the tapeworm (Echinococcus multilocularis). Schistosoma japonicum is an important human parasite and a major infectious agent of schistosomiasis and E. multilocularis is a Cyclophyllidea that is responsible for human hydatid disease or alveolar echinococcosis (reviewed in Nishimura and Hung 1997). In the flatworm S. mediterranea, a 1.3-kb genomic sequence (gb|AAWT01077108.1|) was identified that encodes a complete Morgue homolog (Supplementary Material online). In addition, S. mediterranea ESTs were identified (data not shown) that encode either the conserved zinc finger and F-box region (gb|DN300983.1|) or the Gly/Cys variant conjugase domain (gb|DN308073.1| and gb|EG412926.1|). In the flatworm D. ryukyuensis, ESTs (DrC_00415 and dbj|BW638286.1|) were identified that encode a partial Morgue protein sequence which includes an F-box region with three tryptophan residues (Trp1,3,4) and the Gly/Cys variant conjugase domain (data not shown). In the fluke S. japonicum, an EST (gb|AW186552.1|) was identified that encodes a Gly/Cys variant conjugase domain, and in the tapeworm, E. multilocularis, a genomic clone (Contig_0004860) was identified that contains a 1,154-bp open reading frame encoding a complete Morgue homolog (data not shown). Morgue is thus conserved in all three major Platyhelminthes classes. Significantly, identification of Morgue in Platyhelminthes as well as Molluscs and Annelids reveals its conservation in the Trochozoan and Platyzoan divisions of the Spiralia.

Exceptional Identification of Morgue in a Vertebrate

Whereas Morgue is well represented within the Protostome division of the Bilateria, with one potential exception, Morgue homologs were not identified in any Deuterostome. This exception is a Morgue homolog that was identified from an NCBI sequence database of a teleost fish, the threespine stickleback. Two overlapping ESTs (gb|DW648170.1| and gb|DW648169.1|) that encode a partial Morgue protein were identified from a cDNA library derived from 21-day-old larvae of a marine threespine stickleback (Gasterosteus aculeatus strain: Bitrufjordur). This sequence includes an F box with three Trp residues (Trp2,3,4) and the Gly/Cys variant conjugase domain (Supplementary Material online). The ESTs are both incomplete at the 5′ end and neither extends into a zinc finger. Overall, the sequence of this protein was most strongly related (47% identity over a 259 amino acid region) to the Morgue homolog from the polychaete Annelid, Capitella sp. I. Notably, subsequent searches of sequence data sets (NCBI and EMBL) from an aquatic threespine stickleback strain (G. aculeatus strain: Bear Paw Lake) using this Morgue sequence failed to identify any corresponding stickleback morgue genomic DNA sequences. Morgue homologs were also not identified in other fish species, including the zebrafish (Danio rerio) and two pufferfish (Fugu rubripes and Tetraodon nigroviridis) using resources available at NCBI Trace Archives, the Zebrafish Information Network (http://zfin.org/cgi-bin/webdriver?MIval=aa-ZDB_home.apg), and the Fugu Genome Project (http://www.fugu-sg.org/). These findings suggest that these ESTs may not correspond to an authentic G. aculeatus mRNA.

Conserved Architecture of Morgue Proteins

The Morgue protein is highly modular and contains three identifiable domains, the zinc finger, F box, and Gly/Cys variant E2 conjugase domain, as well as four flanking regions, the NH2 terminus up to the zinc finger (NH2), the region between the zinc finger and F box (Spacer A), the region between the F box and variant conjugase domain (Spacer B), and the COOH terminus (C). Although many of the sequences described here are as yet incomplete or preliminary, the evidence suggests that for all but C. salei Morgue, each homolog exhibits this same architecture. Comparison of these individual regions in the distinct Morgue proteins reveals both clear similarities and differences. The NH2 region that precedes the zinc finger is typically ~50 amino acids in length but ranges in size from nine amino acids in the A. mellifera to 68 amino acids in A. gambiae. This region contains a high proportion of charged residues and exhibits limited sequence conservation. It is followed by a 20-amino acid C4-type zinc finger that exhibits an invariant CysX2CysX12CysX2 arrangement. Strong conservation is observed for internal residues as the Gly6, Tyr8, Gly9, Pro10, and Phe/Tyr12 are nearly invariant (fig. 5). Following the zinc finger and preceding the F box is Spacer A. This region varies substantially in length from 71 amino acids in A. gambiae to 155 amino acids in H. americanus. The sequence of Spacer A is not well conserved and contains a large number of Prolines and several short repeats (e.g., Supplementary Material online; Schreader et al. 2003). Following this region is the F box in the central portion of the protein. In general, F boxes exhibit moderate sequence conservation and the Morgue F-box motif is the least conserved among the three identified domains. The sequence both within and flanking the Morgue F box is distinctive and includes a set of five well conserved though not invariant tryptophan residues (Trp1–5) in a stereotypic TrpX8TrpX12TrpX7TrpX11Trp arrangement (fig. 6). Some residues nearby the first four tryptophans are also conserved and a survey of all Morgues suggests the following 45 amino acid consensus sequence: SerLeuTrpX4ValCysXArgTrpX2IleLeuX8TrpX2(Phe/Tyr)(Ile/Val)X2ArgTrpProLeu(Phe/Tyr)X8Trp. This arrangement is unique and not found in other F-box proteins. The extended Morgue F-box sequence exhibits strong similarity to the sea anemone (N. vectensis) EDO42575 F-box/LRR protein (~46% identity over 43 amino acids) and shares three tryptophan residues (Trp2,3,4). Compared with other D. melanogaster F-box proteins, the Morgue F box exhibits strong similarity to that of F box/WD40 protein Supernumerary Limbs (~34% over 53 amino acids) with which it shares three tryptophans (Trp2,3,5).

FIG. 5.
The Morgue zinc finger motif is conserved in length and organization. (A) Alignment of zinc fingers from several Morgue homologs indicating the invariant cysteine residues (bold, underline in Dros) and CX2CX12CX2C organization. Positions where a residue ...
FIG. 6.
The Morgue F-box region contains five highly conserved Trp residues. (A) Alignment of the F-box regions from several Morgue homologs with that of Drosophila melanogaster (Dros). The positions of five conserved tryptophan residues (Trp 1–5; bold, ...

Between the F box and Gly/Cys variant conjugase domain is Spacer B, which is generally ~120 amino acids but exhibits significant length variation. For example, in H. americanus Morgue, this region is 220 amino acids; it contains a glycine-rich stretch and 16 Proline residues distributed mostly near the two termini (Supplementary Material online). In contrast, in A. gambiae, Morgue Spacer B is only 46 amino acids. Following this region is the Gly/Cys variant conjugase domain located at the COOH terminus. The glycine replacement of the active site cysteine is invariant and no other conjugase was identified in any organism that contains this same substitution. The residues directly flanking this glycine are also strongly conserved and exhibit a HGD(V/I)G(L/I)D consensus (fig. 7). Interestingly, in each Drosophila species, there is a Glutamine insertion five residues after the glycine in the active site that is not observed in any other Morgue. This insertion is also not present in bona fide E2 conjugases. Nonetheless, the Morgue Gly/Cys variant conjugase domain exhibits strong sequence similarity to canonical E2 conjugases including the Drosophila UbcD1/Effete (50.4% identity, E value 1.78 × 10−31) and C. elegans Let-70 (51% identity, E value 7 × 10−31). Significantly, four residues important for contact with the RING domain of E3 ligase proteins (Zheng et al. 2002) and nearly all of the residues involved in interaction with ubiquitin (Hamilton et al. 2001) are conserved in Morgue. However, the residues that mediate interaction with E1 ubiquitin activators (Lee and Shinedelin 2008) are not well conserved. In many species, the end of the Gly/Cys variant conjugase domain defines the Morgue COOH terminus, whereas a few possess an additional short COOH-terminal region of up to 20 amino acids.

FIG. 7.
The Morgue variant E2 conjugase domain contains a unique glycine substitution for the active site cysteine. (A) Alignment of the central portion of the conjugase domain from several Morgue homologs. Deletion of one residue corresponding to the first Glutamine ...

Distinct Organization of morgue Genes

In several arthropod species, the availability of genomic DNA and cDNA sequences permitted determination of the exon/intron organization of the morgue gene. Although the Morgue proteins are generally of similar size, significant variability was observed for organization of the corresponding genes. For example, among Arthropods, the number of Morgue protein-coding exons ranges from one in P. humanus to eight in B. mori. The distribution of the individual domains within the coding exons is also quite distinct (fig. 8). In the D. melanogaster morgue gene, exon 1 encodes only the NH2 region and exon 2 encodes the entire remainder of the protein including all three domains. The single intron is phase 0. In A. gambiae, the Morgue domains are more dispersed; while exon 1 also encodes the NH2 region, only the zinc finger and the F box are encoded by exon 2 and the conjugase domain is split between exons 3 and 4. Thus the zinc finger and F-box domains are encoded separately from the conjugase domain. All four exons exhibit a symmetric phase (0;0), and the intron within the A. gambiae conjugase domain is located 31 amino acids following the active site glycine. In T. castaneum, the three domains are further separated; exon 1 encodes the NH2 region, exon 2 encodes the zinc finger, exon 3 encodes most of Spacer A, exon 4 encodes the F box, exon 5 encodes Spacer B and most of the conjugase domain, and exon 6 encodes the remainder of the conjugase domain. Thus, each of the three domains is encoded by a separate exon. In addition, exons 1, 2, 5, and 6 each exhibit a symmetric phase (0;0) and the intron within the conjugase domain is in the same position as that in A. gambiae Morgue. Other domain distributions are also observed. In the I. scapularis morgue gene, exon 1 encodes both the NH2 region and zinc finger; exon 2 encodes most of Spacer A; exon 3 encodes the F box; exon 4 encodes Spacer B; and exons 5, 6, and 7 together encode the conjugase domain.

FIG. 8.
Morgue homologs exhibit distinct numbers and positions of introns within the protein-coding region. Schematic depictions are presented of the Morgue proteins from several Arthropods: P. humanus (P.h.), Drosophila melanogaster (D.m.), Anopheles gambiae ...

As C. salei Morgue consists of only the variant conjugase domain, it was of particular interest to examine the organization of the corresponding gene. We determined that the C. salei Morgue–coding region is distributed over two exons separated by a single 2.2-kb phase 2 intron that is located in a distinctive position 25 amino acids upstream of the active site glycine (fig. 8). Among other species, only the other chelicerate, I. scapularis, shares an intron in this position. However, in I. scapularis, the conjugase domain is further disrupted by a second intron downstream of the active site glycine. This second intron is absent in C. salei Morgue but is present in several other arthropod Morgues. In general, the exon organization of the Morgue conjugase domain is distinct from other E2 conjugases. For example, there are no equivalent introns in the D. melanogaster UbcD1/Effete or C. elegans Let-70 genes which both have five coding exons.

Discussion

Mosaic Phylogenetic Distribution of Morgue

Given the unique composition of the Morgue protein, elucidation of its evolutionary origins could provide novel insights into ubiquitination processes. Previously, Morgue could only be identified in two insects, D. melanogaster and A. gambiae (Schreader et al. 2003), suggesting that it may have a very limited phylogenetic distribution. In this study, we make use of greatly expanded data sets for genome sequences and ESTs to identify Morgue homologs in a diverse set of metazoans within the Protostome division of the Bilateria. These organisms include members of five distinct animal phyla: the Arthropods, Nematodes, Annelids, Molluscs, and Platyhelminthes, that span both the Ecdysozoan and Spiralia/Lophotrocozoan supergroups. Morgue was neither identified in Cnidaria or Porifera nor was it unambiguously identified in any Deuterostome, including Chordates, Urochordates, Cephalochordates, or Echinoderms. Morgue therefore exhibits a widespread but restricted phylogenetic distribution that is consistent with an origin during the divergence of the Protostomes approximately 500–600 Ma. Interestingly, analysis of specific Protostome lineages suggests that morgue gene evolution has involved significant gene deletion and rearrangement events; Morgue was only identified in one Nematode species and a highly truncated Morgue protein was identified in a spider species. Taken together, these data imply that Morgue has conserved functions in specific lineages dispersed over a wide range of animals.

The similar size and organization of Morgue proteins suggest that there have been constraints both on the divergence of sequences within each domain and on the position and spacing of the domains. Overall, each of the three Morgue domains exhibits a distinct degree of sequence conservation. The NH2-terminally located zinc finger is of the C4 type and exhibits an invariant CysX2CysX12CysX2Cys arrangement. The spacing of the Cys residues and length of the finger are strictly conserved. In addition, several internal residues are nearly invariant, including Gly6, Tyr8, Gly9, Pro10, and Phe/Tyr12. This strong sequence conservation implies a specific, albeit unknown function for this motif. A similar CysX2CysX12CysX2Cys zinc finger motif is present in Alpha Co-atomer, a large WD-40 protein component of a large coat complex that forms around vesicles budding from the Golgi apparatus (Waters et al. 1991). In D. melanogaster, the zinc finger motifs of Alpha Co-atomer (CG7961) and Morgue share the four cysteines as well as the Pro10 finger residue and aromatic residues at positions 8 and 12. However, the two proteins differ in which the zinc finger motif is located at the COOH terminus of the 1,234 amino acid Alpha Co-atomer protein.

More modest sequence similarity is observed for the Morgue F box, both in comparisons between Morgue homologs and to other F-box proteins. Notably, in most Morgue homologs, there is an extended F-box region that contains a distinctive arrangement of five tryptophan residues in a stereotypic TrpX8TrpX12TrpX7TrpX11Trp motif. There is also strong conservation of specific residues around several of the tryptophans. Although this arrangement is distinctive, the Morgue F box does mediate association with the Drosophila SkpA protein (Wing et al. 2002; Giot et al. 2003). Interestingly, the Morgue F box is located in the central portion of the protein rather than at the NH2 terminus as in many other F-box proteins (reviewed in Ho et al. 2008). The Morgue variant E2 conjugase domain exhibits strong sequence conservation, and the Gly/Cys substitution is completely conserved. Strikingly, no known UEV shares this specific substitution, suggesting that the glycine residue contributes a unique and critical functional property to Morgue. Interestingly, the Morgue conjugase domain shares greater sequence conservation to enzymatically active E2s than to other UEVs and nearly all of the ubiquitin-interacting residues, with the exception of the active site cysteine, are conserved. This suggests that Morgue could noncovalently interact with ubiquitin or ubiquitin-like proteins.

Origins of C. salei Morgue

In only one species, the wandering spider C. salei, did a predicted Morgue protein clearly exhibit a distinct architecture. Cupiennius salei Morgue corresponds only to the Gly/Cys variant conjugase domain as it lacks both an F box and zinc finger. What is the basis for this distinct Morgue polypeptide? Perhaps, the different domains of Morgue are each encoded by distinct genes in C. salei, or perhaps, we have identified a specific mRNA isoform derived from a morgue gene that encodes a complete Morgue. As C. salei may have undergone a significant genome duplication event (Schwager et al. 2007), it is also possible that it possesses two morgue genes with distinct organization. Our attempts to identify an extended or alternate version of Morgue from C. salei genomic DNA or cDNA were unsuccessful and we cannot distinguish between these different possibilities. Interestingly, the Morgue homolog identified in another chelicerate, the deer tick I. scapularis, contains all three domains. The organization of C. salei Morgue may therefore be unique among chelicerates or even among spiders. It will be of interest to resolve this issue and characterize Morgue homologs in additional chelicerates. Despite extensive searches of multiple sequence data sets, no other conjugase domain-only version of Morgue was identified. Indeed, whereas several incomplete Morgue sequences were examined, no other clearly distinct Morgue organization was identified. At this point, C. salei is an interesting exception to the conserved multidomain Morgue proteins in other species and it suggests additional complexity in Morgue evolution and function.

Origins of X. index Morgue

Morgue was identified in a single member of phylum Nematoda, the clade I species X. index. Morgue was not detected in any other nematode, including additional clade I species and representatives from clades III, IVa, IVb, and V. Because the sequence data sets from clade I–IV species are in general not as complete or comprehensive as those from Clade V; it may be that Morgue gene sequences are simply not yet represented. However, at least one Clade III species that lacks Morgue, B. malayi, has quite extensive (over 8×) genome sequence coverage (Ghedin et al. 2007). There are several potential explanations for this apparent, highly restricted pattern of distribution. One possibility is that multiple gene deletion events occurred during divergence of the nematodes and these resulted in the maintenance of Morgue specifically in X. index and perhaps other isolated species. Another possibility is that Morgue was lost before the emergence of the nematodes and subsequently acquired by X. index via a horizontal gene transfer event. In this regard, preliminary efforts (Y.Z. and J.R.N.) to identify Morgue in the Xiphinema americanum species (kindly provided by J. Halbrendt) have been unsuccessful. In order to more fully illuminate the evolution of Morgue, it will be important to more fully clarify Morgue's representation within the phylum Nematoda as well as examine species from other phyla of the Cycloneuralia, including the Nematomorpha, Priapulida, Loricifera, and Kinorhyncha.

Origins of G. aculeatus Morgue

Based on previous studies (Wing et al., 2002; Schreader et al. 2003), it was quite unexpected to identify two ESTs from the threespine stickleback, G. aculeatus, which encode what appears to be a Morgue homolog with a conserved F box and variant conjugase domain. This result suggests that Morgue may be present in a specific vertebrate species. However, there are several reasons to be cautious in this interpretation. For example, corresponding G. aculeatus genomic sequences encoding Morgue were not identified. Although this absence could simply indicate that the corresponding morgue gene resides in a genomic interval that has not been sequenced, the genome of G. aculeatus has received 9× coverage (http://www.broad.mit.edu/node/439). It is also possible that the EST/genomic DNA discrepancy reflects a difference between the sticklebacks used to obtain these sequences. In this regard, the genomic DNA and EST projects utilized distinct strains of G. aculeatus (http://www.ensembl.org/Gasterosteus_aculeatus/Info/Index). In particular, the genomic DNA derived from a freshwater aquatic strain from Bear Paw Lake in Alaska, whereas the cDNA library was generated from a marine strain from the Bitrufjordur fiord in Iceland. These stickleback strains have undergone significant morphological divergence and radiation (reviewed in Peichel 2005), and thus, it is possible that the marine strain but not the aquatic strain possesses a morgue gene. However, Morgue is not found in any other vertebrate, including several fish species. Thus, the marine stickleback strain either retained a morgue gene that was lost in vertebrates including other sticklebacks or it gained a morgue gene via a horizontal gene transfer from an invertebrate. A marine stickleback-specific retention of morgue is highly unlikely, and although horizontal gene transfer is a possibility, we did not identify the Morgue sequence from Bitrufjordur strain genomic DNA (kindly provided by David Kingsley). A more plausible explanation is that G. aculeatus Morgue does not correspond to a bona fide stickleback gene but, instead, derives from contaminating molecules present in the cDNA library generated from the larval fish mRNA. The source of such molecules could include live brine shrimp food source (Kingsley D, personal communication) or perhaps a stickleback parasite such as a trematode fluke, nematode, and crustacean (Morozińska-Gogol 2006). At this point, the origin of the stickleback morgue ESTs is not fully resolved.

morgue Gene Evolution

The process of exon shuffling facilitates formation of chimeric genes that encode multidomain proteins (reviewed by Long 2001; Long et al. 2003; Babushok et al. 2007). Functional juxtaposition of exons is facilitated by exons with a symmetric phase that can insert into a similar phase intron without disrupting an open reading frame. Analysis of morgue gene organization in divergent species suggests that morgue gene evolution involved exon shuffling events. In D. melanogaster, P. humanus, and E. multilocularis, the zinc finger, F box, and variant conjugase domain are all encoded by a single exon. In contrast, in T. castaneum, D. pulex, and I. scapularis, the zinc finger and F box are instead each encoded by an individual exon, and the variant conjugase domain is encoded by two exons. Anopheles gambiae Morgue represents an intermediate condition where the zinc finger and most of the F box are encoded together, and the variant conjugase domain is encoded by two distinct exons. Thus, morgue genes exhibit several hallmarks of exon shuffling. They encode a multidomain protein where discrete symmetric phase exons may correspond to individual or multiple domains. In addition, the Morgue spacers are also often encoded by symmetric phase exons.

No other UEV contains a glycine in the active site and Morgue is most similar to other bona fide E2 conjugases including D. melanogater UbcD1/Effete, an E2 that also associates with DIAP1 and influences apoptosis (Ryoo et al. 2002). These data suggest that the Morgue conjugase domain likely derived from a catalytically active E2 rather than another UEV. However, comparisons of the exon/intron organization of the Morgue conjugase domain and other E2s did not reveal close similarities and no apparent progenitor of the Morgue conjugase domain was identified. The strict conservation of the glycine in the conjugase active site strongly suggests that this residue provides a specific and important functional attribute. One possibility is that it may provide substrate recognition properties if Morgue functions as an F-box protein.

Potential Conserved Functions of Morgue

Individual cells within all metazoans and many unicellular organisms can undergo programmed death in response to environmental signals or alterations in internal physiological homeostasis (reviewed in Deponte 2008). Many of the mechanisms of cell death as well as the effector molecules are highly conserved. Yet, despite its fundamental nature, there exist important variations in the cell death pathways utilized by different organisms, such as differences in the roles of the mitochondria as well as IAPs and IAP antagonists (reviewed in Kornbluth and White 2005). Morgue has been shown to facilitate apoptosis and modulate the levels of DIAP1 (Hays et al. 2002; Wing et al. 2002). The widespread but restricted distribution of Morgue suggests that these functions are conserved but utilized only by a subset of metazoans organisms. Does this mosaic distribution reflect bona fide differences in cell death processes that either do or do not involve Morgue or are Morgue functions subserved by other proteins in some species? This distribution pattern could also, or instead, reflect activities of Morgue in alternate processes. Consistent with this possibility, Morgue has also been shown to influence circadian rhythmicity in Drosophila (Murad et al. 2007), another process that involves regulated ubiquitination and protein turnover (Chiu et al. 2008). Nonetheless, it is surprising that Morgue exhibits distinct distribution in closely aligned species. Does Morgue act to modulate conserved ubiquitination processes and/or does it provide novel species-specific activities? Resolution of these issues requires additional investigation into Morgue's biochemical function and evolution. Such studies may shed additional insights into the mechanisms and evolution of ubiquitination in fundamental processes such as programmed cell death and circadian rhythms.

Supplementary Materials

Supplementary figures 16 are available at Molecular Biology and Evolution online (http://www.mbe.oxfordjournals.org/)

[Supplementary Data]

Acknowledgments

This work was supported by the National Institutes of Health (RO1 AG025866-01A1 to J.R.N.). We are grateful to Gregg Brennan, Sean Maguire, Andrew Kalaydjian, Lisa Carvalho, and Osarhieme Aghayere for their efforts with various aspects of this work. We greatly appreciate generous assistance from Wim Damen, Michael Akam, Carlo Brena, David Towle, Chris Smith, David Kingsley, Clemens Schaber, Lucia Kuhn-Nentwig, Friedrich Barth, Elisabeth Fritz, John Halbrendt, and Irina Ronko in supplying us with various live organisms, tissue samples, DNA and RNA samples, and DNA libraries. We thank Vish Nene for assistance with analysis of the I. scapularis Morgue sequence. We are grateful to Kelly A. McKeown, Barbara A. Schreader, John P. Wing, and Lei Zhou for critical reading of the manuscript and James Gary for allowing us to use the adaptation in figure 2.

References

  • Andret-Link P, Schmitt-Keichinger C, Demangeat G, Komar V, Fuchs M. The specific transmission of Grapevine fanleaf virus by its nematode vector Xiphinema index is solely determined by the viral coat protein. Virology. 2004;320:12–22. [PubMed]
  • Babushok DV, Ostertag EM, Kazazian HH., Jr Current topics in genome evolution: molecular mechanisms of new gene formation. Cell Mol Life Sci. 2007;64:542–554. [PubMed]
  • Blaxter ML, De Ley P, Garey JR, et al. (12 co-authors) A molecular evolutionary framework for the phylum Nematoda. Nature. 1998;392:71–75. [PubMed]
  • Carranza S, Baguñà J, Riutort M. Are the Platyhelminthes a monophyletic primitive group? Mol Biol Evol. 2008;14:485–497. [PubMed]
  • Chiu JC, Vanselow JT, Kramer A, Edery I. The phospho-occupancy of an atypical SLIMB-binding site on PERIOD that is phosphorylated by DOUBLETIME controls the pace of the clock. Genes Dev. 2008;22:1758–1772. [PubMed]
  • Deponte M. Programmed cell death in protists. Biochim Biophys Acta. 2008;1783:1396–1405. [PubMed]
  • DeSalle R, Schierwater B. An even “newer” animal phylogeny. Bioessays. 2008;30:1043–1047. [PubMed]
  • Dunn CW, Hejnol A, Matus DQ, et al. (18 co-authors) Broad phylogenomic sampling improves resolution of the animal tree of life. Nature. 2008;452:745–749. [PubMed]
  • Furtado DR, de Oliveira FM, Morales FC, Fantappié MR, Rumjanek FD. Schistosoma mansoni: SmLIMPETin, a member of a novel family of invertebrate-only regulatory proteins. Exp Parasitol. 2008;120:200–204. [PubMed]
  • Ghedin E, Wang S, Spiro D, et al. (71 co-authors) Draft genome of the filarial nematode parasite Brugia malayi. Science. 2007;317:1756–1760. [PMC free article] [PubMed]
  • Giot L, Bader JS, Brouwer C, et al. (49 co-authors) A protein interaction map of Drosophila melanogaster. Science. 2003;302:1727–1736. [PubMed]
  • Glickman MH, Ciechanover A. The ubiquitin-proteasome proteolytic pathway: destruction for the sake of construction. Physiol Rev. 2002;82:373–428. [PubMed]
  • Halanych KM. The new view of animal phylogeny. Ann Rev Ecol Evol. Syst. 2004;35:229–256.
  • Hamilton KS, Ellison MJ, Barber KR, Williams RS, Huzil JT, McKenna S, Ptak C, Glover M, Shaw GS. Structure of a conjugating enzyme-ubiquitin thiolester intermediate reveals a novel role for the ubiquitin tail. Structure. 2001;9:897–904. [PubMed]
  • Hays R, Wickline L, Cagan R. Morgue mediates apoptosis in the Drosophila melanogaster retina by promoting degradation of DIAP1. Nat Cell Biol. 2002;4:425–431. [PubMed]
  • Hershko A, Ciechanover A. The ubiquitin system. Annu Rev Biochem. 1998;67:425–479. [PubMed]
  • Ho MS, Ou C, Chan YR, Chien CT, Pi H. The utility F-box for protein destruction. Cell Mol Life Sci. 2008;65:1977–2000. [PubMed]
  • Hofmann RM, Pickart CM. Noncanonical MMS2-encoded ubiquitin-conjugating enzyme functions in assembly of novel polyubiquitin chains for DNA repair. Cell. 1999;96:645–53. [PubMed]
  • Hurley JH, Lee S, Prag G. Ubiquitin-binding domains. Biochem J. 2006;399:361–372. [PubMed]
  • Kornbluth S, White K. Apoptosis in Drosophila: neither fish nor fowl (nor man, nor worm) J Cell Sci. 2005;118:1779–1787. [PubMed]
  • Lee I, Shinedelin H. Structural insights into E1-catalyzed ubiquitin activation and transfer to conjugating enzymes. Cell. 2008;134:268–278. [PubMed]
  • Long M. Evolution of novel genes. Curr Opin Genet Dev. 2001;11:673–680. [PubMed]
  • Long M, Betrán E, Thornton K, Wang W. The origin of new genes: glimpses from the young and old. Nat Rev Genet. 2003;4:865–875. [PubMed]
  • Mallatt J, Giribet G. Further use of nearly complete 28S and 18S rRNA genes to classify Ecdysozoa: 37 more arthropods and a kinorhynch. Mol Phylogenet Evol. 2006;40:772–794. [PubMed]
  • Mallatt JM, Garey JR, Shultz JW. Ecdysozoan phylogeny and Bayesian inference: first use of nearly complete 28S and 18S rRNA gene sequences to classify the arthropods and their kin. Mol Phylogenet Evol. 2004;31:178–191. [PubMed]
  • Martin P. On the origin of the Hirudinea and the demise of the Oligochaeta. Proc Biol Sci. 2001;268:1089–1098. [PMC free article] [PubMed]
  • Morozińska-Gogol J. A checklist of parasites recorded on sticklebacks (Actinopterygii: Gasterosteidae) from Poland. Parasitol Int. 2006;55:69–73. [PubMed]
  • Murad A, Emery-Le M, Emery P. A subset of dorsal neurons modulates circadian behavior and light responses in Drosophila. Neuron. 2007;53:689–701. [PMC free article] [PubMed]
  • Ni T, Li W, Zou F. The ubiquitin ligase ability of IAPs regulates apoptosis. IUBMB Life. 2005;57:779–785. [PubMed]
  • Nishimura K, Hung T. Current views on geographic distribution and modes of infection of neurohelminthic diseases. J Neurol Sci. 1997;145:5–14. [PubMed]
  • Peichel CL. Fishing for the secrets of vertebrate evolution in threespine sticklebacks. Dev Dyn. 2005;234:815–823. [PubMed]
  • Pickart CM. Mechanisms underlying ubiquitination. Annu Rev Biochem. 2001;70:503–533. [PubMed]
  • Pickart CM, Eddins MJ. Ubiquitin: structures, functions, mechanisms. Biochim Biophys Acta. 2004;1695:55–72. [PubMed]
  • Rose I. Ubiquitin at Fox Chase. Cell Death Differ. 2005;12:1198–1201. [PubMed]
  • Ryoo HD, Bergmann A, Gonen H, Ciechanover A, Steller H. Regulation of Drosophila IAP1 degradation and apoptosis by reaper and ubcD1. Nat Cell Biol. 2002;4:432–438. [PubMed]
  • Schreader BA, Wang Y, Nambu JR. Drosophila morgue and the intersection between protein ubiquitination and programmed cell death. Apoptosis. 2003;8:129–139. [PubMed]
  • Schwager EE, Schoppmeier M, Pechmann M, Damen WG. Duplicated Hox genes in the spider Cupiennius salei. Front Zool. 2007;13:4–10. [PMC free article] [PubMed]
  • Siddall ME, Apakupakul K, Burreson EM, Coates KA, Erséus C, Gelder SR, Källersjö M, Trapido-Rosenthal H. Validating Livanow: molecular data agree that leeches, Branchiobdellidans, and Acanthobdella peledina form a monophyletic group of oligochaetes. Mol Phylogenet Evol. 2001;21:346–351. [PubMed]
  • Sigwart JD, Sutton MD. Deep molluscan phylogeny: synthesis of palaeontological and neontological data” Proc Royal Soc: Biol. 2007;274:2413–2419. [PMC free article] [PubMed]
  • Steller H. Regulation of apoptosis in Drosophila. Cell Death Differ. 2008;15:1132–1138. [PubMed]
  • Sundquist WI, Schubert HL, Kelly BN, Hill GC, Holton JM, Hill CP. Ubiquitin recognition by the human TSG101 protein. Mol Cell. 2004;13:783–739. [PubMed]
  • Thornton BR, Toczyski DP. Precise destruction: an emerging picture of the APC. Genes Dev. 2006;20:3069–3078. [PubMed]
  • Waters MG, Serafini T, Rothman JE. ‘Coatomer’: a cytosolic protein complex containing subunits of non-clathrin-coated Golgi transport vesicles. Nature. 1991;349:248–251. [PubMed]
  • Willems AR, Schwab M, Tyers M. A hitchhiker's guide to the cullin ubiquitin ligases: SCF and its kin. Biochim Biophys Acta. 2004;1695:133–170. [PubMed]
  • Wing JP, Schreader BA, Yokokura T, Wang Y, Andrews PS, Huseinovic N, Dong CK, Ogdahl JL, Schwartz LM, White K, Nambu JR. Drosophila Morgue is an F box/ubiquitin conjugase domain protein important for grim-reaper mediated apoptosis. Nat Cell Biol. 2002;4:451–456. [PubMed]
  • Xu D, Woodfield SE, Lee TV, Fan Y, Antonio C, Bergmann A. Genetic control of programmed cell death (apoptosis) in Drosophila. Fly (Austin) 2009;8 3(1) [PMC free article] [PubMed]
  • Zdobnov EM, von Mering C, Letunic I, et al. (36 co-authors) Comparative genome and proteome analysis of Anopheles gambiae and Drosophila melanogaster. Science. 2002;298:149–159. [PubMed]
  • Zheng N, Schulman BA, Song L, et al. (14 co-authors) Structure of the Cul1-Rbx1-Skp1-F box-Skp2 SCF ubiquitin ligase complex. Nature. 2002;416:703–709. [PubMed]

Articles from Molecular Biology and Evolution are provided here courtesy of Oxford University Press