PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Circ Arrhythm Electrophysiol. Author manuscript; available in PMC 2010 October 1.
Published in final edited form as:
PMCID: PMC2766080
NIHMSID: NIHMS149347
PKA-Dependent Biophysical Phenotype for V227F-KCNJ2 Mutation in Catecholaminergic Polymorphic Ventricular Tachycardia
Amanda L. Vega, PhD,1,3 David J. Tester, B.S.,2 Michael J. Ackerman, M.D., PhD.,2 and Jonathan C. Makielski, M.D.1
1 Departments of Medicine (Cardiovascular Medicine) and Physiology, University of Wisconsin, Madison Wisconsin, USA
2 Departments of Medicine, Pediatrics and Molecular Pharmacology & Experimental Therapeutics/Divisions of Cardiovascular Diseases and Pediatric, Cardiology, Mayo Clinic, Rochester Minnesota, USA
3 Department of Physiology and Biophysics, University of Washington, Seattle, Washington, USA
Reprints and Correspondence: Jonathan C. Makielski, M.D., University of Wisconsin Hospital and Clinics, Division of Cardiovascular Medicine, H6/362 MC 3248, 600 Highland Avenue, Madison, WI 53792, (608) 263-4856 phone, (608) 263-0405 FAX, jcm/at/medicine.wisc.edu
Background
KCNJ2 encodes Kir2.1, a pore-forming subunit of the cardiac inward rectifier current, IK1. KCNJ2 mutations are associated with Andersen-Tawil syndrome (ATS) and also Catecholaminergic Polymorphic Ventricular Tachycardia (CPVT). The aim of this study was to characterize the biophysical and cellular phenotype of a KCNJ2 missense mutation, V227F, found in a patient with CPVT.
Methods and Results
Kir2.1-wild type (WT) and V227F channels were expressed individually and together in Cos-1 cells to measure IK1 by voltage clamp. Unlike typical ATS-associated KCNJ2 mutations which show dominant negative loss of function, Kir2.1WT+V227F co-expression yielded IK1 indistinguishable from Kir2.1-WT under basal conditions. To simulate catecholamine activity, a PKA-stimulating cocktail comprised of forskolin and 3-isobutyl-1-methylxanthine (IBMX) was used to increase PKA activity. This PKA-simulated catecholaminergic stimulation caused marked reduction of outward IK1 compared to Kir2.1-WT. PKA-induced reduction in IK1 was eliminated by mutating the phosphorylation site at serine 425 (S425N).
Conclusions
Heteromeric Kir2.1-V227F and WT channels showed an unusual latent loss of function biophysical phenotype that depended upon PKA-dependent Kir2.1 phosphorylation. This biophysical phenotype, distinct from typical ATS mutations, suggests a specific mechanism for PKA dependent IK1 dysfunction for this KCNJ2 mutation which correlates with adrenergic conditions underlying the clinical arrhythmia.
Keywords: K-channel, arrhythmia (mechanisms), long QT syndrome, Andersen-Tawil syndrome, catecholaminergic polymorphic ventricular tachycardia
The gene KCNJ2 gene encodes the pore-forming subunit of the human inwardly rectifying potassium channel Kir2.1 which underlies the inward rectifier potassium current, IK11. Autosomal dominant loss-of-function mutations in KCNJ2 represent the solely identified cause thus far for the heritable arrhythmia syndrome called Andersen-Tawil syndrome (ATS)2 while gain-of-function mutations in KCNJ2 have been implicated in the pathogenesis of short QT syndrome (SQT3)3 and familial atrial fibrillation4. Classically, ATS presents with a triad of cardiac arrhythmia and prolonged QU intervals, dysmorphic features, and periodic paralysis. Phenotype severity among ATS patients varies5, however, with some patients presenting with only one symptom and other genotype-positive individuals completely non-penetrant.
Catecholaminergic polymorphic ventricular tachycardia (CPVT) is an inherited arrhythmia syndrome characterized by adrenergically mediated bi-directional or polymorphic ventricular tachycardia that causes syncope and sudden cardiac arrest in the absence of structural heart defects among the young6. Approximately 50–60% of CPVT patients harbor mutations in one of two critical calcium handling genes: the cardiac ryanodine receptor (RYR2)7 or calsequestrin-2 (CASQ2)8,9 while the remaining 40% have no known genetic cause10. Ventricular arrhythmias in ATS have demonstrated an uncanny similarity to the ventricular arrhythmias observed in CPVT such as bidirectional tachycardia and exercise-induced arrhythmia5. This can be a source of diagnostic confusion with CPVT. Previously, we identified mutations in KCNJ2 among 3 of 11 unrelated patients that were clinically diagnosed with CPVT11 and suggested phenotypic mimicry. Two patients had R82W, a mutation previously found in an LQTS cohort and showing a dominant-negative loss of function typical of ATS12. The other was a previously uncharacterized, missense mutation in KCNJ2 causing the valine at position 227 to be substituted by phenylalanine in Kir2.1 (Kir2.1-V227F).
Here, we characterize the biophysical and cellular phenotypes of Kir2.1-V227F and show that when co-expressed with wild-type channels (Kir2.1-WT); the mutation caused no abnormal phenotype under control conditions. However, PKA activation, a cellular consequence of adrenergic stimulation, caused a latent loss of function biophysical phenotype which was abrogated by a mutation that eliminated phosphorylation at S425 on Kir2.1. This phenotype, distinct from typical ATS mutations12, provides a new specific mechanism for PKA dependence of IK1 dysfunction for this KCNJ2 mutation in a CPVT patient.
Mutagenesis
The Kir2.1-V227F, Kir2.1-S425N and Kir2.1-AAA (AAA for pore GYG) mutations were introduced into the human Kir2.1 using a Quik Change Site-Directed Mutagenesis kit (Stratagene). The following primer pairs were used to mutate the targeted site(s) in the cDNA:
V227F-F; TTGGTGGAAGCTCATTTTCGAGCACAGCTCCTC,
V227F-R; CAGGAGCTGTGTGCTCGAAAATGAGCTTCCACCAA,
S425N-F; CGGCGAGAACGAGATATGAAAGGGC,
S425N-R; GCCCTTTCATATCTCGTTCTCTGCCCG,
AAA-F; CAGACAACCATAGCCGCTGCCTTCAGATGTGTC,
AAA-R; GACACATCTGAAGGCAGCGGCTATGGTTATGGTTGTCTG.
The S425N mutation was also introduced into the cDNA of both Kir2.1 WT and Kir2.1-V227F. Mutants were generated using the protocol outlined by the manufacturer (Stratagene). DNA integrity was verified by sequencing.
Cos-1 Transfection and Culture
Cos-1 cells were transfected (Superfect Transfection Kit, Qiagen) with Kir2.1 cDNA and cultured in modified Dulbecco’s modified Eagle’s medium (DMEM) as previously described12.
Electrophysiology
IK1 was recorded from Cos-1 cells using an Axopatch 200B amplifier (Axon Instruments) as previously described 12. The protocol for recording IK1 from Cos-1 cells was to hold the cell at a potential of −70mV and run a step protocol from −140mV to +40mV in 20mV increments for 100ms. The extracellular solution contained (in mM) 140 NaCl, 5.4 KCl, 1.8 CaCl2, 0.5 MgCl2, 5 HEPES, 0.33 NaH2PO4, 5.5 glucose and the pH adjusted to 7.4. The microelectrodes were created from borosilicate glass capillaries that after fire polishing had a resistance of 1.0–2.1 MΩ when filled with internal solution. The internal solution contained (in mM) 30 KCl, 85 K-aspartate, 5 MgCl2, 10 KH2PO4, 2 K2EGTA, 2 K2ATP, 5 HEPES and the pH adjusted to 7.2. All recordings were performed at room temperature.
A PKA cocktail (100μM Forskolin + 10μM IBMX; Sigma-Aldrich) was prepared in DMSO and diluted in bath solution. After successful whole-cell access IK1was recorded in control bath solution and the bath was immediately superfused with PKA cocktail bath solution for 5 minutes. IK1 was recorded again in the presence of the PKA cocktail and after the PKA cocktail was washed out over a 10 minute period. All currents returned to basal levels after complete washout of PKA cocktail. In a set of parallel experiments the cells were perfused for 2 hours with the PKA cocktail and compared to cells in control media.
Statistical Analysis
The key biological questions asked is whether current density at −40 mV and −60 mV (the physiological range of importance) were affected by the mutation, or by exposure to PKA. Data are expressed as means ± SEM and analyzed using unpaired Student’s t-test. Where indicated a one-way analysis of variance (ANOVA) was used to compare three means among different channel types. Values of p≤0.05 was considered to be significant.
A CPVT Patient with Kir2.1-V227F
Previously, we identified the mutation Kir2.1-V227F in a female patient referred for CPVT genetic testing11. The 32-year-old Caucasian female was genotype negative for mutations in the two CPVT-susceptibility genes (RYR2 and CASQ2) and also negative for the principal long QT syndrome susceptibility genes (LQT1–6). The patient was heterozygous for a missense mutation in the ATS-susceptibility gene KCNJ2 annotated as Kir2.1-V227F. The proband had no evidence of periodic paralysis or dysmorphism to suggest ATS. Instead, the proband had a history of exertion/emotion-triggered syncope and pre-syncope that has been documented since the age of 2. The subject also had palpitations, ventricular tachycardia and mild mitral and tricuspid insufficiency. Her resting 12-lead electrocardiogram (EKG) had U waves in Lead II (Figure 1A) and exercise stress testing revealed frequent ventricular ectopy, ventricular bigeminy, ventricular couplets, three beat runs of polymorphic ventricular tachycardia suggestive of bi-directional ventricular tachycardia and non-sustained ventricular tachycardia (Figure 1B). The proband had a defibrillator implanted and at last follow-up was taking oral bisoprolol (5 mg) to treat cardiac symptoms. The maternal family history and progeny is unremarkable, but they have not been genotyped. Paternal history is unavailable.
Figure 1
Figure 1
Twelve lead electrocardiograms (A) and selected tracings from a treadmill stress test (B) for the CPVT patient with V227F-KCNJ2 mutation. For further description see text.
Kir2.1-V227F Mutation Has a Distinct Molecular Phenotype for IK1
Expression of Kir2.1-V227F in Cos-1 cells formed functional pores in contrast to the majority of ATS-associated Kir2.1 mutant channels which show negligible current12. Inward IK1 for Kir2.1-V227F was significantly reduced by ~40% in comparison to Kir2.1-WT as shown by the current traces (Figure 2A) and summary peak current-voltage plots (Figure 2B). Over the physiological range of terminal repolarization (−40mV to −60mV), outward IK1 was decreased 85% to 99% in comparison to Kir2.1-WT (Figure 2B inset).
Figure 2
Figure 2
Kir2.1-V227F has distinct molecular phenotype for IK1. (A) Representative IK1 traces for the Kir2.1-WT, Kir2.1-V227F, and co-expressed Kir2.1-WT+Kir2.1-V227F (B) Current-voltage (IV) plots for Kir2.1-WT (closed squares; n=14), Kir2.1-V227F (closed circles; (more ...)
Kir2.1-V227F and Kir2.1-WT Interact To Form Multimeric Pore
Inward rectifier potassium channels are formed by the assembly of four subunits allowing for heteromeric pores containing both WT and mutant subunits. The patient was heterozygous with both a mutant V227F allele and a WT allele so we examined heteromeric channels by co-expression studies. In contrast to most ATS-associated Kir2.1 mutations which show a dominant negative decrease in IK15,12, IK1 from heteromeric channels produced by co-expression of Kir2.1-V227F with Kir2.1-WT was statistically indistinguishable from Kir2.1-WT (Figure 2). To exclude the possibility that this normal appearing IK1 was caused by the failure of Kir2.1-V227F to interact with Kir2.1-WT, we used a dominant-negative approach as previously described13. We introduced the dominant-negative mutation, AAA, to remove the potassium selectivity filter (GYG) in both WT and mutant cDNA. Expression of Kir2.1-AAA alone yielded no potassium currents (Figure 3) as expected. Expression of Kir2.1-AAA with Kir2.1-WT or Kir2.1-V227F both caused a strong dominant-negative reduction of IK1. These results support the idea that Kir2.1-V227F interacted with Kir2.1-WT to form a multimeric pore.
Figure 3
Figure 3
IK1 measured from Cos-1 cells transfected with the dominant negative mutation Kir2.1-AAA. (A) Representative traces from KiR2.1-AAA, co-expressed Kir2.1-WT and Kir2.1-AAA, and co-expressed Kir2.1-V227F and Ki2.1-AAA. (B) Peak current-relationships for (more ...)
Abnormal Phenotype Depends on PKA activation
The normal IK1 phenotype of Kir2.1-WT+Kir2.1-V227F under basal conditions did not leave a plausible explanation for the arrhythmia phenotype observed in the patient. The possibility of V227F being a rare variant was considered, but the mutant was absent from over 800 reference alleles10. Also the homomeric V227F currents were reduced (Figure 2) supporting the possibility of a latent pathological defect. For CPVT, increased catecholamine activity is a characteristic clinical feature for arrhythmia. Therefore, we used a PKA-activating cocktail (100μM forskolin + 10μM IBMX) in the Cos-1 cells to mimic adrenergic stimulation. IK1 was measured before and after 5 minutes of exposure to PKA activation. PKA activation caused a significant reduction (p≤0.05) of inward IK1 for Kir2.1-WT (35%), Kir2.1-V227F (35%) and Kir2.1-WT+Kir2.1-V227F (56%) in comparison to basal conditions (Figure 4). Outward IK1 in the physiological range is of particular interest. In WT channels, PKA caused an increase in outward IK1 (Figure 4B inset) whereas in the heteromeric channels outward IK1 was decreased by 73% and 68% (at −60mV and −40mV respectively, Figure 4D inset). The vehicle control solution (DMSO 1%) and timed control experiments (where no solution was added) showed no significant effects on IK1 (data not shown). The effects on IK1 were reversible after a 10 minute washout (data not shown). After longer exposure to PKA stimulation (2 hours) the outward IK1 of Kir2.1-WT channels was not affected, but heteromeric channels showed (Figure 5) a significant decrease in agreement with experiments after 5 minutes exposure.
Figure 4
Figure 4
PKA activation reduced outward IK1 for heteromeric Kir2.1 WT+V227F channels. From each cell, a complete IV plot was obtained before (closed symbols) and after (open symbols) five minutes of PKA activation. (A) Representative current after (bottom row) (more ...)
Figure 5
Figure 5
PKA activation reduced outward IK1 for heteromeric Kir2.1 WT+V227F channels after 2 hours of PKA activation. Cells were incubated in control solutions or PKA activations solutions for 2 hours then patch-clamped to measure IK1 density. (N numbers in parentheses, (more ...)
Mutation of Serine 425 on Kir2.1 Abrogates PKA Effect
We hypothesized the PKA induced effects on IK1 density were mediated by a direct phosphorylation of the channel. The single known PKA consensus motif, S425 on Kir2.1 has been shown to regulate PKA effects on IK114. We mutated S425 to an asparagine (S425N) in both Kir2.1-WT and Kir2.1-V227F to prevent phosphorylation. The introduced mutation had no impact on Kir2.1-WT function in the absence of PKA (data not shown) and prevented PKA-mediated effects on homomeric Kir2.1-WT channels (Figure 6A and 6B) in agreement with previously published results14. The S425N mutation abrogated the PKA mediated inhibition of IK1 for heteromeric WT and V227F channels when it was present on all subunits (Figure 6C). The PKA-mediated reduction of heteromeric channel current densities was restored if a serine at position 425 was available if it was on the WT subunit (Figure 6D) or the mutant subunit (data not shown). This would suggest only one subunit, whether WT or V227F, needs to be phosphorylated for the PKA effect. These results support the idea that the pathogenic molecular phenotype depends upon PKA-mediated phosphorylation at residue S425.
Figure 6
Figure 6
PKA consensus site S425 required for PKA-mediated effects on Kir2.1 channels. (A) Representative IK1 traces of Kir2.1-S425N, Kir2.1-S425N+Kir2.1- V227F/S425N and Kir2.1-WT+Kir2.1-V227F/S425N in the presence or absence of the PKA activation (B) IV plot (more ...)
A “latent” PKA-dependent dysfunctional biophysical phenotype for Kir2.1-V227F
The predominant molecular phenotype for KCNJ2 mutations associated with ATS is a dominant-negative decrease in IK1 when expressed with WT subunits (see5 and12 for reviews). Kir2.1-V227F showed no effect on IK1 when co-expressed with WT (Figure 2) and joins only R67Q12 and P351S15 as examples of KCNJ2 mutations identified from cardiac arrhythmia patients that have a “WT-like phenotype” when expressed in heterologous systems (Figure 2). Mindful of the clinical CPVT presentation, we tested the hypothesis that a β-adrenergic input as mimicked by PKA stimulation would induce channel dysfunction of heteromeric Kir2.1-WT and V227F channels. We found a latent PKA-dependent pathological phenotype where a profound loss of outward IK1 depended upon PKA activation (Figure 4).
Environmental and regulatory factors have been previously reported to trigger or exacerbate inherited arrhythmia. For example, increased temperature exacerbated an already abnormal biophysical phenotype in Brugada syndrome16,17 and in LQT218. More germane to our case, PKA stimulation has been reported to worsen the phenotype for mutant CPVT RYR2 channels19. It is unusual, however, for a channel with an arrhythmia causing mutation to exhibit a completely WT phenotype. Such a latent pathogenic biophysical phenotype has a precedent in the cardiac Na channel, where low pH was required to elicit an abnormal late current in sudden infant death syndrome20,21. Kir2.1-V227F provides an unusual example of a mutation that depends upon PKA-dependent phosphorylation to manifest a latent and potentially pathogenic phenotype.
β-Adrenergic Modulation of IK1 in heart
Heteromeric Kir2.1-WT+Kir2.1-V227F channels expressed in Cos-1 had significantly reduced function in the presence of PKA (Figure 4) that depend upon phosphorylation at S425 (Figure 6). The few reports available for PKA effects on Kir2.1-WT channels have contradictory results including activation following application of PKA in Xenopus oocytes 22 and CHO cells23, no effect in studies of bovine pulmonary artery endothelial cells24, and inhibition in Cos-7 cells14. Our results support observations made by Wischmeyer et al 14 possibly because the cell model and experimental approach were similar. Of the four members of the Kir2. x family, three (Kir2.1, Kir2.2, Kir2.3) are known to be expressed in the human heart1,25 and underlie cardiac IK126. They are likely to form heteromers that affect function, including response to phosphorylation, so that our results using only Kir2.1 in heterologous systems may not fully recapitulate the effects in native tissue. In native tissue, isoproterenol or PKA has been reported to decrease IK1 in canine Purkinje fibers27, and guinea pig28 and human29 ventricular myocytes, and to have no effect on rat30 and bull-frog atrial cells31.
IK1 Adrenergic/Ca2+ mediated Arrhythmia and CPVT
Decreased IK1 is postulated to play a role in Ca2+-dependent and triggered arrhythmia based on studies in a rabbit model of heart failure32. Loss of IK1 results in membrane “de-stabilization” caused by a reduction in outward current opposing pathogenic transient inward currents. A computer simulation of decreased IK1 showed prolonged action potentials, depolarized resting membrane potential, and EADs, with delayed afterdepolarizations (DADs) emerging after simulated β-adrenergic activity33. A computer simulation study of the ATS mutation D71V in KCNJ2 showed prolonged QT interval34 but no transmural dispersion of repolarization. In addition, the canine arterial wedge preparation model using barium to block IK1 failed to generate EADs, dispersion of repolarization, or sustained arrhythmia despite provocation with isoproterenol and low K+35, but in a similar model IK1 block by Cs+ caused DADs and VT was eliminated by verapamil36. Together these results support a role generally for IK1 in adrenergically-mediated Ca-dependent arrhythmia. Our results with V227F suggest a special direct role of adrenergic stimulation for this mutation. We cannot, however, on the basis of this single patient, say how this novel biophysical phenotype affects the clinical phenotype. For example other mutations that show a dominant negative pattern such as R82W also are adrenergic-dependent11. Adrenergic effects outside of the channel (for example on Ca handling) may in combination with a fixed Kir2.1 deficit make the arrhythmia adrenergic dependent. The adrenergic dependence of the clinical phenotype of Kir2.1 mutations is likely to represent a spectrum.
Kir-V227F – ATS1 or CPVT3?
The patient presented with a diagnosis of CPVT and had clinical features of CPVT and none for ATS aside from arrhythmia. Approximately 50–60% of CPVT cases are caused by mutations in either RYR2 7 or CASQ28,9 while the remaining 40% have are genoptype negative10. Genetic screening of patients diagnosed with CPVT and genotype-negative for RYR2 or CASQ2 have identified mutations in KCNJ237,11,38, a gene that has been previously well established as a cause of the pleiotropic ATS5. The discovery of KCNJ2 mutations in CPVT patients has been described as phenotypic mimicry11 and considered within the variable presentation of ATS5. The latent biophysical phenotype of Kir2.1-V227F, however, poses a possibly distinct mechanistic classification. Unlike other ATS mutations where the defect is always present, the abnormal phenotype would be predicted to be present only transiently under conditions of adrenergic stress. It can be speculated that a transient defect might preclude development of dysmorphic features characteristic of ATS which presumably requires a fixed loss of function during development. Moreover, a permanent defect might be more likely to promote compensatory mechanisms that would ameliorate the defect. Resolving these questions of mechanism and classification will require additional clinical and basic information on additional mutations showing this mechanism.
Caveats and summary
The Kir2.1-V227F mutation found in a patient with CPVT shows an unusual latent biophysical phenotype where loss-of-function occurred only with PKA stimulation, suggesting a direct link with the adrenergic dependence of the clinical phenotype. We showed that phosphorylation on S425 of one subunit of Kir2.1 was both necessary and sufficient for the effect. Although this new biophysical phenotype is of interest, the effects of this mutation on action potential and arrhythmogenesis in myocardial cells and transgenic animals will be required to further confirm and elucidate the mechanism. Also, at this report, this is a single case and the importance and implications for the classification of KCNJ2 mutations in CPVT are not clear.
Acknowledgments
The authors thank Drs. Lee Eckhardt and Carmen Valdivia for valuable discussion and technical assistance.
Sources of Funding: Support was provided by the UW Cellular and Molecular Arrhythmia Research Program and the Mayo Clinic Windland Smith Rice Comprehensive Sudden Cardiac Death Research program. AV received support from the National Heart, Lung, and Blood Institute T32 HL07936 (JCM PI) and the Graduate School of the University of Wisconsin.
Footnotes
KCNJ2 encodes Kir2.1, a pore-forming subunit of the cardiac inward rectifier current, IK1 that contributes to maintenance of the resting potential and to termination of the action potential. KCNJ2 mutations are associated with Andersen-Tawil syndrome (ATS) and also Catecholaminergic Polymorphic Ventricular Tachycardia (CPVT). This study characterized the IK1 currents of a particular novel KCNJ2 missense mutation found in a patient with CPVT and showed that, unlike previously characterized KCNJ2 arrhythmia mutations, this mutation required PKA stimulation (a downstream effect of adrenergic stimulation) to show the biophysical phenotype of IK1 abnormality usually associated with arrhythmia. This PKA-dependence of the biophysical phenotype directly correlates with the adrenergic dependence of the CPVT clinical phenotype and has implications for the classification and pathophysiology of these inherited arrhythmias.
Disclosures: MJA is a consultant to PGx Health.
1. Wible BA, De Biasi M, Majumder K, Taglialatela M, Brown AM. Cloning and functional expression of an inwardly rectifying K+ channel from human atrium. Circ Res. 1995;76:343–350. [PubMed]
2. Plaster NM, Tawil R, Tristani-Firouzi M, Canun S, Bendahhou S, Tsunoda A, Donaldson MR, Iannaccone ST, Brunt E, Barohn R, Clark J, Deymeer F, George AL, Fish FA, Hahn A, Nitu A, Ozdemir C, Serdaroglu P, Subramony SH, Wolfe G, Fu YH, Ptacek LJ. Mutations in Kir2.1 cause the developmental and episodic electrical phenotypes of Andersen’s syndrome. Cell. 2001;105:511–519. [PubMed]
3. Priori SG, Pandit SV, Rivolta I, Berenfeld O, Ronchetti E, Dhamoon A, Napolitano C, Anumonwo J, di Barletta MR, Gudapakkam S, Bosi G, Stramba-Badiale M, Jalife J. A novel form of short QT syndrome (SQT3) is caused by a mutation in the KCNJ2 gene. Circ Res. 2005;96:800–807. [PubMed]
4. Xia M, Jin Q, Bendahhou S, He Y, Larroque MM, Chen Y, Zhou Q, Yang Y, Liu Y, Liu B, Zhu Q, Zhou Y, Lin J, Liang B, Li L, Dong X, Pan Z, Wang R, Wan H, Qiu W, Xu W, Eurlings P, Barhanin J, Chen Y. A Kir2.1 gain-of-function mutation underlies familial atrial fibrillation. Biochem Biophys Res Commun. 2005;332:1012–1019. [PubMed]
5. Donaldson MR, Yoon G, Fu YH, Ptacek LJ. Andersen-Tawil syndrome: a model of clinical variability, pleiotropy, and genetic heterogeneity. Ann Med. 2004;36 (Suppl 1):92–97. [PubMed]
6. Leenhardt A, Lucet V, Denjoy I, Grau F, Ngoc DD, Coumel P. Catecholaminergic polymorphic ventricular tachycardia in children. A 7-year follow-up of 21 patients. Circulation. 1995;91:1512–1519. [PubMed]
7. Priori SG, Napolitano C, Memmi M, Colombi B, Drago F, Gasparini M, DeSimone L, Coltorti F, Bloise R, Keegan R, Cruz Filho FE, Vignati G, Benatar A, DeLogu A. Clinical and molecular characterization of patients with catecholaminergic polymorphic ventricular tachycardia. Circulation. 2002;106:69–74. [PubMed]
8. Lahat H, Eldar M, Levy-Nissenbaum E, Bahan T, Friedman E, Khoury A, Lorber A, Kastner DL, Goldman B, Pras E. Autosomal recessive catecholamine- or exercise-induced polymorphic ventricular tachycardia: clinical features and assignment of the disease gene to chromosome 1p13–21. Circulation. 2001;103:2822–2827. [PubMed]
9. Postma AV, Denjoy I, Hoorntje TM, Lupoglazoff JM, Da Costa A, Sebillon P, Mannens MM, Wilde AA, Guicheney P. Absence of calsequestrin 2 causes severe forms of catecholaminergic polymorphic ventricular tachycardia. Circ Res. 2002;91:e21–e26. [PubMed]
10. Lehnart SE, Ackerman MJ, Benson DW, Jr, Brugada R, Clancy CE, Donahue JK, George AL, Jr, Grant AO, Groft SC, January CT, Lathrop DA, Lederer WJ, Makielski JC, Mohler PJ, Moss A, Nerbonne JM, Olson TM, Przywara DA, Towbin JA, Wang LH, Marks AR. Inherited arrhythmias: a National Heart, Lung, and Blood Institute and Office of Rare Diseases workshop consensus report about the diagnosis, phenotyping, molecular mechanisms, and therapeutic approaches for primary cardiomyopathies of gene mutations affecting ion channel function. Circulation. 2007;116:2325–2345. [PubMed]
11. Tester DJ, Arya P, Will M, Haglund CM, Farley AL, Makielski JC, Ackerman MJ. Genotypic heterogeneity and phenotypic mimicry among unrelated patients referred for catecholaminergic polymorphic ventricular tachycardia genetic testing. Heart Rhythm. 2006;3:800–805. [PubMed]
12. Eckhardt LL, Farley AL, Rodriguez E, Ruwaldt K, Hammill D, Tester DJ, Ackerman MJ, Makielski JC. KCNJ2 mutations in arrhythmia patients referred for LQT testing: a mutation T305A with novel effect on rectification properties. Heart Rhythm. 2007;4:323–329. [PMC free article] [PubMed]
13. Herskowitz I. Functional inactivation of genes by dominant negative mutations. Nature. 1987;329:219–222. [PubMed]
14. Wischmeyer E, Karschin A. Receptor stimulation causes slow inhibition of IRK1 inwardly rectifying K+ channels by direct protein kinase A-mediated phosphorylation. Proc Natl Acad Sci U S A. 1996;93:5819–5823. [PubMed]
15. Haruna Y, Kobori A, Makiyama T, Yoshida H, Akao M, Doi T, Tsuji K, Ono S, Nishio Y, Shimizu W, Inoue T, Murakami T, Tsuboi N, Yamanouchi H, Ushinohama H, Nakamura Y, Yoshinaga M, Horigome H, Aizawa Y, Kita T, Horie M. Genotype-phenotype correlations of KCNJ2 mutations in Japanese patients with Andersen-Tawil syndrome. Hum Mutat. 2007;28:208–216. [PubMed]
16. Dumaine R, Towbin JA, Brugada P, Vatta M, Nesterenko DV, Nesterenko VV, Brugada J, Brugada R, Antzelevitch C. Ionic mechanisms responsible for the electrocardiographic phenotype of the Brugada syndrome are temperature dependent. Circ Res. 1999;85:803–809. [PubMed]
17. Mok NS, Priori SG, Napolitano C, Chan NY, Chahine M, Baroudi G. A newly characterized SCN5A mutation underlying Brugada syndrome unmasked by hyperthermia. J Cardiovasc Electrophysiol. 2003;14:407–411. [PubMed]
18. Amin AS, Herfst LJ, Delisle BP, Klemens CA, Rook MB, Bezzina CR, Underkofler HA, Holzem KM, Ruijter JM, Tan HL, January CT, Wilde AA. Fever-induced QTc prolongation and ventricular arrhythmias in individuals with type 2 congenital long QT syndrome. J Clin Invest. 2008;118:2552–2561. [PMC free article] [PubMed]
19. Lehnart SE, Wehrens XH, Laitinen PJ, Reiken SR, Deng SX, Cheng Z, Landry DW, Kontula K, Swan H, Marks AR. Sudden death in familial polymorphic ventricular tachycardia associated with calcium release channel (ryanodine receptor) leak. Circulation. 2004;109:3208–3214. [PubMed]
20. Plant LD, Bowers PN, Liu Q, Morgan T, Zhang T, State MW, Chen W, Kittles RA, Goldstein SA. A common cardiac sodium channel variant associated with sudden infant death in African Americans, SCN5A S1103Y. J Clin Invest. 2006;116:430–435. [PMC free article] [PubMed]
21. Wang DW, Desai RR, Crotti L, Arnestad M, Insolia R, Pedrazzini M, Ferrandi C, Vege A, Rognum T, Schwartz PJ, George AL., Jr Cardiac sodium channel dysfunction in sudden infant death syndrome. Circulation. 2007;115:368–376. [PubMed]
22. Fakler B, Brandle U, Glowatzki E, Zenner HP, Ruppersberg JP. Kir2.1 inward rectifier K+ channels are regulated independently by protein kinases and ATP hydrolysis. Neuron. 1994;13:1413–1420. [PubMed]
23. Malinowska DH, Sherry AM, Tewari KP, Cuppoletti J. Gastric parietal cell secretory membrane contains PKA- and acid-activated Kir2.1 K+ channels. Am J Physiol Cell Physiol. 2004;286:C495–C506. [PubMed]
24. Kamouchi M, Van Den BK, Eggermont J, Droogmans G, Nilius B. Modulation of inwardly rectifying potassium channels in cultured bovine pulmonary artery endothelial cells. J Physiol. 1997;504 (Pt 3):545–556. [PubMed]
25. Ashen MD, O’Rourke B, Kluge KA, Johns DC, Tomaselli GF. Inward rectifier K+ channel from human heart and brain: cloning and stable expression in a human cell line. Am J Physiol. 1995;268:H506–H511. [PubMed]
26. Zaritsky JJ, Redell JB, Tempel BL, Schwarz TL. The consequences of disrupting cardiac inwardly rectifying K(+) current (I(K1)) as revealed by the targeted deletion of the murine Kir2.1 and Kir2.2 genes. J Physiol. 2001;533:697–710. [PubMed]
27. Tromba C, Cohen IS. A novel action of isoproterenol to inactivate a cardiac K+ current is not blocked by beta and alpha adrenergic blockers. Biophys J. 1990;58:791–795. [PubMed]
28. Koumi S, Wasserstrom JA, Ten Eick RE. Beta-adrenergic and cholinergic modulation of inward rectifier K+ channel function and phosphorylation in guinea-pig ventricle. J Physiol. 1995;486 (Pt 3):661–678. [PubMed]
29. Koumi S, Backer CL, Arentzen CE, Sato R. beta-Adrenergic modulation of the inwardly rectifying potassium channel in isolated human ventricular myocytes. Alteration in channel response to beta-adrenergic stimulation in failing human hearts. J Clin Invest. 1995;96:2870–2881. [PMC free article] [PubMed]
30. Sonoyama K, Ninomiya H, Igawa O, Kaetsu Y, Furuse Y, Hamada T, Miake J, Li P, Yamamoto Y, Ogino K, Yoshida A, Taniguchi S, Kurata Y, Matsuoka S, Narahashi T, Shiota G, Nozawa Y, Matsubara H, Horiuchi M, Shirayoshi Y, Hisatome I. Inhibition of inward rectifier K+ currents by angiotensin II in rat atrial myocytes: lack of effects in cells from spontaneously hypertensive rats. Hypertens Res. 2006;29:923–934. [PubMed]
31. Giles W, Nakajima T, Ono K, Shibata EF. Modulation of the delayed rectifier K+ current by isoprenaline in bull-frog atrial myocytes. J Physiol. 1989;415:233–249. [PubMed]
32. Pogwizd SM, Schlotthauer K, Li L, Yuan W, Bers DM. Arrhythmogenesis and contractile dysfunction in heart failure: Roles of sodium-calcium exchange, inward rectifier potassium current, and residual beta-adrenergic responsiveness. Circ Res. 2001;88:1159–1167. [PubMed]
33. Sung RJ, Wu SN, Wu JS, Chang HD, Luo CH. Electrophysiological mechanisms of ventricular arrhythmias in relation to Andersen-Tawil syndrome under conditions of reduced IK1: a simulation study. Am J Physiol Heart Circ Physiol. 2006;291:H2597–H2605. [PubMed]
34. Seemann G, Sachse FB, Weiss DL, Ptacek LJ, Tristani-Firouzi M. Modeling of IK1 mutations in human left ventricular myocytes and tissue. Am J Physiol Heart Circ Physiol. 2007;292:H549–H559. [PubMed]
35. Tsuboi M, Antzelevitch C. Cellular basis for electrocardiographic and arrhythmic manifestations of Andersen-Tawil syndrome (LQT7) Heart Rhythm. 2006;3:328–335. [PMC free article] [PubMed]
36. Morita H, Zipes DP, Morita ST, Wu J. Mechanism of U wave and polymorphic ventricular tachycardia in a canine tissue model of Andersen-Tawil syndrome. Cardiovasc Res. 2007;75:510–518. [PubMed]
37. Postma AV, Bhuiyan ZA, Shkolnikova M, Denjoy I, Mannens MM, Wilde AAM, Guicheney R, Bezzina CR. Involvement Of The Kir2 Gene Family In catecholaminergic polymorphic ventricular tachycardia; analysis for mutations and identification of numerous pseudogenes. European Heart Journal. 2004;25:66–66.
38. Ruan Y, Theilade J, Memmi M, Giuli LD, Rizzi N, Cruz FE, Napolitano C, Priori SG. KCNJ2 mutations in patients referred for catecholaminergic polymorphic ventricular tachycardia gene screening. Circulation. 2007;116:492–492.