PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Am Chem Soc. Author manuscript; available in PMC 2010 October 21.
Published in final edited form as:
PMCID: PMC2764326
NIHMSID: NIHMS150000

An Allosteric Dual-DNAzyme Unimolecular Probe for Colorimetric Detection of Copper(II)

We have developed an effective molecular engineering mechanism which senses the metal ion controlled DNAzyme catalytic reactions, thus generating a sensitive metal ion sensing probe. DNAzymes are DNA sequences that catalyze chemical reactions, such as cleaving ribonucleic acid targets.1 Among the DNAzymes attracting most attention are those that are divalent metal ion cofactor-specific. Accordingly, DNAzyme-based sensors have been reported for such metal ions as Cu2+,2 Zn2+,3 Pb2+,4 Hg2+,5 UO22+,6 and Ca2+.7 Focusing on the development of DNAzyme-based probes for metal ions, many different design principles have been advanced. One strategy utilizes a molecular beacon consisting of two oligos: DNAzyme and substrate. Upon target ion binding, the dye-labeled substrates quenched by a quencher-modified DNAzyme are irreversibly cleaved and released to produce a fluorescent signal.2,4,6 Another probe design uses the conformation alteration that results from the cleavage of substrate by the DNAzyme. In this case, the horseradish peroxidase (HRP)-mimicking DNAzyme is activated by a cleavage process, thus generating colorimetric or chemiluminescence readout signals. The Willner group has made significant advancements in this field. For example, they employed Pb2+ and L-histidine-dependent DNAzymes, yielding HRP-mimicking nucleic acids that enable the colorimetric detection of Pb2+ and L-histidine,8 or used catalytic nucleic acid as labels to detect DNA and investigate the telomerase activity.9 They also designed an autonomous DNA-based machine to amplify the detection of M13 phage single-stranded DNA10 (ssDNA) and used it to detect the Hg2+ ion.11 These approaches do offer a general means of DNAzyme-based probe design, but they mostly still involve complicated modifications to DNAzyme and the hybridization of two oligos: annealing of the DNAzyme and substrate strands. These, however, are limitations that prevent applications such as on-site detection with sensitivity and stability. To address these problems, Wang et al. recently proposed covalently linking the DNAzyme and leaving a substrate fragment with polythymine to create a unimolecular beacon with a strong intramolcular interaction for lead ion monitoring.12 Herein, we report the development of a novel and versatile allosteric dual-DNAzyme unimolecular probe with simple and label-free design. As illustrated in Scheme 1, this unimolecular probe is a combination of a DNA-cleaving DNAzyme (D-DNAzyme) and a HRP-mimicking DNAzyme (H-DNAzyme), including three main components. Domain I is the substrate of DNA-DNAzyme. Domain II includes the sequence of the H-DNAzyme, and Domain III represents the D-DNAzyme. In the absence of target metal ion, these three domains act cooperatively in DNA-cleaving active state due to strong intra-molecular interaction, and the resulting structure reveals higher stability than the G-quadruplex structure (active state of H-DNAzyme). Conversely, when the probe meets its target, the cleavage of substrate by D-DNAzyme will disturb the intramolecular DNA conformation, and this event results in an allosteric transformation from the active state of D-DNAzyme to the active state of H-DNAzyme, giving, in turn, a colorimetric signal. Compared with other DNAzyme-based sensor designs, the allosteric dual-DNAzyme unimolecule strategy provides a robust and label-free probe construction by integrating DNAzyme, substrate, and signaling moiety into one molecule. This design utilizes intramolecular allosteric effect and signal amplification effect of HRP-DNAzyme such that, theoretically, the dual-DNAzyme unimolecule approach can be used for some cleaving-DNAzymes with similar structure.

Scheme 1
Schematic representation of the colorimetric detection of Cu2+ ion using the dual-DNAzyme allosteric unimolecule system. The point of scission is indicated by a black arrow. The Cu2+-dependent cleavage of substrate (Domain I) results in the formation ...

Heavy metal ion contamination has created an important public health concern in our environment and living systems. After iron and zinc, copper is the third most abundant soft transition metal ion in the human body, and it plays an important role in various biological processes under certain amount. However, because of its widespread use, copper(II) (Cu2+) also poses serious environmental problems and is potentially toxic for all the living organisms.13 As a result, there is a high demand for the development of sensitive and selective methods to detect Cu2+ ions. To demonstrate the feasibility of the dual-DNAzyme unimolecule probe strategy, the design was applied to detect the Cu2+ ion using the Cu2+-dependent nucleic acid cleaving-DNAzyme.14

We engineered the allosteric dual-DNAzyme unimolecular probe composed of Cu2+-dependent D-DNAzyme and H-DNAzyme: (Bi-Enz, 5′AGCTTCTTTCTAATACGGTGGGTAGGGCGGGTTGGGCTACCCACCTGGGCCTCTTTCTTTTTAAGAAAGAAC3′). This probe simultaneously employs two catalytic functions: 1) a Cu2+-dependent self-cleavage catalytic activity to detect Cu2+ ions (Domain III) and 2) a horseradish peroxidase (HRP)-mimicking function to give colorimetric readout signal (Domain II). Domain I, as previously noted, is the substrate of Cu2+-dependent DNAzyme. In the absence of Cu2+ ion, the probe is stabilized in triplex, the active state of Cu2+ specific DNAzyme. Specifically, in the presence of Cu2+ ions, the Bi-Enz molecule undergoes irreversible self-cleavage at the guanine base site (marked in black). The cleavage and release of Domain I results in spontaneous deformation of duplex and triplex. The resulting nucleic acid (Domain II) can then intercalate hemin, and resulting in the formation of HRP-mimicking DNAzyme under G-quadruplex self-assembly. The H-DNAzyme transduces the sensing events through the catalyzed H2O2–mediated oxidation of 3,3′,5,5′-tetramethylbenzidine (TMB) to the blue product, a bisszo benzidine compound (Fig. S1). The reaction can be halted with 2 M H2SO4, resulting in a yellow-colored product, followed by the colorimetric readout at λ=450 nm. Because the cleavage of Domain I is dependent on the concentration of the Cu2+ ions, the activity of the resulting H-DNAzyme provides a quantitative measure.

Figure 1A shows the UV-Vis absorption spectra upon analyzing different concentrations of Cu2+ ions by the dual-DNAzyme probe. As the concentration of Cu2+ ions increases, the absorbance values at 450 nm augments. However, in the absence of Cu2+ ions, control experiments showed a small absorbance signal at 450 nm (Fig. 1A, curve a), indicating that oxidation of TMB by H2O2 can also occur in the presence of Bi-Enz without Cu2+ ions. This background absorbance results from the minute folding of intact Bi-Enz molecules to G-quadruplex structure. In the presence of hemin, these folded molecules catalyze the oxidation of TMB by H2O2. As shown in Figure 1A, we observed a monotonically increasing absorbance with increasing Cu2+ concentration (0, 1 μM, 10 μM, 100 μM, 200 μM, 1 mM, and 10 mM). The absorbance changes (ΔAbs) were obtained by subtracting control samples (shown in Fig. S2). The Fig. 1B showed a good nonlinear correlation (R2=0.9994) between the ΔAbs and Cu2+ concentration over the range of 0.001–1.0 mM.

Figure 1
(A) UV-Vis absorption spectra (halting the catalytic reaction by adding H2SO4) analyzing different concentrations of Cu2+: a) 0, b) 1 μM, c) 10 μM, d) 100 μM, e) 200 μM, f) 1 mM g) 10 mM, in the presence of DNAzyme. The ...

To evaluate the specificity of sensing Cu2+ by this dual-DNAzyme probe, other environmentally relevant metal ions in aqueous solutions, including Hg2+, Mn2+, Cd2+, Pb2+, Mg2+, Zn2+, Fe2+, Ca2+, K+ and Na+, were evaluated. Figure 2 shows the absorbance changes for the dual-DNAzyme probe upon interaction with these metal ions. The minimal changes indicate good selectivity over alkali, alkaline earth, and transition heavy metal ions.

Figure 2
Selectivity of the probe towards Cu2+ by colorimetric method. The concentration of all the metal ions was 1 mM. The error bars are relative standard deviations from three repeated experiments.

To investigate if the method was applicable to real samples, we tested real and spiked river samples with different Cu2+ ion concentrations. The recoveries of standard addition were 106.1%, 112.8% and 108.3% for Cu2+ ion concentrations of 1 μM, 5μM and 10 μM, respectively, when using the colorimetric method.

To conclude, we have developed a label-free allosteric dual-DNAzyme unimolecular probe design based on the allosteric effect of unimolecules from the active state of cleaving-DNAzyme to the active state of HRP-mimicking DNAzyme by self-cleavage. As a proof-of-concept experiment, the design was applied to the rapid and selective colorimetric detection of Cu2+ ion in aqueous media at room temperature. The method exhibits a sensitivity of 1 μM (65 ppb) in drinking water, which is much lower than the MAL (maximum allowable level) of ~20 μM (1.3 ppm) in the USA, ~30 μM (2.0 ppm) in the European Union and ~15 μM (1.0 ppm) in Canada. Based on our results, this method opens up new possibilities for the generalized rapid and easy detection of toxic metal ions in environmental samples. Indeed, to test the practical application of this dual-DNAzyme probe, preliminary experiments were performed on real and spiked river water samples. The results reveal good recoveries. We believe that this molecular engineering design may prove useful in the future development of other nucleic acid-based probes for toxicological and environmental monitoring.

Supplementary Material

1_si_001

Acknowledgments

We thank Ms. Hui Wang for interesting discussion and reading of the manuscript. This work was supported by grants of 20627005 from the National Natural Science Foundation, the National Special Fund for SKLBE (2060204), NCET-07-0287 from the Program for New Century Excellent Talents, and 06SG32 from the Shanghai Shuguang Program, and by US NIH grants.

Footnotes

Supporting Information Available: Additional figures and experimental details. This information is available free of charge via the Internet at http://pubs.acs.org/.

References

1. Breaker RR, Joyce GF. Chem Biol. 1994;1:223–229. [PubMed]
2. (a) Carmi N, Balkhi HR, Breaker RR. Proc Natl Acad Sci USA. 1998;95:2233–2237. [PubMed] (b) Carmi N, Breaker RR. Bioorg Med Chem. 2001;9:2589–2600. [PubMed] (c) Carmi N, Shultz LA, Breaker RR. Chem Biol. 1996;3:1039–1046. [PubMed] (d) Liu JW, Lu Y. Chem Commun. 2007:4872–4874. [PubMed]
3. (a) Li J, Zheng W, Kwon AH, Lu Y. Nucleic Acids Res. 2000;28:481–488. [PubMed] (b) Santoro SW, Joyce GF, Sakthivel K, Gramatikova S, Barbas CF., III J Am Chem Soc. 2000;122:2433–2439. [PubMed] (c) Kim H, Liu J, Li J, Nagraj N, Li M, Pavot CMB, Lu Y. J Am Chem Soc. 2007;129:6896–6902. [PubMed]
4. (a) Liu JW, Lu Y. J Am Chem Soc. 2003;125:6642–6643. [PubMed] (b) Yim TJ, Liu JW, Lu Y, Kane RS, Dordick JS. J Am Chem Soc. 2005;127:12200–12201. [PubMed] (c) Xiao Y, Rowe AA, Plaxco KW. J Am Chem Soc. 2007;129:262–263. [PubMed] (d) Shen L, Chen Z, Li YH, He SL, Xie SB, Xu XD, Liang ZW, Meng X, Li Q, Zhu ZW, Li MX, Le XC, Shao YH. Anal Chem. 2008;80:6323–6328. [PubMed] (e) Elbaz J, Shlyahovsky B, Willner I. Chem Commun. 2008:1569–1571. [PubMed]
5. (a) Hollenstein M, Hipolito C, Lam C, Dietrich D, Perrin D. Angew Chem Int Ed. 2008;47:4346–4350. [PubMed] (b) Liu JW, Lu Y. Angew Chem Int Ed. 2007;46:7587–7590. [PubMed]
6. Liu JW, Brown AK, Meng X, Cropek DM, Istok JD, Watson DB, Lu Y. Proc Natl Acad Sci USA. 2007;104:2056–2061. [PubMed]
7. Peracchi A. J Biol Chem. 2000;275:11693–11697. [PubMed]
8. Elbaz J, Shlyahovsky B, Willner I. Chem Commun. 2008:1569–1571. [PubMed]
9. Pavlov V, Xiao Y, Gill R, Dishon A, Kotler M, Willner I. Anal Chem. 2004;76:2152–2156. [PubMed]
10. Weizmann Y, Beissenhirtz MK, Cheglakov Z, Nowarski R, Kotler M, Willner I. Angew Chem Int Ed. 2006;45:7384–7388. [PubMed]
11. Li D, Wieckowska A, Willner I. Angew Chem Int Ed. 2008;120:3991–3995.
12. Wang H, Kim Y, Liu H, Zhu Z, Bamrungsap S, Tan W. J Am Chem Soc. 2009;131:8221–8226. [PubMed]
13. (a) Merian E. Metals and their compounds in the environment. VCH; Weinheim: 1991. p. 893. (b) Georgopoulos PG, Roy A, Yonone-Lioy MJ, Opiekun RE, Lioy PJ. J Toxicol Env Health, B. 2001;4:341–394. [PubMed]
14. (a) Carmi N, Shultz LA, Breaker RR. Chem Biol. 1996;3:1039–1046. [PubMed] (b) Carmi N, Balkhi HR, Breaker RR. Proc Natl Acad Sci USA. 1998;95:2233–2237. [PubMed]