PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Dev Biol. Author manuscript; available in PMC 2010 November 1.
Published in final edited form as:
PMCID: PMC2764001
NIHMSID: NIHMS143779

CDX2 in the Formation of the Trophectoderm Lineage in Primate Embryos

Abstract

The first lineage decision during mammalian development is the establishment of the trophectoderm (TE) and the inner cell mass (ICM). The caudal-type homeodomain protein Cdx2 is implicated in the formation and maintenance of the TE in the mouse. However, the role of CDX2 during early embryonic development in primates is unknown. Here, we demonstrated that CDX2 mRNA levels were detectable in rhesus monkey oocytes, significantly upregulated in pronuclear stage zygotes, diminished in early cleaving embryos but restored again in compact morula and blastocyst stages. CDX2 protein was localized to the nucleus of TE cells but absent altogether in the ICM. Knockdown of CDX2 in monkey oocytes resulted in formation of early blastocyst-like embryos that failed to expand and ceased development. However, the ICM lineage of CDX2-deficient embryos supported the isolation of functional embryonic stem cells. These results provide evidence that CDX2 plays an essential role in functional TE formation during primate embryonic development.

Keywords: Embryo, CDX2, Trophectoderm, Primates, Embryonic stem cells

Introduction

Mammalian development commences when an oocyte is fertilized by a sperm forming a zygote. The zygote and individual blastomeres of the 2- and 4-cell stage embryos are totipotent, meaning that a single cell has the potential to develop into an embryo with all the specialized cells that make up a living organism and the placental structures necessary to support fetal development. Experimentally, totipotency of the early cleavage stage blastomeres has been established by separation and transfer of individual blastomeres into recipients (Chan et al., 2000; Mitalipov et al., 2002). As embryo development progresses to the 8-cell stage and beyond, it is believed that the individual blastomeres gradually lose their totipotency.

The differentiation of totipotent cells and segregation into the first two distinct cell lineages is apparent at the blastocyst stage with formation of the TE and the ICM. Cell-fate analysis has revealed that the TE contributes to the embryonic portion of the placenta, a structure unique to mammalian development, whereas the ICM gives rise to all cells and tissues of the embryo proper and the extraembryonic endoderm (Pedersen et al., 1986). After fertilization, maternally inherited factors present in the ooplasm initially support early cleavage development of the transcriptionally-quiescent embryo. Following the onset of embryonic genome activation, however, control of the developmental program is gradually shifted to products expressed from the embryonic genome. While little is known about oocyte factors that direct the formation of the ICM and TE, genes expressed from the embryonic genome, whose functions have been well defined, include the transcription factors Oct4, Nanog, and Sox2. These genes are considered essential for ICM lineage formation in mouse preimplantation embryos (Avilion et al., 2003; Chambers et al., 2003; Mitsui et al., 2003).

The caudal-type homeobox gene, Cdx2, is one of the earliest transcription factors essential for formation and maintenance of the TE lineage in mouse embryos (Niwa et al., 2005; Yamanaka et al., 2006). Its expression in pre- and early postimplantation mouse embryos is restricted to the TE lineage where it functions as a repressor of Oct4 and Nanog expression (Beck et al., 1995; Deschamps et al., 1999; Strumpf et al., 2005; van den Akker et al., 2002). Mouse embryos lacking Cdx2 form blastocyst-like structures with outer layer cells resembling the TE, but fail to implant after transplantation into recipients or produce TE outgrowths in culture (Strumpf et al., 2005). The TE-like cells found in these Cdx2 deficient embryos do ectopically express genes characteristic for the pluripotent ICM lineage (e.g., Oct4 and Nanog) and support isolation of embryonic stem cells (ESCs) (Chawengsaksophak et al., 2004). On the other hand, overexpression of Cdx2 can cause mouse ESCs to adopt properties of trophoblast stem cells (Niwa et al., 2005; Tolkunova et al., 2006). During fetal development, expression of Cdx2 is limited almost exclusively to the endoderm of the primitive gut by E12.5 and this pattern is maintained throughout life, with highest expression levels detected in the distal intestinal and the proximal colon (James et al., 1994; Silberg et al., 2000).

As indicated above, the role of oocyte-specific maternal factors including CDX2 during formation of totipotent embryos and specification of the first two lineages in blastocysts is not well understood. Here, we present results demonstrating that CDX2 transcripts and protein are present in monkey oocytes and pronuclear stage zygotes. Embryonic expression of CDX2 protein was first detected in all cells that comprise the compact morula but in blastocysts expression was confined to the TE cells and absent in the ICM. CDX2 knockdown in unfertilized oocytes resulted in a failure to progress beyond the early blastocyst stage due to inability to form a functional TE. Interestingly, these CDX2-deficient embryos supported the isolation of functional ESCs. These results indicate that similar to the mouse, CDX2 plays an essential role in the formation of the TE during early primate development. Our data also suggest that CDX2 is a maternal factor present in unfertilized primate oocytes and zygotes.

Materials and methods

Animals

Adult rhesus macaques housed in individual cages were used in this study. All animal procedures were approved by the Institutional Animal Care and Use Committee at the ONPRC/OHSU

Ovarian stimulation, recovery of rhesus macaque oocytes, fertilization by intracytoplasmic sperm injection (ICSI), and embryo culture

Controlled ovarian stimulations and oocyte recovery has been described previously (Zelinski-Wooten et al., 1995). Briefly, cycling females received twice-daily injections of recombinant human follicle-stimulating hormone (FSH; Organon; 30 IU, im) for 8 days and recombinant human luteinizing hormone (LH; Ares Serono; 30 IU, im) on days 7–8 of the stimulation protocol. In addition, animals received a gonadotropin-releasing hormone (GnRH) agonist (Acyline; NIH/NICHD; 0.075 mg/kg body weight, sc) and human chorionic gonadotropin (hCG; Serono; 1,000 IU, im) on day 7 during the stimulation period approximately 36 hrs prior to oocyte retrieval. Cumulus-oocyte complexes were collected from anesthetized animals by laparoscopic follicular aspiration and placed in Hepes-buffered TALP (modified Tyrode solution with albumin, lactate, and pyruvate) (Bavister and Yanagimachi, 1977) containing 0.3% bovine serum albumin (TH3) at 37°C. Tubes containing follicular aspirates were placed in a portable incubator (Minitube, Verona) at 37°C for transport to the laboratory. Hyaluronidase (0.5 mg/ml) was added directly to the tubes containing aspirates followed by incubation at 37°C (30 seconds) before the contents were gently agitated with a serological pipette to disaggregate cumulus and granulosa cell masses and sifted through a cell strainer (Falcon, 70-μm mesh size; Becton Dickinson). Oocytes were retained in the mesh, whereas blood, cumulus, and granulosa cells were washed through the filter. The strainer was immediately backwashed with TH3, and the medium containing oocytes was collected. Residual cumulus cells were removed upon passage through a small-bore pipette (approximately 125 μm in inner diameter), and oocytes were placed in chemically defined, protein-free hamster embryo culture medium (HECM)-9 medium (McKiernan and Bavister, 2000) equilibrated at 37°C in 6% CO2, 5% O2, and 89% N2 and covered with tissue culture oil (Sage IVF, Trumbull). Fertilization by intracytoplasmic sperm injection (ICSI) and embryo culture were performed as described (Wolf et al., 2004). Briefly, sperm were diluted with 10% polyvinylpyrrolidone (1:4; Irvine Scientific), and a 5-μl drop was placed in a micromanipulation chamber. A 30-μl drop of TH3 was placed in the same micromanipulation chamber next to the sperm droplet, and both were covered with tissue culture oil. The micromanipulation chamber was mounted on an inverted microscope equipped with Hoffman optics and micromanipulators. An individual sperm was immobilized by physical manipulation, aspirated tail first into an ICSI pipette (Humagen), and injected into the cytoplasm of a metaphase II-arrested (MII) oocyte, away from the polar body. After ICSI, injected oocytes were placed in 4-well dishes (Nalge Nunc) containing protein-free HECM-9 medium covered with tissue culture oil and cultured at 37°C in 6% CO2, 5% O2, and 89% N2. Embryos at the eight-cell stage were transferred to fresh plates of HECM-9 medium supplemented with 5% fetal bovine serum (FBS) (HyClone) and cultured for a maximum of 9 days, with medium change every other day.

CDX2 morpholino design

Two morpholino constructs designed to knockdown CDX2 protein synthesis in monkey oocytes and embryos were employed (www.gene-tools.com). The first 25-mer construct binds to the translational start site of CDX2 and blocks translation in the monkey. The following represents the sense strand CDX2 mRNA sequence, with the morpholino target sequence being denoted in bolded brackets and the transcription start site is indicated in parenthesis: 5′CTCGCCAC[C(ATG)TACGTGAGCTACCTCCTGGAC]A-3′. The sequence of morpholino #1 is 5′-GTCCAGGAGGTAGCTCACGTACATG-3′. The second morpholino interrupts normal pre-mRNA splicing by blocking a splice acceptor site during splicing events. This 25-mer was designed to bind to the intron1-exon2 boundary causing improper splicing and subsequent removal of intron1-exon2-intron2. The following represents the sense strand CDX2 mRNA sequence of the intron1-exon2 boundary, with the morpholino target sequence being denoted in bolded brackets: 5′-GCCCTC[ACTTCTCCTTCCTCCACAGTGAAAA]CCAGGACGAAAGACAA-3′. The sequence of morpholino #2 is 5′-TTTTCACTGTGGAGGAAGGAGAAGT-3′. Each morpholino was resuspended in tissue culture grade H2O at a concentration of 1 mM. For injections, equal amounts of each morpholino were mixed together, diluting each to a final concentration of 0.5 mM. Prior to each use, the concentration was reevaluated using a NanoDrop 1000 spectrophotometer and adjusted as required. For the negative control (negative morpholino), we injected a commercially available 25-mer morpholino (www.gene-tools.com) designed to a sequence found in reticulocytes from thallasemic humans with a splice-generating mutation at position 705 in beta-globin pre-mRNA; therefore having no target in the present study. The sequence of the negative control morpholino is 5′-CCTCTTACCTCAGTTACAATTTATA 3′.

ESC isolation and propagation

Zonae pellucidae were removed with brief protease (0.5%) treatment and embryos were plated onto Nunc 4-well dishes containing mitotically-inactivated mouse embryonic fibroblasts (mEFs) and ESC culture medium consisting of DMEM/F12 medium supplemented with 1% nonessential amino acids, 2 mM L-glutamine, 0.1 mM β-mercaptoethanol and 15% FBS (Mitalipov et al., 2006). ICMs that attached to the feeder layer and initiated outgrowth were manually dissociated into small cell clumps with a microscalpel and replated onto new mEFs. After the first passage, colonies with ESC-like morphology were selected for further propagation, characterization and low temperature storage. Medium was changed daily and ESC colonies were split every 5-7 days by manual disaggregation and replating collected cells onto dishes with fresh feeder layers. Cultures were maintained at 37°C, 3% CO2, 5%O2 and 92% N2.

Immunocytochemical procedures

Oocytes, embryos, undifferentiated and differentiated ESCs were fixed in 4% paraformaldehyde for 20 minutes. After permeabilization with 0.2% Triton X-100 and 0.1% Tween-20, non-specific reactions were blocked with 10% goat or donkey normal serum (Jackson ImmunoResearch). Cells were then incubated for 40 minutes in primary antibodies, washed three times and exposed to 1:400 dilution of secondary antibodies conjugated with fluorochromes (Jackson ImmunoResearch) before co-staining with 2 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich) for 10 minutes, whole-mounting onto slides and examination under epifluorescence microscopy. Primary antibodies were for CDX2 (1:25 dilution) from Affinity BioReagents™ and for OCT4 (1:200), SSEA-4 (1:200), TRA-1-60 and TRA-1-81 (1:200) from Santa Cruz Biotechnology Inc. Neural specific antibodies including microtubule-associated protein (MAP2), nestin and β-III-tubulin were from Chemicon International, Inc.

Quantitative Real-Time PCR

Quantitative real-time PCR (qPCR) was performed on total RNA samples isolated from individual oocytes and embryos using Cells-to-cDNA™ II kit (Ambion Inc.). Briefly, RNA was treated with RNase-free DNase to remove genomic DNA. Next, cDNA was synthesized from total RNA using M-MLV Reverse Transcriptase and random decamers. TaqMan probes were designed using ABI Primer Express ver. 2.0.0 and synthesized by Applied Biosystems (Foster City). The real-time PCR primers were designed using online software (http://scitools.idtdna.com/Primerquest/) and synthesized by IDT (Integrated DNA Technologies). QPCR was performed on an ABI 7900HT Fast Real-time PCR System with the SDS 2.2.2 program using the ABI TaqMan universal PCR master mix (Applied Biosystems). All reactions were carried out in triplicate. The final concentration of the real-time primers was 300 nM, and the final concentration of the real-time probes was 250 nM. Initially, qPCR for CDX2 and OCT4 was optimized using a 5-fold dilution series of control samples, pancreas and undifferentiated monkey ESCs, respectively. For each subsequent qPCR analysis with experimental samples, standard curves generated with CDX2, OCT4 and GAPDH controls were employed. The cycling profile for each run was 95°C for 20 seconds and 40 cycles of 95°C for 3 seconds followed by 60°C for 30 seconds, using the default ramp rate. CDX2 and OCT4 gene expression for each sample was normalized relative to the endogenous housekeeping gene GAPDH. In each fold change calculation, the average cycle-threshold (Ct) value of CDX2 and OCT4 expression in monkey oocytes and embryos was compared to the average Ct value of the CDX2 and OCT4 expression in pancreas and undifferentiated ESCs, respectively. QPCR for CDX2 was carried out using a primer/probe set designed for exon 2: forward primer 5′-CGGCTGGAGCTGGAGAAG-3′, reverse primer 5′-GGCTTTCCTCCGGATGGT-3′, and the probe 5′-AGTTTCACTACAGTCGCTAC-3′. The primer/probe sets for the rhesus monkey OCT4 gene are: forward primer 5′-CCCACTGGTGCCGTGAA-3′, reverse primer 5′-TTGGCAAATTGCTCGAGTTCT-3′, and the probe 5′-GGACTCCTCCGGGTTTTGCTCCAG-3′. The primer/probe sets for monkey GAPDH (house-keeping gene) are: forward primer 5′-GGTGGTCTCCTCCGACTTCA-3′, reverse primer 5′-ACCAGGAAATGAGCTTGACAAAG-3′, and the probe 5′-CCCACTCTTCCACCTTCGACGCTG-3′.

Results

CDX2 expression in primate oocytes and preimplantation stage embryos

In the mouse, onset of embryonic Cdx2 expression was found in 8-16 cell stage embryos in all cells initially, but downregulated or repressed in the ICM of blastocysts (Beck et al., 1995; Ralston and Rossant, 2008; Suwinska et al., 2008). We first examined the expression of CDX2 during early primate development performing a comprehensive analysis of its spatial and temporal dynamics in rhesus macaque (Macaca mulatta) oocytes and preimplantation stage embryos. Initially, oocytes and embryos collected at various stages from a minimum of three independent experiments/animals were analyzed for CDX2 and OCT4 expression using qPCR. Low levels of CDX2 mRNA were detected in germinal vesicle (GV), metaphase I (MI) and MII stage oocytes (Fig. 1A). However, expression was markedly upregulated in pronuclear (PN) stage zygotes but then drastically diminished in cleavage stage embryos (Fig. 1A). Embryonic expression of CDX2 was detected again in compact morula (CM, corresponding to 32- 64-cell stage embryos) and blastocyst stage embryos with the highest levels seen in hatched blastocysts (HB; Fig. 1A). Next, we performed a detailed time course of OCT4 expression levels in primate oocytes and embryos by qPCR (Fig. 1B). Low mRNA levels were observed in monkey GV and MI oocytes but expression was undetectable in MII oocytes and early cleavage stage embryos. Similar to CDX2, strong embryonic OCT4 expression was found in CM and in all blastocyst stages (Fig. 1B).

Fig. 1
CDX2 and OCT4 expression profiles in rhesus macaque oocytes and embryos

To determine the pattern of CDX2 protein localization, monkey oocytes and embryos were labeled with antibody raised against CDX2 and analyzed by immunocytochemistry (ICC; Fig. 2). The CDX2 signal was diffuse but present throughout the cytoplasm of monkey GV oocytes while localized peripherally in MI and MII oocytes (Fig. 2A-C). After fertilization, CDX2 epifluorescence was detected at high levels in zygotic pronuclei (Fig. 2D). However, CDX2 protein was undetectable in cleavage stage monkey embryos (Fig. 2E,F). Of note, CDX2 protein was detectable in the 2nd polar body (2nd PB; Fig. 2E,F). Embryonic CDX2 protein first became evident at the CM stage and appears to be expressed in the nuclei of most if not all blastomeres ubiquitously (Fig. 2G). In monkey blastocysts, a strong CDX2 signal was confined to the outer TE cells and absent in the ICM (Figs 2H-J, ,3).3). Interestingly, both ICM and TE cell nuclei were positive for OCT4 in early and expanded monkey blastocysts and double labeling indicated that CDX2 and OCT4 were co-expressed in the TE at this stage (Fig. 3; upper panel). We have previously shown that, the OCT4 protein is diminished in TE cells only in hatching or hatched monkey blastocysts while expression remained high in the ICM (Fig. 3; lower panel) (Mitalipov et al., 2003).

Fig. 2
CDX2 protein expression and localization in monkey oocytes and embryos
Fig. 3
Co-localization of CDX2 and OCT4 in monkey blastocysts

CDX2 knockdown in primate oocytes and embryos

If timely CDX2 expression is critical in early development, down-regulation of CDX2 protein production in unfertilized primate oocytes may compromise normal fertilization and embryo development. To test this assumption, we engineered two antisense morpholino oligonucleotides, the first for specifically blocking the translation initiation complex of the CDX2 mRNA and the second for blocking the splice acceptor site at the intron1/exon2 boundary. Approximately 6-8 pl (1% of oocyte volume) of an equal mixture of both CDX2 morpholinos was microinjected into the cytoplasm of unfertilized MII oocytes. The 25-mer control morpholino (based on a sequence found in human reticulocytes) used as a negative control was injected into a subset of oocytes. After 30-60 min, all oocytes were fertilized by ICSI and the resulting embryos were cultured in vitro to the blastocyst stage for morphological evaluation of embryo development.

Fertilization and subsequent embryo development rates, up to the early cavitating blastocysts, were similar for all groups (Table 1). However, a majority of CDX2 morpholino-injected early blastocysts failed to expand and none hatched (Fig. 4A). Subsequently, CDX2 morpholino-treated embryos collapsed and ceased development. In contrast, a majority of the blastocysts in both the negative morpholino and non-treated intact control groups expanded and hatched from the zona pellucida by day 8 of culture (Fig. 4A).

Fig. 4
Effect of CDX2 knockdown on monkey embryonic development
Table 1
Rhesus monkey embryo development after CDX2 morpholinos injection

CDX2 and OCT4 mRNA and protein levels in treated embryos were examined by qPCR and ICC (Fig. 4B,C). A qPCR primer/probe set, designed to amplify exon2 of CDX2 mRNA, was employed to quantitate residual mRNA levels after injection of morpholino #1. CDX2 mRNA expression levels that escaped the anti-splicing morpholino were markedly attenuated in treated oocytes and embryos at all stages examined compared to controls (PN stage, down 80%; CM stage, down 100%; blastocysts stage, down 88%) (Fig. 4B). In contrast, OCT4 expression was unaffected in treated embryos (Fig. 4B). The sum effect of both the splicing and translational morpholinos as examined by ICC demonstrated efficient blockade of CDX2 protein synthesis in blastocysts (Fig. 4C).

We also examined expression levels of several other ICM (NANOG and CDX2) and TE (KRT8, and FGFR2) specific genes in CDX2 depleted blastocysts. Similar to OCT4, expression of pluripotency genes NANOG and SOX2 was unchanged (Fig. 5). Expression of TE genes in CDX2 deficient blastocysts was variable - FGFR2 was unaltered but expression of KRT8 was significantly reduced when compared to intact controls (Fig. 5).

Fig. 5
Expression of ICM and TE specific factors in CDX2 deficient blastocysts

Isolation of functional ESCs from CDX2-deficient monkey embryos

In order to assess whether CDX2 knockdown in primate oocytes affected the formation of a normal ICM capable of supporting ESC production, we removed zona pellucida from CDX-deficient embryos (n = 4) and cultured on feeder layers. After plating onto feeder layers consisting of mEFs and further propagation, two ESC lines (ORMES-24 and ORMES-25) were isolated (50% efficiency) with typical primate ESC morphology (Fig. 6A-D). Both cell lines strongly reacted with OCT4, SSEA-4, TRA-1-60 and TRA-1-81 antibodies (Fig. 6). Conventional cytogenetic G-banding analysis demonstrated normal rhesus macaque XX (ORMES-24) and XY (ORMES-25) karyotypes.

Fig. 6
Pluripotency analysis of ESCs derived from CDX2-deficient embryo

For pluripotency evaluation, ORMES-24 and ORMES-25 cells were exposed to conditions for cardiac and neural differentiation in vitro (Mitalipov et al., 2006) and both produced contracting cardiomyocytes and neural phenotypes expressing microtubule associated protein 2 (MAP2; Fig. 6E), nestin (Fig. 6F) and β-III-tubulin (Fig. 6G). Moreover, injection of undifferentiated ESCs into SCID mice resulted in teratoma tumor formation consisting of mixed tissues and cells representative of all three germ layers (Fig. 6H-J). In sum, the composition of teratomas formed by ESCs derived from CDX2-deficient embryos were remarkably similar to those produced from ESCs (ORMES-23) derived from control embryos.

Discussion

Differentiation and specification of unspecialized cells into other cell types is a crucial process of development. Thus, understanding the molecular mechanisms governing the downstream lineage determination and commitment is critical to dissect fundamental developmental pathways. As indicated above, the embryonic genome at early cleavage stages is transcriptionally quiescent and development is supported and regulated by maternally inherited factors present at the time of fertilization in the oocyte (Minami et al., 2007). The transition in developmental regulation occurs gradually with activation of the embryonic genome in a species-specific manner and a complete loss of dependence on oocyte factors takes place by the blastocyst stage. Thus, TE and ICM cells are self sustained and their development is maintained by endogenously expressed factors. However, oocyte-specific transcriptional and epigenetic factors are essential for “natural” reprogramming of highly specialized and terminally differentiated gametic genomes into trophectodermal and pluripotent ICM lineages. Currently, little is known about these maternal factors and their role in induction of totipotency remains elusive.

Studies in the mouse suggested that embryonic Cdx2 functions as a gatekeeper for committing totipotent cells to the TE lineage during early preimplantation development (Niwa et al., 2005; Ralston and Rossant, 2008). Here, we present evidence that CDX2 plays a similar role in primates. Our results also indicate that maternal CDX2 transcripts are present in monkey oocytes, with their level increasing dramatically after fertilization. These results were also confirmed by detection of CDX2 protein in the zygotic pronuclei by ICC. This observation was somewhat unexpected and has not been reported for other species including the mouse. The function of CDX2 in primate oocytes soon after fertilization is unclear and remains to be addressed. CDX2 mRNA levels were low in cleavage stage embryos and undetectable at the protein level except in the second polar body. Onset of embryonic expression was evident at the compact morula stage, where the protein was ubiquitously expressed in all nuclei. In contrast, CDX2 protein became confined to the outer TE layer in early cavitating blastocysts and was not detected in the ICM. This pattern of expression in blastocysts was similar to that reported in the mouse suggesting that CDX2 is an important transcription factor during primate TE specification.

On the other hand, embryonic activation of OCT4 in monkey embryos occurs slightly earlier than CDX2, at the 16-cell stage and in blastocysts it is initially expressed in both the ICM and TE cells (Mitalipov et al., 2003). OCT4 protein is downregulated in the TE of hatched blastocysts while strong expression is maintained in the ICM. In our study, CDX2 and OCT4 were co-expressed initially in all cells of the compact morula and in TE cells of early and expanded blastocysts. However, their expression becomes mutually exclusive in individual TE and ICM cells as development continues to the more advanced blastocyst stages. Studies in the mouse indicate that overexpression of Cdx2 downregulates Oct4 expression in ESCs (Strumpf et al., 2005). Modulation of the OCT4 to CDX2 expression ratio in ESCs can determine their fate. A high OCT4:CDX2 ratio supports the maintenance of the pluripotent ICM, whereas a low ratio promotes differentiation into TE (Niwa et al., 2005). This pattern of CDX2 and OCT4 expression suggests that the interplay and mutual repression between these two transcription factors could be important for the segregation and specification of the first two lineages in primate embryos.

Furthermore, inhibition of CDX2 protein synthesis secondary to anti-sense morpholino injection into unfertilized monkey oocytes suggests translational down-regulated of maternal and embryonic CDX2 protein synthesis throughout preimplantation development. Thus, the inhibition of protein synthesis by morpholinos would appear to be an effective tool for investigating gene function in primate embryos. Despite their normal appearance, CDX2-deficient monkey blastocysts were unable to expand and hatch from the zona pellucida, suggesting that CDX2 is likely responsible for the maintenance of cell junctions in the TE. Our results also indicate that although CDX2 has an important role in the development of a fully functional TE and possibly in the downregulation of the ICM-associated pluripotency genes, initial blastocoel formation does not seem to require either maternal or zygotic CDX2. These observations are consistent with available evidence that Cdx2 is not essential for certain early aspects of the TE specification during preimplantation mouse embryo development (Meissner and Jaenisch, 2006; Niwa et al., 2005; Strumpf et al., 2005). However, Cdx2-deficient TE cells were unable to proliferate and form giant trophoblast cell outgrowths in vitro or produce TE stem cells upon culture on feeder layers (Niwa et al., 2005). Moreover, mouse Cdx2 knockout embryos fail to implant and grow into a fetus (Ralston and Rossant, 2008).

Similar to the mouse (Chawengsaksophak et al., 2004), depletion of CDX2 did not seem interfere with the formation of the pluripotent ICM lineage in primate embryos based on the observation that OCT4 expression was unaffected. We were able to rescue the pluripotent lineage by plating CDX2-deficient embryos onto feeder layers and subsequently isolating ESC lines. Two ESC lines were derived at a 50% efficiency which is slightly higher than our average for control embryos (30%) (Mitalipov et al., 2006). Moreover, both cell lines exhibited a normal diploid karyotypes, expressed key ESCs markers and differentiated into various cell and tissue types representing all the three embryonic germ layers.

In summary, we demonstrated the expression pattern of CDX2 during early primate embryo development. Knockdown of CDX2 protein resulted in embryonic arrest due to inability to form the TE. These results provide evidence that CDX2 plays an essential role in formation of the functional TE lineage during primate embryonic development.

Acknowledgments

The authors would like to acknowledge the Assisted Reproductive Technologies & Embryonic Stem Cell Core, Division of Animal Resources, Surgery Team, Endocrine Core, Imaging & Morphology Core and Molecular & Cellular Biology Core at the Oregon National Primate Research Center for providing expertise and services that contributed to this project. Funding was provided by start-up funds from Oregon National Primate Research Center, Oregon Stem Cell Center and National Institutes of Health grants RR00163, HD18185, HD057121-01A2, HD047721, HD047675 and HD058294.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • Avilion AA, Nicolis SK, Pevny LH, Perez L, Vivian N, Lovell-Badge R. Multipotent cell lineages in early mouse development depend on SOX2 function. Genes Dev. 2003;17:126–40. [PubMed]
  • Bavister BD, Yanagimachi The effects of sperm extracts and energy sources on the motility and acrosome reaction of hamster spermatozoa in vitro. Biol Reprod. 1977;16:228–37. [PubMed]
  • Beck F, Erler T, Russell A, James R. Expression of Cdx-2 in the mouse embryo and placenta: possible role in patterning of the extra-embryonic membranes. Dev Dyn. 1995;204:219–27. [PubMed]
  • Chambers I, Colby D, Robertson M, Nichols J, Lee S, Tweedie S, Smith A. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell. 2003;113:643–55. [PubMed]
  • Chan AW, Dominko T, Luetjens CM, Neuber E, Martinovich C, Hewitson L, Simerly CR, Schatten GP. Clonal propagation of primate offspring by embryo splitting. Science. 2000;287:317–9. [PubMed]
  • Chawengsaksophak K, de Graaff W, Rossant J, Deschamps J, Beck F. Cdx2 is essential for axial elongation in mouse development. Proc Natl Acad Sci U S A. 2004;101:7641–5. [PubMed]
  • Deschamps J, van den Akker E, Forlani S, De Graaff W, Oosterveen T, Roelen B, Roelfsema J. Initiation, establishment and maintenance of Hox gene expression patterns in the mouse. Int J Dev Biol. 1999;43:635–50. [PubMed]
  • James R, Erler T, Kazenwadel J. Structure of the murine homeobox gene cdx-2. Expression in embryonic and adult intestinal epithelium. J Biol Chem. 1994;269:15229–37. [PubMed]
  • McKiernan SH, Bavister BD. Culture of one-cell hamster embryos with water soluble vitamins: pantothenate stimulates blastocyst production. Hum Reprod. 2000;15:157–64. [PubMed]
  • Meissner A, Jaenisch R. Generation of nuclear transfer-derived pluripotent ES cells from cloned Cdx2-deficient blastocysts. Nature. 2006;439:212–5. [PubMed]
  • Minami N, Suzuki T, Tsukamoto S. Zygotic gene activation and maternal factors in mammals. J Reprod Dev. 2007;53:707–15. [PubMed]
  • Mitalipov S, Kuo HC, Byrne J, Clepper L, Meisner L, Johnson J, Zeier R, Wolf D. Isolation and characterization of novel rhesus monkey embryonic stem cell lines. Stem Cells. 2006;24:2177–86. [PubMed]
  • Mitalipov SM, Kuo HC, Hennebold JD, Wolf DP. Oct-4 expression in pluripotent cells of the rhesus monkey. Biol Reprod. 2003;69:1785–92. [PubMed]
  • Mitalipov SM, Yeoman RR, Kuo HC, Wolf DP. Monozygotic twinning in rhesus monkeys by manipulation of in vitro-derived embryos. Biol Reprod. 2002;66:1449–55. [PubMed]
  • Mitsui K, Tokuzawa Y, Itoh H, Segawa K, Murakami M, Takahashi K, Maruyama M, Maeda M, Yamanaka S. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell. 2003;113:631–42. [PubMed]
  • Niwa H, Toyooka Y, Shimosato D, Strumpf D, Takahashi K, Yagi R, Rossant J. Interaction between Oct3/4 and Cdx2 determines trophectoderm differentiation. Cell. 2005;123:917–29. [PubMed]
  • Pedersen RA, Wu K, Balakier H. Origin of the inner cell mass in mouse embryos: cell lineage analysis by microinjection. Dev Biol. 1986;117:581–95. [PubMed]
  • Ralston A, Rossant J. Cdx2 acts downstream of cell polarization to cell-autonomously promote trophectoderm fate in the early mouse embryo. Dev Biol. 2008;313:614–29. [PubMed]
  • Silberg DG, Swain GP, Suh ER, Traber PG. Cdx1 and cdx2 expression during intestinal development. Gastroenterology. 2000;119:961–71. [PubMed]
  • Strumpf D, Mao CA, Yamanaka Y, Ralston A, Chawengsaksophak K, Beck F, Rossant J. Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst. Development. 2005;132:2093–102. [PubMed]
  • Suwinska A, Czolowska R, Ozdzenski W, Tarkowski AK. Blastomeres of the mouse embryo lose totipotency after the fifth cleavage division: expression of Cdx2 and Oct4 and developmental potential of inner and outer blastomeres of 16- and 32-cell embryos. Dev Biol. 2008;322:133–44. [PubMed]
  • Tolkunova E, Cavaleri F, Eckardt S, Reinbold R, Christenson LK, Scholer HR, Tomilin A. The caudal-related protein cdx2 promotes trophoblast differentiation of mouse embryonic stem cells. Stem Cells. 2006;24:139–44. [PubMed]
  • van den Akker E, Forlani S, Chawengsaksophak K, de Graaff W, Beck F, Meyer BI, Deschamps J. Cdx1 and Cdx2 have overlapping functions in anteroposterior patterning and posterior axis elongation. Development. 2002;129:2181–93. [PubMed]
  • Wolf DP, Thormahlen S, Ramsey C, Yeoman RR, Fanton J, Mitalipov S. Use of assisted reproductive technologies in the propagation of rhesus macaque offspring. Biol Reprod. 2004;71:486–93. [PubMed]
  • Yamanaka Y, Ralston A, Stephenson RO, Rossant J. Cell and molecular regulation of the mouse blastocyst. Dev Dyn. 2006;235:2301–14. [PubMed]
  • Zelinski-Wooten MB, Hutchison JS, Hess DL, Wolf DP, Stouffer RL. Follicle stimulating hormone alone supports follicle growth and oocyte development in gonadotrophin-releasing hormone antagonist-treated monkeys. Hum Reprod. 1995;10:1658–66. [PubMed]