PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Cancer Res. Author manuscript; available in PMC 2010 October 1.
Published in final edited form as:
PMCID: PMC2762355
NIHMSID: NIHMS140238

Melanoma Proteoglycan Modifies Gene Expression to Stimulate Tumor Cell Motility, Growth and Epithelial to Mesenchymal Transition

Abstract

Melanoma chondroitin sulfate proteoglycan (MCSP) is a plasma membrane-associated proteoglycan that facilitates the growth, motility and invasion of tumor cells. MCSP expression in melanoma cells enhances integrin function and constitutive activation of Erk 1,2. The current studies were performed to determine the mechanism by which MCSP expression promotes tumor growth and motility. The results demonstrate that MCSP expression in radial growth phase (RGP), vertical growth phase (VGP) or metastatic cell lines causes sustained activation of Erk 1,2, enhanced growth and motility which all require the cytoplasmic domain of the MCSP core protein. MCSP expression in an RGP cell line also promotes an epithelial to mesenchymal transition (EMT) based on changes in cell morphology and the expression of several EMT markers. Finally MCSP enhances the expression of c-Met and HGF, and inhibiting c-Met expression or activation limits the increased growth and motility of multiple melanoma cell lines. The studies collectively demonstrate an importance for MCSP in promoting progression by an epigenetic mechanism and they indicate that MCSP could be targeted to delay or inhibit tumor progression in patients.

Introduction

Human melanoma proteoglycan (MCSP), and the rat homologue NG2, are transmembrane proteoglycans in which the core protein is modified with chondroitin sulfate (13). Normal melanocytes express little or no MCSP in situ, while increased levels of MCSP are detected in both benign and dysplastic nevi (1) and these levels are largely maintained throughout progression. MCSP expression in certain tumors (such as acute lymphoblastic leukemia and acral lentiginous melanoma) portends a poor prognosis (47), implicating MCSP as a mediator of malignant potential in certain tumors.

MCSP/NG2 functions in multiple ways to contribute to cell adhesion, motility, invasion and growth. The NG2 core protein binds PDGF-AA and bFGF growth factors, indicating the importance of core protein as a co-receptor (8, 9). MCSP/NG2 expression is associated with increased cell motility, and it modifies the organization of the cytoskeleton by modulating the activity of rho family GTPases (10, 11). MCSP acts as a co-receptor for integrin and has been shown to hyper activateα4β1 integrin-mediated stimulation of focal adhesion kinase (1214). The cytoplasmic domain also has several key functional domains and phosphoacceptor sites, which include distinct Erk-binding and phosphoacceptor sites, and a PDZ domain binding motif (1518). This led us to propose that MCSP functions to enhance signal transduction efficiency (14) and provide tumor cells with a competitive advantage in remodeling tumor microenvironments, in which adhesion, growth and survival factors are rate-limiting.

Melanomas express mutant active BRAF with a high frequency, and this mutation is associated with a high level of constitutively activated Erk 1,2 (1921). Consequences of Erk 1,2 pathway activation, include entry into the cell cycle, increased expression of key melanoma transcription factors, and other key factors important for invasion such as matrix metalloproteinases (22). Erk 1,2 activation can also lead to increased adhesion by increasing expression of specific (e.g. β3) integrin subunits and elevated resistance to apoptosis (22). Thus, elements of the Erk 1,2 pathway are considered potential therapeutic targets in the treatment of this tumor (22, 23).

MCSP expression in radial growth phase melanoma cells results in constitutive activation of Erk 1,2 which is sustained even when adhesion to ECM is prevented and a highly organized actin cytoskeleton is lacking, such as might occur in tumor cells undergoing hematogenous metastasis (14). In the current study we demonstrate that MCSP expression enhances tumor cell motility, growth and tumor formation, all of which require the cytoplasmic domain of the MCSP core protein. MCSP expression also enhances epithelial to mesenchymal transition markers (EMT) when expressed in an RGP tumor cell line. The phenotypic changes stimulated by MCSP are linked to the enhanced expression of c-Met and HGF, both of which are stimulated by activation of Erk 1,2 pathway and the MITF transcription factor (2427). This suggests that MCSP performs unique scaffolding functions that integrate and amplify incoming signals from the microenvironment much like scaffold/adaptor proteins control signaling downstream of growth factor receptors (e.g. Ras-Raf-Mek-Erk pathway) (28).

Materials and Methods

Cell lines

WM164, 1205Lu, WM1552C and WM1341D human melanoma cells were generously provided by Dr. Meenhard Herlyn (The Wistar Institute, University of Pennsylvania, Philadelphia, PA). A375SM cells were provided by Dr. Isiah Fidler (MD Anderson, Houston, TX). MeWo melanoma cells were purchased from ATCC (Manassas, VA). ‘WM’ and 1205Lu cells were maintained in 4:1 MCDB 153: Leibovitz’s L-15 medium supplemented with 5 μg/ml insulin and 2% fetal bovine serum, whereas A375SM cells were cultured in DMEM medium supplemented with 10% FBS, sodium pyruvate, and non-essential amino acids. MeWo cells were cultured in RPMI medium supplemented with 10% FBS. The MCSP negative radial growth phase cell line was used to produce WM1552C/MCSP, Mock and MCSPΔCD stable transfectant cell lines as described previously (14) and cultured in medium supplemented with 0.25 mg/ml G418. WM1552C melanoma cells expressing constitutively active Mek-1 were derived clonally. Two clones with enhanced Erk phosphorylation were selected for assay and designated WM1552C/MKK1#15 and WM1552C/MKK1#17.

DNA constructs

The full-length MCSP construct was generated as described previously (14). Cytoplasmic domain-truncated MCSP (MCSPΔCD) was generated by PCR-site-directed mutagenesis of the full-length clone, modifying threonine 2252 to a stop codon. Mutagenesis was carried out using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA)) with primers CTACCTCCGAAAACGCAACAAGTCGGGCAAGCATGACGTC and GACGTCATGCTTGCCCTACTTGTTGCGTTTTCGGAGGTAG, using the manufacturer’s suggested protocol. Both hemaglutanin-tagged constitutively active MEK-1 in vector pMCL+ and control vector pCEP4L were gifts from Dr. Natalie Ahn (Howard Hughes Medical Institute, University of Colorado, Denver, CO). All DNA constructs were verified by sequencing at the Biomedical Genomics Center at the University of Minnesota.

Antibodies and reagents

The anti-MCSP monoclonal antibody 9.2.27 was provided by Dr. Ralph Reisfeld (The Scripps Research Institute, La Jolla, CA). Other antibodies and reagents were purchased from the indicated companies: Anti-tubulin from Oncogene Research Products (Pasadena, CA); anti-phospho p44/42 MAPK (pErk 1,2), anti-p44/42 MAPK (Erk1,2), anti-c-Met and phospho c-Met (pc-Met), Mek inhibitor U0126 and control compound U0124 from Cell Signaling Technology, Inc (Boston, MA); anti-GST from Abcam, Inc (Boston, MA); anti-E-Cadherin from BD Transduction Labs (Lexington, KY); anti-MITF from Santa Cruz Biotech. Inc (Santa Cruz, CA); c-Met kinase inhibitor SU11274 from Calbiochem, Inc (La Jolla, CA); methylcellulose and anti-Hemaglutinin from Sigma (St. Louis, MO); normal mouse monoclonal IgG2a, normal rabbit IgG and goat anti-mouse FC from ICN Pharmaceuticals (Aurora, OH); peroxidase-conjugated goat anti-mouse and goat anti-rabbit secondary antibodies from Jackson ImmunoResearch Laboratories (West Grove, PA); recombinant human HGF and anti- HGF antibody from R&D Systems (Minneapolis, MN).

siRNA

SiRNA specific for MCSP (CUUCUCCUCCUCUCAUGACUU) was designed by our lab and manufactured by Qiagen Inc (Chatsworth, CA). Fluorescein (FITC)-conjugated negative control siRNA, c-Met specific siRNA and HGF specific siRNA were purchased from Qiagen. Cells were transfected with siRNA using the RNAifect transfection reagent (Qiagen) per the manufacturer’s protocol. Transfection efficiency was routinely greater than 90% as determined by flow cytometry analysis of cells transfected with the negative fluorescein-labeled control siRNA.

In vivo tumor growth

WM1552C/Mock, WM1552C/MCSP and WM1552C/MCSPΔCD -transfected tumor cells were harvested from culture, washed 2 times with serum free medium, counted and suspended in serum-free medium at 2×107 cells/ml. 100 μl of cell suspension (2×106 cells) was injected subcutaneously into the flank of 7–8 week old female NOD.CB17-Prdkcscid mice (Jackson Laboratory, Bar harbor, ME) and monitored over a 6 week period. 42 days post injection the animals were euthanized, tumors harvested and weighed to determine tumor mass. Data in Figure 1 are the combined results from 2 separate experiments (experiment 1 n=5, experiment 2 n=20). Data were analyzed by student’s two-tailed t test.

Figure 1
Expression of MCSP stimulates tumor formation, anchorage independent growth and constitutive activation of ERK 1, 2 in melanoma cells

Growth in soft agar

A layer of 1% agarose in normal growth media was pipetted into six well plates and allowed to solidify. Cells were suspended in 6.75 ml regular growth media at 5000 cells/ml and incubated for 15 min at 37°C. For assays involving inhibitors, inhibitor or control was added at the indicated concentration prior to incubation at 37°C. 750 μl of 2% agarose was then added to the tubes, mixed thoroughly by pipetting, and 2 ml of cell suspension was pipetted into triplicate wells. Plates were placed at 4°C for 15 min to facilitate rapid polymerization of the agarose, the wells overlayed with 2 ml growth media and incubated at 37°C/5% CO2 for 17 days. Media were replaced every three days, +/− inhibitor as appropriate. Colonies were counted in five random fields/well, and data are shown as the average number of colonies from five fields/well from triplicate wells, +/− s.e.m.

Migration assays

Cells were plated at high density (3×105) in 6 well culture plates with growth medium and grown to confluence (~24–36 hours). Confluent cell monolayers were scratched using a sterilized 200μl pipette tip, and the wells were washed two times with medium to remove loose cells. Images of the wound area were collected using a 10x objective at 0, 24, 48, and 72 hours and the cell free area quantified by tracing the open wound area using Adobe Photoshop. Bars represent the percentage change in cell free area between the 0 and indicated assay time point, from triplicate wells, +/− s.e.m.

Western blot and immunoprecipitation

Western blot was performed using standard techniques as described previously (14). For immunoprecipitation, cells were lysed on ice by addition of IP buffer (20 mM Tris-HCl, pH7.5, 150 mM NaCl, 1 mM Na2EDTA, 1 mM EGTA, 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM •-glycerophosphate, 1 mM Na3O4, 1 μg/ml leupetin, 1 mM PMSF) and the insoluble materials were removed by centrifugation. For co-immunoprecipitation experiments, we replaced the 1% Triton – x-100 with 1% Nonidet P-40. Lysates were pre-cleared with protein A/G Sepharose beads (Amersham Pharmacia, Piscataway, NY) for 30 min at 4°C. Antibodies were incubated with the lysates overnight at 4°C, and the immunocomplexes collected by incubation with protein A/G-Sepharose beads for 1 h at 4°C. Immunocomplexes were washed three times with lysis buffer at 4°C and the bead-associated proteins resolved by SDS-PAGE.

Confocal microscopy

Cells plated on cover slips were serum starved for 48 hrs, fixed with 4% paraformaldehyde for 15 min, permeabilized with 0.05% Triton-x-100 for 5 min at room temperature, and blocked with 1% donkey serum for 1 h. Cover slips were incubated with indicated primary antibodies overnight at 4°C. Appropriate Cy2 or Cy3-conjugated secondary antibodies (Jackson Immunoresearch Laboratories) were added separately. Propidium Iodide was added for nuclei staining. Images were taken as described previously (14).

Recombinant GST fusion proteins

cDNA fragments encoding the complete MCSP cytoplasmic tail (aa2247-2322) or the amino-terminal half of the MCSP tail (aa2247-2286) were inserted into the bacterial expression vector pGEX-2T to generate the glutathione S-transferase (GST)-MCSP tail fusion proteins used in pull-down assays. Recombinant GST-MCSP tail proteins were purified as described previously (10).

GST pull down assay

Melanoma cells (1.0 × 106) were plated in tissue culture plates and incubated overnight at 37°C. Cells were lysed by addition of 1.0 ml ice-cold Nonidet P-40 lysis buffer, and the cell lysate pre-cleared by incubation with glutathione Sepharose beads (Amersham Pharmacia) for 2 hrs at 4°C. Pre-cleared cell lysates were mixed with 20 μl of GST-fusion protein-coupled beads and incubated for 2 hrs at 4°C with rotation. Beads were washed four times by centrifugation with ice-cold lysis buffer. Washed beads were mixed with and equal volume of 2x reducing Laemmli buffer and the bead-associated proteins resolved by SDS-PAGE.

Statistical analysis

Statistical analysis was performed using the GraphPad Prism® 4 software (GraphPad Software, La Jolla, CA), with the assistance of the University of Minnesota Masonic Cancer Center Statistics Core.

Results

MCSP-stimulated tumor formation and anchorage-independent cell growth requires intact core protein

WM1552C parental cell line, which is MCSP negative (Supplementary Figure 1 and ref.14), was chosen as a model cell line in which to express and evaluate the function of the MCSP core protein. WM1552C MCSP null cells were stably transfected with full length MCSP core protein or with an empty vector (mock). A portion of the transfected MCSP core protein is modified with chondroitin sulfate, as evidenced by the chondroitinase ABC - induced shift of the higher antibody-reactive band (supplementary figure 1). Mock transfected WM1552C cells were very poorly tumorigenic in subcutaneous xenograft assays; however stable expression of the proteoglycan significantly increased both the tumorigenic potential and tumor growth of these RGP cells (Figure 1a). The difference in tumorigenic potential was also correlated with activation of Erk 1,2 and anchorage independent growth in vitro (Figure 1b). The colonies formed by WM1552C/MCSP cells were large and contained tightly packed cells, whereas cellular debris were detected in WM1552C/Mock cells with occasional evidence of cells that had undergone a few divisions. Several cell lines expressing endogenous MCSP were treated with siRNA to inhibit the expression of the MCSP core protein. These included WM1341D, WM164 (vertical growth phase) and 1205Lu and A375SM (metastatic) cell lines. Inhibiting MCSP expression in all of these cell lines reduced the activation of Erk 1,2 and anchorage independent growth of these cells, with the exception of MeWo cells, which express low-to-undetectable levels of endogenous MCSP (Figure 1c, 1d).

WM1552C cells were also transfected with a construct of MCSP in which the cytoplasmic domain of MCSP was deleted (WM1552C/MCSPΔCD). Expression of this construct resulted in the formation of both a core protein and a chondroitin sulfate modified core protein (Supplementary Figure 1). In contrast to WM1552C/MCSP cells, WM1552C/MCSPΔCD failed to cause a sustained high level of activated Erk 1,2 or form colonies under these conditions (Figure 2a). WM1552C/MCSPΔCD cells also demonstrated reduced tumor growth compared to the MCSP transfectants (Figure 2b). MCSP produced an in vitro morphologic phenotype that was distinctly more spread and appeared less differentiated than either MCSPΔCD or mock transfectants when cultured in serum free medium (Supplementary Figure 2). MCSP transfectants exhibited sustained (i.e. 72 hr) constitutive activation of Erk 1,2 and this high level of activation required the presence of the intact core protein (Figure. 2c). The sustained activation of Erk 1,2 resulted in its translocation to the cell nucleus (Figure 2d), which was not observed in cells expressing MCSPΔCD. To initially probe the role of MCSP in controlling Erk 1,2 activity in melanoma cells, we first confirmed an association between Erk 1,2 and MCSP in radial phase melanoma cells (Supplementary Figure 3). MCSP co-immunoprecipitated with active Erk 1,2 but this was not detected in immunoprecipitates of β1 integrin (Supplementary Figure 3a). MCSP/Erk 1,2 co-precipitation required a cytoplasmic domain since Erk 1,2 was not detected in immunoprecipitates of MCSPΔCD (Supplementary Figure 3b). A fusion protein containing the entire cytoplasmic domain (GST-MCSP 2247-2322) also pulls down active Erk 1,2 (Supplementary Figure 3c), whereas none was detected when using either GST-MCSP 2247-2286 (which lacks the carboxyl terminal of the cytoplasmic domain) or GST alone (Supplementary Figure 3d). The results are consistent with recently published data demonstrating that that the carboxyl terminal half of the cytoplasmic domain of NG2 contains both an Erk docking site and a phosphoacceptor threonine residue (29).

Figure 2
Full length MCSP, but not MCSPΔCD, promotes growth, tumor formation and Erk 1,2 activation

Stable Expression of MCSP induces EMT changes in Radial Growth Phase Cells

Epithelial to mesenchymal transition is an important aspect of primary tumor progression that contributes to the initial invasion of tumor cells. EMT is complex, and involves increased motility, the shedding and loss of E-cadherin and increased expression of mesenchymal markers such as fibronectin and vimentin. Since expression of MCSP caused a morphological change in the WM1552C RGP cell line (Supplementary Figure 2), we decided to compare several phenotypic markers of EMT in the MCSP transfectants. Transfectants were evaluated for the expression two mesenchymal markers, fibronectin and vimentin (Figure 3). Cells expressing intact MCSP exhibit easily detectable levels of fibronectin and vimentin by immunofluorescence (Figure 3a) and western blot analysis of cell extracts (Figure 3b). By contrast, vimentin and fibronectin expression in either the mock transfectants or MCSPΔCD expressed levels of these proteins which were lower or not detectable.

Figure 3
WM1552C/MCSP cells show increased expression of mesenchymal cell markers

WM1552C/MCSP cells also exhibited significantly higher levels of activated c-Met whereas the other two cell lines expressed very low levels of this tyrosine kinase receptor (Figure 4a). MCSP also increased levels of endogenous HGF in a pattern similar to that observed for c-Met in these cell lines (Figure 4b). Densitometry analysis (normalized to the level of tubulin, not shown) demonstrated that MCSP stimulated a 5–10 fold increase in the total amount of c-Met, and that endogenous HGF expression increased the level of pc-Met by 2 fold, which could be inhibited by siRNA for HGF (Figure 4c). Supplementing the culture medium with exogenous hepatocyte growth factor (HGF) to the WM1552C/MCSP cells caused a further 2 fold activation of c-Met (Figure 4a) at 15 and 30 minutes of incubation without affecting the amount of c-Met expressed. By contrast, exogenous HGF had limited effects on activation of c-Met in the MCSPΔCD or mock transfected cells. The addition of exogenous HGF also caused almost a complete loss of E-cadherin at 30 minutes in the MCSP cells but caused only a partial inhibition of E-cadherin levels in the other two cell lines (Figure 4a). Scratch wound assays (Figure 4d) demonstrated that exogenous HGF enhanced the motility of MCSP cells, whereas it was much less effective at enhancing motility of Mock or MCSPΔCD expressing cells. RNA interference of c-Met expression significantly inhibited motility and anchorage independent growth in the WM1552C/MCSP cells, with a minimal effect on Erk 1,2, which actually demonstrated a small increase (Figures 5a,b, ,6c).6c). The enhanced motility produced by increased MCSP/c-Met could also be inhibited by using the c-Met inhibitor SU11274 (Figure 5c, Supplementary Figure 4). MCSP siRNA (Figure 5d) inhibited expression of both total and activated c-Met in multiple melanoma cell lines (WM1552C/MCSP, WM1341D and WM164, 1205Lu, A375SM). MeWo cells, which express low-to-undetectable levels of MCSP (Figure 5d), were not inhibited with this siRNA.. This is consistent with a model in which MCSP functions to enhance both the level (via MITF, below) and activation (via increased endogenous HGF) of c-Met.

Figure 4
MCSP stimulates an autocrine loop of HGF/c-Met that activates c-Met
Figure 5
WM1552C/MCSP cell migration and anchorage-independent growth is dependent upon the expression and activation of C-Met
Figure 6
Erk 1,2 mediates enhanced c-Met expression through MITF

MCSP stimulated activation of Erk 1,2 stimulates activated c-Met expression by an MITF dependent mechanism

Microphthalmia-associated transcription factor (MITF) is associated with malignant potential of melanoma cells, and Erk 1,2 activation of this transcription factor facilitates expression of c-Met (3032). We next tested the possibility that MCSP stimulated both motility and growth by an Erk 1,2/MITF/c-Met pathway. The addition of Mek-1 inhibitor U0126 decreased anchorage independent growth of WM1552C/MCSP cells (Supplementary Figure 5a and 5b). WM1552C/Mock transfectants were also stably transfected with constitutively active Mek-1 to cause sustained activation of Erk 1,2 (Supplementary Figure 5c) resulting in increased motility and growth (Supplementary Figures 5d and 5e, respectively) which were both inhibited by U0126 (Not shown and Supplementary Figure 5f). Elevated levels of MITF and c-Met expression/activation were almost completely inhibited by U0126 in WM1341D and WM1552C/MCSP cells, consistent with a model in which Erk 1,2 stimulates increased levels of MITF (Figure 6a). Treating WM1552C/MCSP cells with siRNA against MITF inhibited the expression of both MITF and c-Met (Figure 6b). Furthermore, siRNA against c-Met in these cells had no inhibitory effect on the level of MITF (Figure 6c). These data collectively support a model in which MCSP expression stimulates motility and growth by an activated Erk 1,2/MITF/c-Met pathway.

Discussion

The factors that contribute to melanoma progression in primary tumors include changes in cell adhesion molecules, expression of growth factors and their cognate receptors, and associated signaling pathways. MCSP is a cell surface proteoglycan that is detected in the vast majority of melanomas as well as in benign dysplastic nevi (1) and has been associated with increased growth and motility in tumors (1, 3). It also interacts with a number of signal transduction pathway components important for tumor progression such as activated Erk 1,2; activated focal adhesion kinase (FAK); and activated small GTPases associated with cytoskeletal reorganization (10, 11). The current studies extend these initial observations to include a function of stimulating changes in gene expression with a corresponding change in expression of HGF and expression/activation of c-Met, both of which are implicated in melanoma progression (33).

Stable transfection and expression of full length MSCP-core protein in the MCSP null WM1552C (RGP) cell enhances the level and duration of Erk1,2 activation. This is especially apparent in cells that are stressed by putting them into suspension in the absence of serum. The MCSP-induced increases in motility, growth and activation of Erk 1,2 can be reversed by using RNA interference for the MCSP core protein. The MCSP-induced activation of Erk 1,2 is required for subsequent changes in anchorage independent growth, and cell motility in vitro. This is supported by the ability of the U0126 Mek-1 inhibitor to reverse MCSP induced increased growth and motility, and by the ability of constitutively active Mek-1 to bypass the requirement for MCSP expression. Furthermore, inhibiting the expression of endogenous MCSP in VGP melanoma cells (WM1341D, WM164) and metastatic melanoma cells (A375, 1205Lu) reduces sustained activation of Erk1,2 and anchorage independent growth. This indicates the ability of MCSP to cause sustained activation of Erk 1,2 is preserved throughout progression and this may be one explanation for its widespread expression in human melanomas.

The mechanisms by which MCSP facilitates constitutive activation of Erk 1,2 remain to be defined. MCSP-mediated sustained activation of Erk 1,2 requires the cytoplasmic domain of the core protein. The MCSP core protein cytoplasmic domain is conserved with that of NG2 which contains both Erk docking and phosphoacceptor sites (29). The MCSP core protein or a recombinant fusion protein containing the cytoplasmic domain both co-precipitate/pulldown activated Erk 1,2. The total amount of Erk 1,2 that co-precipitates with the proteoglycan is a very small amount (less than 5%) of the total activated Erk within the cell, suggesting that only a portion of total Erk 1,2 interacts with MCSP. This raises the possibility that MCSP/Erk 1,2 related interactions may be controlled by a subpopulation of activated Erk 1,2 that could depend on specific scaffolds which help to assemble Erk 1,2 pathway components within different subcellular compartments (28). Although the MCSP core protein can interact with Erk 1,2, the core protein cannot directly activate Erk 1,2 indicating MCSP must be integrated with other pathways that can directly lead to Erk 1,2 activation.

The Ras/Raf/MEK/ERK pathway is a key regulator of melanoma cell proliferation, which is hyperactivated in the vast majority of human melanomas (19). BRAF, which can be constitutively activated by several mutations in melanomas, stimulates constitutive ERK signaling in tumor cells (19, 21). Sequence analysis of BRAF in WM1552C and WM1341D melanoma cell lines indicated both cells express constitutively activating mutations V600E and V660R, respectively. Furthermore, kinase assays also demonstrated that both cell lines express constitutively active BRAF (not shown) indicating that sustained activation of Erk 1,2 also requires expression of the intact MCSP core protein. WM164, 1205Lu cell lines, both of which also express mutant active BRAF, exhibit the same dependence on MCSP expression for Erk 1,2 activation (21, 34). Although mutant active BRAF is associated with constitutive activation of Erk 1,2, the action of growth factors has been shown to work in concert with this mutation to cause the strong and sustained activation of the Erk 1,2 pathway (21). Constitutively active Mek-1 can phenocopy the effect of the proteoglycan on Erk 1,2 activation, growth and motility, indicating that the core protein per se is not absolutely required for these phenotypic changes. The data favor a model in which the proteoglycan core protein can facilitate the assembly of elements of the Erk 1,2 signaling pathway stimulated by upstream activators such as growth factors and/or constitutively active BRAF. Confocal analysis shows that BRAF co-distributes at the plasma membrane with MCSP (not shown), However, neither BRAF nor Mek-1 were detected in immunoprecipitates of the proteoglycan, indicating the interaction of BRAF and/or Mek-1 with MCSP may be indirect or unable to survive the immunoprecipitation conditions.

Inhibiting c-Met or HGF expression with RNA interference inhibited the ability of MCSP to enhance motility and growth. The results also show that MCSP enhances total levels of c-Met by 5–10 fold, as well as increased MITF, a transcription factor which acts as a key regulatory factor for transcriptional regulation of c-Met expression in melanoma (30), MCSP induced activation of Erk 1,2 leads to the nuclear translocation of activated Erk 1,2 where it could influence MITF transcription. Furthermore, a Mek-1 inhibitor reverses MCSP-induced elevations in the level of MITF and cells that express the MCSPΔCD mutant, (which minimizes activation of Erk 1,2) do not express elevated levels of HGF or activated c-Met. As expected, siRNA interference with MITF expression in WM1552C/MCSP cells also inhibits c-Met expression/activation. Finally, inhibiting MCSP expression in a number of cell lines causes a decreases in the activation of Erk 1,2 and the level of activated c-Met indicating that epigenetic changes in these cells produced by MCSP include expression/activation of the c-Met receptor.

An inverse correlation between HGF and the level of E-cadherin suggests that HGF could induce rapid shedding of E-cadherin (35, 36). Down-regulation of E-cadherin in transformed cell lines has been associated with acquisition of the ability to migrate and invade; two features of epithelial to mesenchymal transition (EMT) MCSP transfected serum starved WM1552C RGP cells, which express a relatively high (5–10 fold increase compared to Mock or MCSPΔCD cells) level of c-Met, exhibit almost a complete loss of E-cadherin when a low amount of additional HGF is added to the culture medium. By contrast, this level of HGF causes only a partial inhibition of E-cadherin in the mock-transfected and MCSPΔCD mutant cell lines, a result we interpret as indicative of the lower overall level of total and activated c-Met in these two cell lines. MCSP expression in the WM1552C RGP cells also facilitates increased expression of fibronectin and vimentin, which are two phenotypic markers of EMT (37, 38). Thus MCSP could function in a primary RGP tumor to stimulate the increased motility and invasion associated with EMT.

Previous studies have focused on the function of MCSP as a cell surface adhesion molecule that can signal directly or indirectly to alter the activation of other adhesion receptors (1). The current studies indicate that MCSP can also regulate invasion and growth by an epigenetic mechanism and it may play a dynamic role in melanoma progression by enhancing the expression or function of progression-associated gene products. The current findings demonstrate that MCSP stimulates EMT related changes in RGP cells and additional MCSP induced epigenetic changes would be anticipated in melanoma cells isolated from different stages of progression. These studies indicate that MCSP is required to cause a robust and sustained activation of Erk 1,2 in several melanoma cell lines that express mutant active BRAF by a mechanism which remains to be determined. While activating BRAF mutations have been the subject of intensive investigation as a therapeutic target, these studies suggest that MCSP is an equally viable target in the treatment of melanoma.

Supplementary Material

Acknowledgments

Funded by NCI grants R01 CA82295 and R01 CA92222 to JBM.

References

1. Campoli MR, Chang CC, Kageshita T, Wang X, McCarthy JB, Ferrone S. Human high molecular weight-melanoma-associated antigen (HMW-MAA): a melanoma cell surface chondroitin sulfate proteoglycan (MSCP) with biological and clinical significance. Crit Rev Immunol. 2004;24:267–96. [PubMed]
2. Chekenya M, Rooprai HK, Davies D, Levine JM, Butt AM, Pilkington GJ. The NG2 chondroitin sulfate proteoglycan: role in malignant progression of human brain tumours. Int J Dev Neurosci. 1999;17:421–35. [PubMed]
3. Stallcup WB. The NG2 proteoglycan: past insights and future prospects. J Neurocytol. 2002;31:423–35. [PubMed]
4. Kageshita T, Nakamura T, Yamada M, Kuriya N, Arao T, Ferrone S. Differential expression of melanoma associated antigens in acral lentiginous melanoma and in nodular melanoma lesions. Cancer Res. 1991;51:1726–32. [PubMed]
5. Sorensen PH, Chen CS, Smith FO, et al. Molecular rearrangements of the MLL gene are present in most cases of infant acute myeloid leukemia and are strongly correlated with monocytic or myelomonocytic phenotypes. J Clin Invest. 1994;93:429–37. [PMC free article] [PubMed]
6. Behm FG, Smith FO, Raimondi SC, Pui CH, Bernstein ID. Human homologue of the rat chondroitin sulfate proteoglycan, NG2, detected by monoclonal antibody 7.1, identifies childhood acute lymphoblastic leukemias with t(4;11)(q21;q23) or t(11;19)(q23;p13) and MLL gene rearrangements. Blood. 1996;87:1134–9. [PubMed]
7. Smith FO, Rauch C, Williams DE, et al. The human homologue of rat NG2, a chondroitin sulfate proteoglycan, is not expressed on the cell surface of normal hematopoietic cells but is expressed by acute myeloid leukemia blasts from poor-prognosis patients with abnormalities of chromosome band 11q23. Blood. 1996;87:1123–33. [PubMed]
8. Goretzki L, Burg MA, Grako KA, Stallcup WB. High-affinity binding of basic fibroblast growth factor and platelet-derived growth factor-AA to the core protein of the NG2 proteoglycan. J Biol Chem. 1999;274:16831–7. [PubMed]
9. Grako KA, Ochiya T, Barritt D, Nishiyama A, Stallcup WB. PDGF (alpha)-receptor is unresponsive to PDGF-AA in aortic smooth muscle cells from the NG2 knockout mouse. J Cell Sci. 1999;112 (Pt 6):905–15. [PubMed]
10. Eisenmann KM, McCarthy JB, Simpson MA, et al. Melanoma chondroitin sulphate proteoglycan regulates cell spreading through Cdc42, Ack-1 and p130cas. Nat Cell Biol. 1999;1:507–13. [PubMed]
11. Majumdar M, Vuori K, Stallcup WB. Engagement of the NG2 proteoglycan triggers cell spreading via rac and p130cas. Cell Signal. 2003;15:79–84. [PubMed]
12. Fukushi J, Makagiansar IT, Stallcup WB. NG2 proteoglycan promotes endothelial cell motility and angiogenesis via engagement of galectin-3 and alpha3beta1 integrin. Mol Biol Cell. 2004;15:3580–90. [PMC free article] [PubMed]
13. Iida J, Meijne AM, Oegema TR, Jr, et al. A role of chondroitin sulfate glycosaminoglycan binding site in alpha4beta1 integrin-mediated melanoma cell adhesion. J Biol Chem. 1998;273:5955–62. [PubMed]
14. Yang J, Price MA, Neudauer CL, et al. Melanoma chondroitin sulfate proteoglycan enhances FAK and ERK activation by distinct mechanisms. J Cell Biol. 2004;165:881–91. [PMC free article] [PubMed]
15. Barritt DS, Pearn MT, Zisch AH, et al. The multi-PDZ domain protein MUPP1 is a cytoplasmic ligand for the membrane-spanning proteoglycan NG2. J Cell Biochem. 2000;79:213–24. [PubMed]
16. Chatterjee N, Stegmuller J, Schatzle P, et al. Interaction of syntenin-1 and the NG2 proteoglycan in migratory oligodendrocyte precursor cells. J Biol Chem. 2008;283:8310–7. [PubMed]
17. Stegmuller J, Schneider S, Hellwig A, Garwood J, Trotter J. AN2, the mouse homologue of NG2, is a surface antigen on glial precursor cells implicated in control of cell migration. J Neurocytol. 2002;31:497–505. [PubMed]
18. Stegmuller J, Werner H, Nave KA, Trotter J. The proteoglycan NG2 is complexed with alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors by the PDZ glutamate receptor interaction protein (GRIP) in glial progenitor cells. Implications for glial-neuronal signaling. J Biol Chem. 2003;278:3590–8. [PubMed]
19. Davies H, Bignell GR, Cox C, et al. Mutations of the BRAF gene in human cancer. Nature. 2002;417:949–54. [PubMed]
20. Houben R, Becker JC, Kappel A, et al. Constitutive activation of the Ras-Raf signaling pathway in metastatic melanoma is associated with poor prognosis. J Carcinog. 2004;3:6. [PMC free article] [PubMed]
21. Satyamoorthy K, Li G, Gerrero MR, et al. Constitutive mitogen-activated protein kinase activation in melanoma is mediated by both BRAF mutations and autocrine growth factor stimulation. Cancer Res. 2003;63:756–9. [PubMed]
22. Smalley KS. A pivotal role for ERK in the oncogenic behaviour of malignant melanoma? Int J Cancer. 2003;104:527–32. [PubMed]
23. Hingorani SR, Jacobetz MA, Robertson GP, Herlyn M, Tuveson DA. Suppression of BRAF(V599E) in human melanoma abrogates transformation. Cancer Res. 2003;63:5198–202. [PubMed]
24. Abidoye O, Murukurthy N, Salgia R. Review of clinic trials: agents targeting c-Met. Rev Recent Clin Trials. 2007;2:143–7. [PubMed]
25. Puri N, Ahmed S, Janamanchi V, et al. c-Met is a potentially new therapeutic target for treatment of human melanoma. Clin Cancer Res. 2007;13:2246–53. [PubMed]
26. Salgia R. c-Met inhibition. Clin Adv Hematol Oncol. 2006;4:823–4. [PubMed]
27. Sawada K, Radjabi AR, Shinomiya N, et al. c-Met overexpression is a prognostic factor in ovarian cancer and an effective target for inhibition of peritoneal dissemination and invasion. Cancer Res. 2007;67:1670–9. [PubMed]
28. Raman M, Chen W, Cobb MH. Differential regulation and properties of MAPKs. Oncogene. 2007;26:3100–12. [PubMed]
29. Makagiansar IT, Williams S, Mustelin T, Stallcup WB. Differential phosphorylation of NG2 proteoglycan by ERK and PKCalpha helps balance cell proliferation and migration. J Cell Biol. 2007;178:155–65. [PMC free article] [PubMed]
30. Levy C, Khaled M, Fisher DE. MITF: master regulator of melanocyte development and melanoma oncogene. Trends Mol Med. 2006;12:406–14. [PubMed]
31. McGill GG, Haq R, Nishimura EK, Fisher DE. c-Met expression is regulated by Mitf in the melanocyte lineage. J Biol Chem. 2006;281:10365–73. [PubMed]
32. Wellbrock C, Rana S, Paterson H, Pickersgill H, Brummelkamp T, Marais R. Oncogenic BRAF regulates melanoma proliferation through the lineage specific factor MITF. PLoS ONE. 2008;3:e2734. [PMC free article] [PubMed]
33. Boccaccio C, Sabatino G, Medico E, et al. The MET oncogene drives a genetic programme linking cancer to haemostasis. Nature. 2005;434:396–400. [PubMed]
34. Smalley KS, Haass NK, Brafford PA, Lioni M, Flaherty KT, Herlyn M. Multiple signaling pathways must be targeted to overcome drug resistance in cell lines derived from melanoma metastases. Mol Cancer Ther. 2006;5:1136–44. [PubMed]
35. Gruss C, Herlyn M. Role of cadherins and matrixins in melanoma. Curr Opin Oncol. 2001;13:117–23. [PubMed]
36. Li G, Schaider H, Satyamoorthy K, Hanakawa Y, Hashimoto K, Herlyn M. Downregulation of E-cadherin and Desmoglein 1 by autocrine hepatocyte growth factor during melanoma development. Oncogene. 2001;20:8125–35. [PubMed]
37. Shook D, Keller R. Mechanisms, mechanics and function of epithelial-mesenchymal transitions in early development. Mech Dev. 2003;120:1351–83. [PubMed]
38. Thiery JP. Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer. 2002;2:442–54. [PubMed]