PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Biochem Biophys Res Commun. Author manuscript; available in PMC 2010 October 16.
Published in final edited form as:
PMCID: PMC2756978
NIHMSID: NIHMS140005

Enhancement of protein misfolding cyclic amplification by using concentrated cellular prion protein source

Abstract

Protein misfolding cyclic amplification (PMCA) is a cell-free assay mimicking the prion replication process. However, constraints affecting PMCA have not been well-defined. Although cellular prion protein (PrPC) is required for prion replication, the influence of PrPC abundance on PMCA has not been assessed. Here, we show that PMCA was enhanced by using mouse brain material in which PrPC was overexpressed. Tg(MoPrP)4112 mice overexpressing PrPC supported more sensitive and efficient PMCA than wild type mice. As brain homogenate of Tg(MoPrP)4112 mice was diluted with PrPC-deficient brain material, PMCA became less robust. Our studies suggest that abundance of PrPC is a determinant that directs enhancement of PMCA. PMCA established here will contribute to optimizing conditions to enhance PrPSc amplification by using concentrated PrPC source and expands the use of this methodology.

Keywords: prion, transmissible spongiform encephalopathy, PrPC, PrPSc, protein misfolidng cyclic amplification, transgenic mice

Introduction

Small proteinaceous infectious particles known as prions are devoid of nucleic acid and cause a group of closely related, fatal neurodegenerative diseases in humans and animals called transmissible spongiform encephalopathies (TSEs) [1]. These diseases include Creutzfeldt-Jakob disease in humans, bovine spongiform encephalopathy in cattle, scrapie in sheep, and chronic wasting disease in deer and elks [1]. The primary, if not sole, component of the prion appears to be the pathogenic isoform of the prion protein, referred to as PrPSc [2]. This aberrantly folded protein propagates through a conformational change of the cellular prion protein, PrPC, as a result of interacting with the pathogenic PrPSc template [1]. The propagated PrPSc tends to aggregate and is accumulated in the brain as disease progresses.

Protein misfolding cyclic amplification (PMCA) is quickly emerging as the most prominent system among the available cell-free assays designed to mimic the PrP conversion process in vitro [3]. PMCA is a cyclic PrPSc amplification process in which brain homogenate from prion-infected animals is diluted in the brain material of healthy animals, and prion conversion is accelerated by bursts of sonication that break down PrPSc aggregates to maximize interaction with the excess amount of PrPC [4]. This methodology has been applied to a number of studies investigating de novo generation of prion infectivity in vitro, biochemical prion strain properties, prion adaptation process during interspecies transmission, and detection of minute levels of PrPSc in blood and urine [512]. However, adjustment of this assay for specific necessities still remains to be a difficult task because major constraints of PMCA have not been well defined.

Since the association between TSEs and the Prnp gene was shown [1315], development of numerous genetically manipulated murine models has made it clear that the availability of PrPC for the PrPSc conversion process strongly influences the progression of disease concomitant with PrPSc propagation. Prnp deficient (Prnpo/o) mice become completely resistant to disease with no trace of clinical symptoms or neuropathology [1618]. Upon prion infection, the level of PrPC expressed in wild type mice is sufficient to cause disease within 105–158 days [19]. On the other hand, an excess expression of PrPC has shown to accelerate the disease process. Six- to ten-fold overexpression of PrPC in the brain of transgenic lines such as Tg(MoPrP-A)4053/FVB and Tga20 resulted in abbreviated incubation times of ~45 to ~62 days [20, 21]. These studies indicate that the disease progression and prion propagation are associated with the level of PrPC expression in animals.

In PMCA, the effect of the concentration of PrPC has not been definitively addressed. Based on animal studies, we hypothesized that the level of PrPC influences PMCA. In this study, we compared PMCA carried out under varying levels of PrPC and found that the concentration of PrPC as a factor to enhance the in vitro PrPSc propagation.

Materials and methods

Tg(MoPrP)4112 mice overexpressing full length murine PrPC were generated by the methods as previously described [22] and maintained hemizygous for the transgene. Genomic DNA isolated from tail tissue of all pups at weaning was screened for the presence of the transgene construct by PCR using the transgene specific primers (forward primer, 5′ – agagctacggtggataacc – 3′ and reverse primer, 5′ – caatgacgtgttgctggagtac – 3′) under the following conditions: 94°C for 4 min; 30 cycles of 94°C for 45 s/60°C for 1 min/72°C for 3 min; 72°C for 3 min. PrPC expression in the brain was estimated by comparing brain extracts of Tg(MoPrP)4112 and wild type FVB/N mice (Harlan, Indianapolis, IN) using Western blotting with the monoclonal antibody 6H4 (Prionics AG, Zurich, Switzerland). Intracerebral inoculation of the established transgenic line, Tg(MoPrP)4112 (n=8/group), and wild type FVB/N (n=8/group) mice was conducted as previously described [23]. One percent brain homogenate of mice terminally sick by mouse adapted scrapie RML prions or non-prion material (phosphate buffered saline, PBS) was used as inocula. Brain homogenate was prepared by repeated extrusion through 16 to 21 gauge needles. The period required for appearance of a characteristic set of clinical symptoms [14] in the prion inoculated mice was measured to monitor average incubation times.

PMCA based on brain material was conducted as previously published [5, 24]. In a 96-well PCR plate (TempPlate III, USA Scientific, Ocala, FL), brain homogenate of terminally sick CD-1 mice inoculated with RML prions was serially diluted 1×102 -6.6×105 fold in 10% brain homogenate of perfused, healthy Tg(MoPrP)4112, FVB/N, or Prnp0/0 mice prepared in PMCA buffer (PBS, pH7.2 including 150 mM NaCl, 0.1% Triton X-100, 5 mM EDTA) with protease inhibitors (CompleteMini, Roche, Basel, Switzerland). A 20 μl pre-amplification aliquot was taken from each sample and saved at −20°C until used for Western blot analysis, while the remaining 100 μl underwent 94 cycles of 40 s sonication pulsed every 30 min at the power ~ 300 W in a Misonix Model 3000 microsonicator with incubation at 37°C. Twenty μl of each post-PMCA sample was digested with 100 μg/ml proteinase K at 37°C for 60 min and analyzed by Western blotting.

Western blotting was performed as described previously (Mays 2008). Blots were incubated with either 6H4 (Prionics AG) or D13 (Inpro, South San Francisco, CA) anti-PrP antibodies for detection of PrPC and proteinase K-resistant PrPSc. Doc-It Image Analysis Software (UVP, Upland, CA) was used for densitometry analysis. Densitometry data were used to estimate sensitivity and efficiency of PMCA. The sensitivity of PMCA was defined as newly generated PrPSc by PMCA over increasing dilution factors of PrPSc seeds. The level of newly generated PrPSc was calculated by subtracting the level of PrPSc seeds from the level of PrPSc after PMCA. The efficiency of PMCA was defined as fold increase of PrPSc levels achieved by PMCA at a given condition of diluted PrPSc seeds and was calculated by dividing PrPSc levels of post-PMCA by those of PrPSc seeds.

Results

In the brain, Tg(MoPrP)4112 hemizygotes expressed PrPC more than wild type FVB/N mice (Fig. 1). The expression of PrPC was ~five fold higher in brain extracts of Tg(MoPrP)4112 mice when estimated by densitometry. As expected, animals responded similarly to Tg(MoPrP-A)4053/FVB and Tga20 mice when challenged with prions. Intracerebral inoculation of Tg(MoPrP)4112 mice with RML prions resulted in an abbreviated incubation period of 58.4 ± 0.9 (average incubation time ± standard error) days compared to 114.0 ± 2.3 days for wild type FVB/N animals. Both Tg(MoPrP)4112 and FVB/N mice in control groups inoculated with non-prion material (PBS) were healthy over 500 days, suggesting that overexpression of PrPC in the newly generated transgenic line did not spontaneously develop prion disease.

Fig. 1
PrPC expression in the brains of Tg(MoPrP)4112 mice

To determine if the different PrPC levels influence PMCA, we compared the ability of RML prions to be amplified in the brain material of Tg(MoPrP)4112 hemizygote, wild type FVB/N, and Prnpo/o mice, all of which have identical FVB/N genetic background. Since all murine brain material from the same background of an inbred strain should be equivalent, this comparison eliminates the possibility of additional neuronal components aside from PrPC influencing the reaction. In PMCA followed by Western blotting, brain homogenate of wild type mice supported PrPSc amplification, showing increased PrPSc levels after PMCA compared to the level of PrPSc used as seeds (Fig. 2). The same PrPSc seeds were amplified to a much larger quantity under more diluted conditions when brain homogenate of Tg(MoPrP)4112 mice was utilized in PMCA (Fig. 2). Brain material of Prnpo/o mice failed to support PMCA, showing gradual disappearance of seeded PrPSc (Fig. 2). In control PMCA conducted without PrPSc seeds, proteinase K-resistant PrP species were not spontaneously formed from PrPC of the brain homogenate of Tg(MoPrP)4112 mice (Data not shown).

Fig. 2
PMCA with brain material of Tg(MoPrP)4112, wild type FVB/N and Prnpo/o mice

We carried out densitometry analysis of the blots and plotted newly generated PrPSc by PMCA as a function of PrPSc seed dilution factors to compare sensitivity of PMCAs performed with brain material in which PrPC levels differ. PMCA with brain material of wild type mice was not successful if the seeds were diluted > 2.7 ×103 fold (Fig. 3A), which corresponds to the results of previous reports [11, 25]. However, with Tg(MoPrP)4112 brain material, amplification of PrPSc was dramatically enhanced and lasted until PrPSc seeds were diluted 2.4 ×104 fold (Fig. 3A), although the level of amplified PrPSc was minimal at this condition. We also assessed the difference in efficiency of PMCA performed with Tg(MoPrP)4112 and wild type mouse brain material by comparing fold increase of PrPSc after PMCA. When PrPSc was diluted 1:100 fold, PMCA using both Tg(MoPrP)4112 and wild type FVB/N mouse brain homogenate exhibited similar efficiency. However, when PrPSc seeds were further diluted (> 1:300 fold), Tg(MoPrP)4112 brain material always supported more efficient PrPSc amplification than its wild type counterpart (Fig. 3B). These studies suggest that PrPC is a limiting factor for PrPSc propagation and that the abundance of PrPC enhances sensitivity and efficiency of PMCA. Thus, the elevated levels of PrPC in the Tg(MoPrP)4112 brain make it a superior source for PMCA compared to the wild type mouse brain.

Fig. 3
Sensitivity and efficiency of PMCA

To confirm that enhancement of PMCA is dependent on the concentration of PrPC, additional PMCA was performed with brain homogenate of Tg(MoPrP)4112 mice diluted ten-fold in PrPC-deficient brain material. PMCA carried out under decreased levels of PrPC exhibited reduced sensitivity and efficiency in amplifying PrPSc (Fig. 4). These results verify that altering the PrPC concentration alone can affect the ability to amplify PrPSc in PMCA.

Fig. 4
PMCA with mixed brain material of Tg(MoPrP)4112 and Prnpo/o mice

Discussion

PMCA is a useful in vitro tool to study various aspects of prion biology. Because murine models represent common and reliable systems for research in prion biology, the use of mouse brain material for PMCA continues to become more common [6, 7]. However, application of PMCA to the murine model was significantly less efficient than the initial PMCA with hamster adapted prions and brain material [11, 25]. Despite the growing need for efficient PMCA based on the murine model, the constraints that influence robust PMCA have not been defined. In this study, we found that the abundance of PrPC is critical to obtaining more sensitive and efficient PMCA. If this holds true for comparison of PMCA using mouse and hamster material, the previous findings describing brain homogenate derived from mice as being inferior to that derived from hamster may be attributed to differing concentrations of PrPC in the PMCA system.

Our results correspond to the recent studies with cervidized or humanized transgenic mouse material. Prions from mule deer with chronic wasting disease replicate more readily in PMCA using brain homogenate from transgenic mice overexpressing cervid PrPC than healthy deer brain homogenate [26]. By comparing previously published works [11, 27], brain homogenate from transgenic mice overexpressing human PrPC appears to be a more adequate source for amplifying prions of variant Creutzfeldt-Jakob disease patients than healthy human brain homogenate. Similarly, our studies showed that brain homogenate of Tg(MoPrP)4112 mice overexpressing mouse PrPC supported enhanced PrPSc amplification compared to wild type FVB/N brain material.

In this study, we showed that the abundance of PrPC is a primary contributor to PMCA. In the aforementioned studies, comparing the ability of brain material from deer and humans for PMCA to their respective transgenic mouse models left a possibility that variations in neuronal constituents between different animal species influence PrPSc amplification. We excluded such a possibility by using wild type and Tg(MoPrP)4112 mice in which neuronal constituents are identical due to their common FVB/N background. Therefore, the enhancement of PMCA achieved in our studies is solely attributed to the different concentrations of PrPC.

In conclusion, our study suggests a novel approach of improving PMCA. Our data showed that transgenic mice overexpressing native PrPC was a superior source for amplification because of the higher levels of PrPC. Application of concentrated PrPC sources in PMCA has advantages in several investigations for prion biology such as prion strain adaptation studies and diagnostics. These findings contribute to our knowledge on the constraints of this useful assay system and aid in improving its practicality.

Acknowledgments

The authors thank Dr. Stanley Prusiner for providing the cosSHa.Tet cosmid expression vector and Prnp0/0 mice to GT and Ms. Paula Thomason for editing this manuscript. This work was partially supported by the funds from the Sanders Brown Center on Aging and College of Medicine, University of Kentucky (CR), and from the NIH grants 2RO1 NS040334-04 and 1P01AI077774-015261 (GT).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

1. Prusiner SB. Prions. Proc Natl Acad Sci USA. 1998;95:13363–13383. [PubMed]
2. Prusiner SB. Novel proteinaceous infectious particles cause scrapie. Science. 1982;216:136–144. [PubMed]
3. Ryou C, Mays CE. Prion propagation in vitro: are we there yet? Int J Med Sci. 2008;5:347–353. [PMC free article] [PubMed]
4. Saborio GP, Permanne B, Soto C. Sensitive detection of pathological prion protein by cyclic amplification of protein misfolding. Nature. 2001;411:810–813. [PubMed]
5. Castilla J, Saa P, Hetz C, Soto C. In Vitro Generation of Infectious Scrapie Prions. Cell. 2005;121:195–206. [PubMed]
6. Castilla J, Morales R, Saa P, Barria M, Gambetti P, Soto C. Cell-free propagation of prion strains. EMBO J. 2008;27:2557–2566. [PubMed]
7. Castilla J, Gonzalez-Romero D, Saá P, Morales R, De Castro J, Soto C. Crossing the species barrier by PrPSc replication in vitro generates unique infectious prions. Cell. 2008;134:757–768. [PMC free article] [PubMed]
8. Green KM, Castilla J, Seward TS, Napier DL, Jewell JE, Soto C, Telling GC. Accelerated high fidelity prion amplification within and across prion species barriers. PLoS Pathog. 2008;4:e1000139. [PMC free article] [PubMed]
9. Castilla J, Saá P, Morales R, Abid K, Maundrell K, Soto C, Indu K, Ronald W. Methods in Enzymology. Academic Press; 2006. Protein misfolding cyclic amplification for diagnosis and prion propagation studies; pp. 3–21. [PubMed]
10. Castilla J, Saa P, Soto C. Detection of prions in blood. Nat Med. 2005;11:982–985. [PubMed]
11. Soto C, Anderes L, Suardi S, Cardone F, Castilla J, Frossard MJ, Peano S, Saa P, Limido L, Carbonatto M, Ironside J, Torres JM, Pocchiari M, Tagliavini F. Pre-symptomatic detection of prions by cyclic amplification of protein misfolding. FEBS Lett. 2005;579:638–642. [PubMed]
12. Gonzalez-Romero D, Barria MA, Leon P, Morales R, Soto C. Detection of infectious prions in urine. FEBS Lett. 2008;582:3161–3166. [PMC free article] [PubMed]
13. Dickinson AG, Meikle VMH, Fraser H. Identification of a gene which controls the incubation period of some strains of scrapie agent in mice. J Comp Pathol. 1968;78:293–299. [PubMed]
14. Carlson GA, Kingsbury DT, Goodman PA, Coleman S, Marshall ST, DeArmond S, Westaway D, Prusiner SB. Linkage of prion protein and scrapie incubation time genes. Cell. 1986;46:503–511. [PubMed]
15. Hunter N, Hope J, McConnell I, Dickinson AG. Linkage of the scrapie-associated fibril protein (PrP) gene and Sinc using congenic mice and restriction fragment length polymorphism analysis. J Gen Virol. 1987;68:2711–2716. [PubMed]
16. Bueler H, Aguzzi A, Sailer A, Greiner RA, Autenried P, Aguet M, Weissmann C. Mice devoid of PrP are resistant to scrapie. Cell. 1993;73:1339–1347. [PubMed]
17. Manson JC, Clarke AR, McBride PA, McConnell I, Hope J. PrP gene dosage determines the timing but not the final intensity or distribution of lesions in scrapie pathology. Neurodegeneration. 1994;3:331–340. [PubMed]
18. Prusiner SB, Groth D, Serban A, Koehler R, Foster D, Torchia M, Burton D, Yang SL, DeArmond SJ. Ablation of the prion protein (PrP) gene in mice prevents scrapie and facilitates production of anti-PrP antibodies. Proc Natl Acad Sci USA. 1993;90:10608–10612. [PubMed]
19. Carlson GA, Goodman PA, Lovett M, Taylor BA, Marshall ST, Peterson-Torchia M, Westaway D, Prusiner SB. Genetics and polymorphism of the mouse prion gene complex: control of scrapie incubation time. Mol Cell Biol. 1988;8:5528–5540. [PMC free article] [PubMed]
20. Telling GC, Haga T, Torchia M, Tremblay P, DeArmond SJ, Prusiner SB. Interactions between wild-type and mutant prion proteins modulate neurodegeneration in transgenic mice. Genes Dev. 1996;10:1736–1750. [PubMed]
21. Fischer M, Rulicke T, Raeber A, Sailer A, Moser M, Oesch B, Brandner S, Aguzzi A, Weissmann C. Prion protein (PrP) with amino-proximal deletions restoring susceptibility of PrP knockout mice to scrapie. EMBO J. 1996;15:1255–1264. [PubMed]
22. Browning SR, Mason GL, Seward T, Green M, Eliason GA, Mathiason C, Miller MW, Williams ES, Hoover E, Telling GC. Transmission of prions from mule deer and elk with chronic wasting disease to transgenic mice expressing cervid PrP. J Virol. 2004;78:13345–13350. [PMC free article] [PubMed]
23. Kim Y, Song J, Mays C, Titlow W, Yoon D, Ryou C. Changes in gene expression of kringle domain-containing proteins in murine brains and neuroblastoma cells infected by prions. Mol Cell Biochem. 2009;328:177–182. [PubMed]
24. Saa P, Castilla J, Soto C. Ultra-efficient replication of infectious prions by automated protein misfolding cyclic amplification. J Biol Chem. 2006;281:35245–35252. [PubMed]
25. Murayama Y, Yoshioka M, Yokoyama T, Iwamaru Y, Imamura M, Masujin K, Yoshiba S, Mohri S. Efficient in vitro amplification of a mouse-adapted scrapie prion protein. Neurosci Lett. 2007;413:270–273. [PubMed]
26. Kurt TD, Perrott MR, Wilusz CJ, Wilusz J, Supattapone S, Telling GC, Zabel MD, Hoover EA. Efficient in vitro amplification of chronic wasting disease PrPRES. J Virol. 2007;81:9605–9608. [PMC free article] [PubMed]
27. Jones M, Peden AH, Prowse CV, Gröner A, Manson JC, Turner ML, Ironside JW, MacGregor IR, Head MW. In vitro amplification and detection of variant Creutzfeldt-Jakob disease PrPSc. J Pathol. 2007;213:21–26. [PubMed]