PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Clin Cancer Res. Author manuscript; available in PMC 2010 October 1.
Published in final edited form as:
PMCID: PMC2756333
NIHMSID: NIHMS140319

Downregulation of ZIP4 by RNA Interference Inhibits Pancreatic Cancer Growth and Increases the Survival of Nude Mice with Pancreatic Cancer Xenografts

Abstract

Purpose

Zinc levels have been correlated with cancer risk, though the role of zinc and zinc transporters in cancer progression is largely unknown. We have recently found that a zinc transporter, ZIP4, is overexpressed in pancreatic cancer. In this study, we have further deciphered the role that ZIP4 plays in a pancreatic cancer mouse model by silencing ZIP4.

Experimental Design

ZIP4 stable silencing was established in pancreatic cancer cell lines ASPC-1 (ASPC-shZIP4) and BxPC-3 (BxPC-shZIP4) by shRNA using retrovirus vectors. The stable cells were characterized in vitro and in vivo using a nude mouse xenograft model.

Results

Silencing of ZIP4 was associated with decreased cell proliferation, migration, and invasion. Both ASPC-shZIP4 and BxPC-shZIP4 cells showed a significant reduction in tumor volume and weight in the subcutaneous model, and decreased primary tumor weight in the orthotopic model compared with the vector control cells (ASPC-shV and BxPC-shV). Silencing of ZIP4 also caused reduced incidence of tumor metastasis in the mice and downsized the tumor grade. More importantly, silencing of ZIP4 significantly increased the survival rate of nude mice with orthotopic xenografts (P = 0.005). All ASPC-shZIP4-injected mice (100%) remained alive up to 32 days after tumor implantation, whereas only 30% of the ASPC-shV mice were alive at the same time point. CyclinD1 expression was decreased in the ASPC-shZIP4 xenografts.

Conclusions

These results identify a previously uncharacterized role of ZIP4 in pancreatic cancer progression, and indicate that knocking down ZIP4 by shRNA might be a novel treatment strategy for pancreatic cancers with ZIP4 overexpression.

Introduction

Zinc is an essential trace element and catalytic/structural component utilized by many enzymes and transcription factors that contain zinc finger motifs (1, 2). Zinc is essential for growth, and zinc deficiency in animals leads to growth retardation, impaired DNA synthesis, and severe dermatitis (3). Recent studies have shown that zinc availability is also important for tumor growth and progression because zinc is a critical component for many enzymes involved in hypoxia, angiogenesis, cell proliferation, and metastasis of cancers (4, 5). On the other hand, high concentrations of zinc are toxic so cells have evolved a complex system to maintain the balance of zinc uptake, intracellular storage, and efflux (6, 7). Two solute-linked carrier (SLC) gene families were identified as zinc transporters, SLC30 which encodes for ZnT proteins, and SLC39 which encodes for ZIP proteins (79). They appear to have opposite roles in cellular zinc homeostasis. ZnT transporters reduce intracellular zinc availability by promoting zinc efflux from cells or into intracellular vesicles, while ZIP transporters increase intracellular zinc availability by promoting extracellular zinc uptake and vesicular zinc release into the cytoplasm (10). Altered expression of zinc transporters is associated with many diseases, including cancers. Recently, low levels of ZnT1 have been observed in mammary gland tumor cells. The zinc concentration in these cells are also higher than that in normal cells, which suggests that zinc transport is misregulated in these proliferating tumor cells, and zinc availability might be essential for tumor cell growth (11). In another study, ZIP6 (also known as LIV-1), a breast cancer-associated protein, which belongs to a new subfamily (LZT subfamily) of ZIP transporters, has been associated with estrogen-positive breast cancer and metastasis to lymph nodes (12). Similarly, Kagara et al found that zinc and the transporter ZIP10 were involved in invasive behavior of breast cancer cells (13). Our previous study also indicates that ZIP4 may play an important role in pancreatic cancer (14). Those reports thus suggest a positive correlation between zinc, zinc importers and cancer progression.

ZIP4, encoded by the SLC39A4 gene, plays an important role in maintaining the cellular zinc level by facilitating uptake of dietary zinc into intestinal epithelial cells, and releasing zinc from vesicular compartments (1, 6, 15). Mutations in SLC39A4 gene are thought to be the cause of a genetic disorder of zinc deficiency, acrodermatitis enteropathica (AE) (2, 16). Our recent study has indicated that ZIP4 is over-expressed in human pancreatic cancer, and aberrant expression of ZIP4 contributes to pancreatic cancer growth (14). As the fourth leading cause of cancer-related deaths in North America, pancreatic cancer has the highest fatality rate of all cancers. Survival statistics are poor because there are no reliable tests for early diagnosis and no effective therapies for the metastatic form of pancreatic cancer (1719). There is a pressing need to understand more about the pathogenesis and to develop effective prevention and treatment of pancreatic cancer. Recently, diet and nutrition prevention have brought more attention in cancer therapy including pancreatic cancer (2023). Epidemiology studies on patient diet and nutrition uptake have indicated that pancreatic cancer patients do better on a largely plant-based diet which contains low zinc (20). Tested subjects who ate the most processed meat or most red meat (high zinc diet) had a 68% or 50% greater risk of having pancreatic cancer, respectively, compared with those who ate the least processed meat and red meat (20). These results provide a diet recommendation for pancreatic cancer patients with low zinc diet. Considering the importance of zinc in many enzymes for tumor growth and metastasis, it is of great interest to investigate the role and mechanisms of ZIP4 in pancreatic cancer pathogenesis. In this study, we examined the effect of silencing ZIP4 in human pancreatic cancer both in vitro and in vivo. This study has suggested a new target for pancreatic cancer therapy.

Materials and Methods

Chemicals and cell culture

Human pancreatic cancer cell lines ASPC-1 and BxPC-3 were purchased from the American Type Culture Collection (ATCC, Rockville, MD), and was cultured in RPMI 1640 medium with 10% fetal bovine serum (FBS) as previously described (24, 25). The human ZIP4 (hZIP4) antibody was generated in rabbits against a KLH-conjugated 14-aa synthetic peptide and affinity purified basically as described previously (15). Other chemicals were from Sigma (St. Louis, MO).

ZIP4 mRNA detection

The ZIP4 mRNA was analyzed by real time RT-PCR as previously described (14, 24). Briefly, real time PCR was performed using the SYBR supermix kit (Bio-Rad, Hercules, CA). PCR reaction included the following components: 100 nM each primer, diluted cDNA templates and iQ SYBR Green supermix, and running for 40 cycles at 95°C for 20 sec and 60°C for 1 min. PCR efficiency was examined by serially diluting the template cDNA and the melting curve data were collected to check PCR specificity. Each cDNA sample was run as triplicates and the corresponding no-reverse transcriptase (RT) mRNA sample was included as a negative control. The β-actin primer was included in every plate to avoid sample variations. The relative mRNA level was presented as unit values of 2^[Ct(β-actin) − Ct(gene of interest)]. The primer sequences for human ZIP4 gene (SLC39A4) are: Sense 5′ATGTCAGGAGCGGGTCTTGC3′; and anti-sense 5′ GCTGCTGTGCTGCTGGAAC 3′.

Stable cell line selection

ZIP4 shRNA expressing stable cells were selected in ASPC-1 and BxPC-3 cells with retrovirus vectors (Origene, Rockville, MD), following manufacturer’s instructions. The sequence of the ZIP4 shRNAs used in this study is as follows: 5 ′ ACGTAGCACTCTGCGACATGGTCAGGATG 3′. Briefly, ZIP4-shRNA constructs were cotransfected into 293T cells with packing plasmids. Viral supernatants were collected and transduced to the target cells. Stable cell lines expressing ZIP4 shRNA (ASPC-shZIP4 and BxPC-shZIP4) or empty vector (ASPC-shV and BxPC-shV) were selected with adding 0.5 μg/mL of puromycin into the medium. Three stable cells expressing different shRNAs were selected.

Western blot analysis

ASPC-shV and ASPC-shZIP4 cells were lysed with ice-cold lysis buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM Na2EDTA, 1 mM EGTA, 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM β-glycerophosphate, 1 mM Na3VO4, 1 μg/mL leupeptin and protease inhibitor cocktail) for 30 min in ice. Cell lysates were then collected after centrifugation at 12,000 rpm for 5 min at 4°C. Sixty μg of lysate protein was loaded and total cellular protein was separated with 15% SDS-polyacrylamide gel electrophoresis and then transblotted overnight at 4°C onto Hybond-P PVDF membrane (Amersham Biosciences). The membrane was probed with anti-ZIP4 (1:500) or anti-β-actin (1:3000) antibody at room temperature for 1 h and then washed three times with 0.1% Tween 20-TBS and incubated in a horseradish peroxidase-linked secondary antibody (1:2000) for 1 h at room temperature. The membrane was washed three times with 0.1% Tween 20-TBS and the immunoreactive bands were detected by using enhanced chemiluminescent (ECL) plus reagent kit.

Cell proliferation assay

Cell proliferation was analyzed with the MTS assay. Stable ASPC-1 or BxPC-3 cells were seeded in 96-well plates (2×103 cells/well), and serum-starved (0% FBS) for 24 h. Cell growth was assessed on 1, 2, 3, 4, 5 days after serum starvation. For zinc dependent assay, ASPC-shV and ASPC-shZIP4, or BxPC-shV and BxPC-shZIP4 cells were treated with a membrane-permeable metal chelator, N,N,N,N-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN, Sigma) at 4 μM for 1 h at 37°C. Cells were washed with PBS to remove excess TPEN because TPEN is toxic to cells with long time incubation. Cells were then incubated with DMEM in the presence of 0, 1, and 5 μM ZnCl2. Cell growth was assessed from 1 day after treatment. Twenty μL of MTS reagent mixed with 100 μL growth medium was added to each well, and incubated in 37°C for 2 h. Absorbance was recorded at 490 nm with an EL-800 universal microplate reader (Bio-Tek Instruments, Winooski, VT).

In vitro migration and invasion assays

The cell migration/invasion was determined using a modified Boyden chamber assay. Uncoated poly carbonate inserts (BD Biosciences, San Jose, CA) of 8-μm pore size were either used uncoated or were coated with 100 μL of 100μg/mL of Matrigel (BD Biosciences). Cells trypsinized and re-suspended in growth media (105 cells/200μl) were added into the upper compartment of an invasion (Matrigel coated insert) or migration (uncoated insert) chamber and 600μl of the same growth media was added into the lower chamber. After 24 hours (for migration) and 48 hours (for invasion) the cells were incubated in Calcein-AM (Molecular Probes, Eugene, OR) for 1 hr at 37°C before fixation. The fluorescence was read from the bottom at an excitation wavelength of 495nm and emission wavelength of 520nm. Cells in the upper chamber were then removed, and cells that had migrated or invaded onto the lower surface of the membrane were quantified. The migration/invasion rate was presented as the ratio of the mean fluorescence reading after scraping of the cells divided by the reading before removing the top cells.

Pancreatic cancer mouse models

Subconfluent ASPC-shV and ASPC-shZIP4, or BxPC-shV and BxPC-shZIP4 cells were harvested by trypsinization, and resuspended in RPMI 1640. Only single cell suspensions with >95% viability were used. The cells (3×106) were inoculated either into the right flank (subcutaneous tumor model) or the body of the pancreas (orthotopic tumor model) of 5- to 6-week-old male nude mice (NCI-Charles River). All mice were cared for in accordance with the OPRR and Animal Welfare Act guidelines under an animal protocol approved by Baylor College of Medicine Institutional Animal Care and Use Committee (IACUC). For the subcutaneous tumor model, the tumor size was measured weekly using a digital caliper (VWR international, GA) and the tumor volume was determined with the formula: tumor volume [mm3] = (length [mm]) × (width [mm])2 × 0.52. For intrapancreatic injections, mice were anesthetized with 2.5% avertin and a 0.5–1 cm incision was made in the left subcostal region. The tumor cells (3×106) in a volume of 50 μL were injected into the body of the pancreas. The peritoneum and skin were closed with a 4.0 surgical suture. After 4 weeks, all surviving mice were euthanized by an overdose of CO2 exposure and evaluated macroscopically for the presence of orthotopic tumors and the metastases in the abdominal cavity. For both subcutaneous and orthotopic experiments, the animals were euthanized when their tumor size reached 2 cm in diameter or the animals became moribund during the observation period, and the time of euthanization was recorded as the time of mortality.

Immunohistochemical staining

Mouse orthotopic tumors were collected and processed into 5 μm slices. Fixed tissue slides were either H&E stained, or incubated with anti-Ki67 or cyclin D1 antibodies (Biodesign International, Cincinnati, OH) for 30 min at 4°C, before DAB visualization, and the sections were then mounted and observed under a phase contrast microscope as described previously (14).

Statistical analysis

Quantitative results are shown as means ± standard deviations. The statistical analysis was performed by the Student’s t test between control and treatment groups. The Kaplan-Meier method was used to plot survival curves for the treatment and control groups. Because the proportional hazards assumption does not hold, the log rank test was not used to compare the survival curves. Instead, the p-value for a two-sample test for proportions was reported at the 32 day time point. A p-value of < 0.05 was considered statistically significant.

Results

Silencing of ZIP4 inhibits pancreatic cancer cell proliferation, migration, and invasion

Our previous study has indicated that ZIP4 expression was differentially higher in most human pancreatic cancer cell lines compared with that in the normal human pancreatic duct epithelial (HPDE) cells (14). We selected ASPC-1 cells to silence ZIP4 by short hairpin RNA (shRNA) because parental ASPC-1 cells express more ZIP4 than other pancreatic cancer cell lines. We also selected another pancreatic cancer cell line, BxPC-3 cells, which express intermediate levels of ZIP4, to silence ZIP4 by shRNA as comparison. Three stably over-expressing ZIP4 shRNA cell lines which contained different shRNA sequences were established in both ASPC-1 and BxPC-3 cells (ASPC-shZIP4, or BxPC-shZIP4) using a retrovirus vector (Origene). Stable cells containing empty vectors (ASPC-shV, or BxPC-shV) were also established in ASPC-1 and BxPC-3 cells as controls. Silencing of ZIP4 in the three ASPC-shZIP4 or BxPC-shZIP4 cell lines was confirmed when compared with the ASPC-shV or BxPC-shV controls by real time PCR, Western blotting, and flow cytometry. ZIP4 silencing in a representative ASPC-shZIP4 stable cell line was shown in Fig. 1A and 1B (71% reduction in mRNA level, P < 0.05). ZIP4 silencing in a representative BxPC-shZIP4 stable cell line was also indicated in Fig. 1C (71% reduction in mRNA level, P < 0.05). Because of the low level of the endogenous ZIP4 protein in BxPC-3 cells, we were unable to detect the ZIP4 protein by western blot. However, we used an alternative method, flow cytometry, to examine the ZIP4 expression in BxPC-3 cells, and we found that the percentage and the mean fluorescence of ZIP4 positive cells were decreased in BxPC-shZIP4 cells compared with that in BxPC-shV cells (data not shown).

Fig. 1Fig. 1Fig. 1
ZIP4 expression was silenced by shRNA in ASPC-1 and BxPC-3 cells

To investigate whether silencing of ZIP4 affects the proliferation of pancreatic cancer cells, we compared the proliferation of ASPC-shV and ASPC-shZIP4, or BxPC-shV and BxPC-shZIP4 cells by using a MTS assay. Cells were cultured in zinc sub-optimal conditions, in which the culture medium was pre-incubated with chelex 100 to chelate the zinc ion, and low concentration and high concentration of ZnCl2 were added to the medium, respectively. As shown in Fig. 2A, at low concentration of zinc (0.5 μM), ASPC-shV cells with wild type ZIP4 showed a growth advantage over ASPC-shZIP4 cells with reduced ZIP4 expression. Silencing of ZIP4 in ASPC-shZIP4 cells was associated with 41% decreased cell proliferation by day 4, compared with that in ASPC-shV cells (P < 0.05, n=5). In high concentration of zinc (5 μM), no significant growth advantage was observed in ASPC-shV cells, probably because of the toxicity of high zinc to the cells. When the exogenous ZnCl2 exceeds 5 μM, both ASPC-shV and ASPC-shZIP4 cells died quickly after day 2 (data not shown). Similar results were also found in another pancreatic cancer cell line, BxPC-3 cells. As shown in supplementary Fig. 1, at low concentration of zinc (1 μM), BxPC-shV cells proliferated faster than BxPC-shZIP4 cells. Silencing of ZIP4 in BxPC-shZIP4 cells was associated with 27% decreased cell proliferation by day 4, compared with that in BxPC-shV cells. In high concentration of zinc (5 μM), silencing of ZIP4 in BxPC-shZIP4 cells was associated with 35% decreased cell proliferation by day 4. These results indicate that zinc plays an important role in ZIP4 shRNA-mediated growth inhibition, and difference pancreatic cancer cell lines respond to different range of zinc supplement.

Fig. 2Fig. 2Fig. 2Fig. 2
Effect of ZIP4 silencing on pancreatic cancer cell proliferation, migration, and invasion

To further study the functions of ZIP4 and to determine the effects of silencing of ZIP4 in vitro, we did cell migration and invasion assays. As shown in Fig. 2C and 2D, silencing of ZIP4 significantly decreased the cell migrative and invasive abilities of ASPC-1 cells by 68% and 81%, respectively, compared with that in ASPC-shV cells (P < 0.05). In BxPC-3 cells, silencing of ZIP4 also decreased the cell migrative and invasive abilities of BxPC-3 cells by 14% and 9%, respectively, compared with that in BxPC-shV cells. These results indicate that ZIP4 plays an important role in pancreatic cancer cell migration and invasion in vitro, which are essential features of pancreatic cancer progression.

Silencing of ZIP4 inhibits pancreatic cancer growth in the nude mouse model of subcutaneous xenograft

We further analyzed the role of ZIP4 on tumor growth in vivo using an immunodeficient nude mouse model. ASPC-shZIP4 cells showed a delayed onset of tumor growth and dramatic decrease (62%) in tumor volume after 4 weeks compared with the ASPC-shV control cells in the subcutaneous tumor model (P < 0.001, n=10; Fig. 3A). ASPC-shZIP4 also significantly reduced subcutaneous tumor weight after 4 weeks compared with ASPC-shV control cells (P < 0.05, n=10; Fig. 3B). Mice given injections of ASPC-shV cells had severe skin ulcer (90%), and loss of body weight (50%), whereas only 50% of ASPC-shZIP4 control mice showed mild skin ulcer, but no other symptoms. BxPC-shZIP4 cells also showed a delayed onset of tumor growth and dramatic decrease (67%) in tumor volume after 4 weeks compared with the BxPC-shV control cells in the subcutaneous tumor model (P < 0.05, n=10; Fig. 3C). BxPC-shZIP4 also reduced subcutaneous tumor weight (58%) after 4 weeks compared with BxPC-shV control cells (Fig. 3D).

Fig. 3Fig. 3Fig. 3Fig. 3
Effects of ZIP4 silencing on pancreatic cancer growth in the nude mouse model of subcutaneous xenograft

Silencing of ZIP4 inhibits pancreatic cancer growth and downsizes the tumor grade in the nude mouse model of orthotopic xenograft

ASPC-shZIP4 cells inhibited orthotopic tumor weight by 34% compared with the ASPC-shV control cells in the orthotopic model (Fig. 4A). Furthermore, mice given injections of ASPC-shV cells showed significant loss of body weight (80%), multiple peritoneal dissemination (100%), jaundice (50%), liver metastasis (40%), lung metastasis (20%), colon/intestine obstruction (40%), and severe abdominal ascetic fluid (40%). On the contrary, only 40% of ASPC-shZIP4 mice showed mild peritoneal dissemination, but no other symptoms (Fig. 4A and supplementary table 1). Tumors from orthotopically injected mice were removed and processed for further histological and immunohistochemical analysis. As shown in Fig 4B and Table 1, the majority of the tumors from ASPC-shV group were poorly differentiated or sarcomatoid, and the tumor area percentage were between 70% and 95% in most tumors, while most of the tumors from the ASPC-shZIP4 group were moderately differentiated, and the tumor area percentage were between 20% and 60%. Furthermore, tumors from ASPC-shZIP4-injected mice showed much decreased cell proliferation as indicated by the staining of Ki67, compared with that of the ASPC-shV mice (Fig. 4C). The stability of ZIP4 shRNA in orthotopic tumors from the ASPC-shZIP4 group was confirmed by real time RT PCR, and the expression of ZIP4 was decreased by 63% in ASPC-shZIP4 group compared with that in the ASPC-shV group at three weeks after tumor implantation (data not shown). Similarly, silencing of ZIP4 in BxPC-3 cells also inhibited orthotopic tumor growth. The take rate of the orthotopic tumors in BxPC-shZIP4 group was significantly decreased (from 60% to 20%) compared with the BxPC-shV group. BxPC-shZIP4 cells also inhibited orthotopic tumor weight compared with the BxPC-shV control cells (data not shown). Those results indicate that ZIP4 could be a malignant factor that significantly contributes to pancreatic cancer growth in vivo.

Fig. 4Fig. 4Fig. 4Fig. 4
Effects of ZIP4 silencing on pancreatic tumor progression and survival in the nude mouse model of orthotopic xenograft
Table 1
Summary of histological staining of orthotopic tumors

Silencing of ZIP4 significantly increases the survival rate of nude mouse with orthotopic xenografts

To study the effect of ZIP4 silencing in the survival of the mice, ten nude mice were orthotopically implanted with ASPC-shV or ASPC-shZIP4 cells, and the survival rate was examined everyday up to 32 days. As shown in Fig. 4D, 100% of the ASPC-shZIP4 mice remained alive up to 32 days, whereas only 30% of the ASPC-shV mice were alive at the same time point. The survival rate was significantly higher in the ASPC-shZIP4 group at 32 days (P = 0.005). Those results indicate that knocking down ZIP4 by shRNA might be an effective method to control pancreatic cancer growth, and represents a novel and potent treatment for ZIP4-overexpressed pancreatic cancer.

Silencing of ZIP4 inhibits pancreatic cancer growth through decreasing the expression of cyclin D1

In order to delineate the mechanisms of ZIP4 shRNA-induced tumor growth inhibition, we did a gene profiling study using the orthotopic tumor tissues as mentioned above. We found that cyclin D1 expression was significantly downregulated in the ASPC-shZIP4 group compared with that in the ASPC-shV group (data not shown). Cyclin D1 is an important molecule controlling cell proliferation and cell cycle progression, and is also found to be overexpressed in pancreatic cancer. To confirm the gene profiling results, we examined the expression of cyclin D1 in the orthotopic xenografts by immunohistochemistry. As shown in Fig. 5A, tumor cells in ASPC-shZIP4 group had significantly lower levels of cyclin D1 expression as compared with that in the ASPC-shV group. The percentage of cyclin D1 positive cells from ten random fields in the ASPC-shZIP4 group was decreased by 53% (Fig. 5B). The downregulation of cyclin D1 was also confirmed in the xenografts by real time RT PCR and western blot (41% reduction in cyclin D1 mRNA level, data not shown), and in the cell lines (64% reduction in cyclinD1 level in ASPC-shZIP4 cells, and 22% reduction in cyclinD1 level in BxPC-shZIP4 cells, supplementary Fig. 2), indicating that silencing of ZIP4 inhibits pancreatic cancer growth maybe through decreasing the expression of cyclin D1. Cyclin D1 is a downstream transcriptional target of NF-κB, which is overexpressed in pancreatic cancer. We examined the NF-κB expression and activation in ASPC-shZIP4 cells, and we found that the activation of NF-κB is significantly decreased when ZIP4 is silenced (supplementary Fig. 3), which indicates that NF-κB signaling might be involved in ZIP4 silencing induced growth inhibition of pancreatic cancer.

Fig. 5Fig. 5
The cyclin D1 expression in orthotopic tumors

Discussion

Recent studies indicated that zinc transport and zinc homeostasis play important roles in cancer progression, especially in pancreatic cancer and breast cancer (13, 14, 26). However, the molecular mechanism by which zinc transporters regulate cancer growth remains unknown, and it has not been described whether silencing of zinc transporters has any impact on tumor growth. In this study, we have shown that silencing of ZIP4 was associated with decreased cell proliferation, migration, and invasion in two different pancreatic cancer cell lines. In the immune deficient mice with pancreatic cancer xenografts, silencing of ZIP4 results in a dramatic decrease in tumor volume, weight, and differentiation grade, and significantly increased the survival rate of nude mice with orthotopic xenografts. The inhibition of tumor growth by ZIP4 shRNA may be through decreasing the expression of cyclin D1. Those results indicate that ZIP4 plays an important role in pancreatic cancer growth, and knocking down ZIP4 by shRNA might be a novel treatment for ZIP4-overexpressed pancreatic cancer.

Zinc is an essential factor for cell growth. Zinc deficiency is associated with diverse disorders, such as growth retardation, and delayed wound healing (3, 27). Previous studies suggest that zinc plays a critical role in cell proliferation and growth possibly through influencing the DNA synthesis and cell cycle. However, a high concentration of zinc is toxic to the cells, and causes apoptosis (28, 29). Therefore, cells must have a fine homeostatic mechanism to maintain the intracellular zinc level within a narrow physiologic range through activity of the zinc transporters. In pancreatic cancer cells, zinc stimulates cell proliferation at low concentrations. We have recently found a concentration-dependent increase of cell proliferation when less than 20 μM of exogenous ZnCl2 was added to MIA-ZIP4 cells, a pancreatic cancer cell (MIA PaCa-2) that stably overexpressed ZIP4. Higher concentrations of ZnCl2 (more than 50 μM) caused a dramatic decrease in cell proliferation (14). In ASPC-1 cells, the zinc concentration which stimulates cell proliferation is even lower. In zinc sub-optimal conditions, when low concentration of ZnCl2 (0.5 μM) was added, ASPC-shV cells with wild-type ZIP4 had a significant growth advantage over ASPC-shZIP4 cells with reduced ZIP4 expression. When incubated with a high concentration of zinc (5 μM), no significant growth advantage was observed in ASPC-shV cells compared with ASPC-shZIP4 cells, probably because of the toxicity of high zinc to ASPC-1 cells. When the exogenous ZnCl2 exceeds 5 μM, both ASPC-shV and ASPC-shZIP4 cells died quickly after 2 days. Similarly, in another pancreatic cancer cell line, BxPC-3 cells, exogenous zinc treatment (1 μM and 5 μM) caused BxPC-shV cells proliferate faster than BxPC-shZIP4 cells. These results indicate that zinc and zinc transporter ZIP4 play important roles in pancreatic cancer cell proliferation, and different pancreatic cancer cell lines respond to different range of zinc supplement.

Silencing of ZIP4 was also associated with decreased cell migration and invasion, which strongly suggests that ZIP4 not only regulates pancreatic cancer cell proliferation, but also has an impact on cancer metastasis. Two cell lines we used in this study (ASPC-1 and BxPC-3) respond differently to the ZIP4 silencing. We found that silencing of ZIP4 in BxPC-3 cells inhibits cell proliferation in vitro, and suppresses tumor growth in vivo, but only has mild inhibition on cell migration and invasion. We hypothesize that silencing of ZIP4 in BxPC-3 cells inhibits tumor growth mainly through suppressing cell proliferation. This is a little different from what we have seen in another pancreatic cancer cell, ASPC-1 cells, in which both cell proliferation and migration/invasion are significantly suppressed by ZIP4 silencing. These results indicate that silencing of ZIP4 inhibits tumor growth through different mechanisms in different pancreatic cancer cell lines. Previous studies have shown that another zinc transporter, ZIP10, is a malignant factor and is associated with metastatic phenotype of breast cancer cells. Depletion of intracellular zinc and silencing of ZIP10 in invasive breast cancer cells caused a decrease in the migratory activity of these cells, suggesting a positive correlation between zinc transport and breast cancer metastasis (13). Similarly, ZIP6 (LIV-1) has been indicated to play an important role in estrogen-positive, metastatic breast cancer (12). ZIP4, ZIP6 and ZIP10 are homologs of the nine-member LZT subfamily of ZIP transporters (10), these studies suggest a novel function of zinc transporters of the LZT subfamily in cancer metastasis and progression.

Consequently, our study that showed silencing of ZIP4 caused an inhibition of pancreatic cancer growth in both subcutaneous and orthotopic xenografts of nude mice. Both ASPC-shZIP4 and BxPC-shZIP4 cells showed a delayed onset of tumor growth and dramatic decrease in tumor volume and tumor weight in the subcutaneous model. In the orthotopic model, silencing of ZIP4 was associated with significant inhibition of orthotopic primary tumor weight, and reduction of the incidence of loss of body weight, peritoneal dissemination, jaundice, liver metastasis, lung metastasis, colon/intestine obstruction, and abdominal ascites fluid. Further histological analysis indicated that silencing of ZIP4 led to reduced tumor grades, and thereby silencing of ZIP4 may sensitize the tumors to additional therapies.

Cyclin D1 plays a critical role in promoting cell proliferation by triggering cell cycle progression from G1 to S phase. Increased expression of cyclin D1 is found in pancreatic cancer and is associated with poor prognosis and survival (3032). Forced overexpression of cyclin D1 contributes to chemoresistance of pancreatic cancer cells possibly due to the roles of cyclin D1 in promoting cell proliferation and inhibiting drug-induced apoptosis (32). In the current study, we show that silencing of ZIP4 caused significantly reduced expression of cyclin D1 in the orthotopic xenografts. Only 39% of the tumor cells are cyclin D1 positive in the ASPC-shZIP4 mice, as compared with 82% cyclin D1-positive tumor cells in the ASPC-shV mice (Fig. 5B). These data indicate that silencing of ZIP4 inhibits pancreatic cancer growth maybe through decreasing the expression of cyclin D1. Cyclin D1 is a downstream transcriptional target of NF-κB, which is often overexpressed in pancreatic cancer. We found that the activation of NF-κB is significantly decreased when ZIP4 is silenced in ASPC-1 cells, which indicates that NF-κB signaling might be involved in ZIP4 silencing induced growth inhibition of pancreatic cancer. In the future studies, it would be interesting to elucidate the more detailed upstream and downstream signaling pathways of cyclin D1 and how ZIP4 regulates the expression of cyclin D1 in pancreatic cancer.

Another exciting finding of our study is that silencing of ZIP4 increased the survival rate in nude mice with orthotopic xenografts. Those results indicate that knocking down ZIP4 by shRNA might be an effective method to control pancreatic cancer growth, and represents a novel and potent treatment for ZIP4-overexpresed pancreatic cancer. This strategy may also have a great potential in translating to clinical trails for the treatment of pancreatic cancer. By defining the ZIP4 profile in pancreatic cancer before and after therapy, we can use the ZIP4 profile to guide the choice of initial and sequential ZIP4-based therapies. Individuals with different expression of ZIP4 may respond to the ZIP4 shRNA therapy differently. Considering the short life span of shRNA, it might be necessary to modify the shRNA or use multiple cycles of shRNA treatment (33). This concept is important, since it will most likely require multiple treatment cycles to have an impact on survival in patients with metastatic pancreatic cancer; and sequential therapy could be guided by the ZIP4 profile. To increase the efficacy of shRNA therapy, combinational therapy (double or triple therapy) may represent a novel strategy for pancreatic cancer treatment. Our studies have shown that silencing of ZIP4 downsized tumor grade, and may sensitize the tumors to subsequent treatment. Therefore, the combinational therapies with ZIP4 shRNA and chemo/radiation therapy may increase the efficacy of individual therapy. Further studies are warranted to investigate whether gemcitabine, the standard chemotherapy drug for pancreatic cancer, regulates the expression of ZIP4, and whether silencing of ZIP4 sensitizes pancreatic cancer cells to gemcitabine treatment. In summary, zinc transporter ZIP4 may be a promising marker for pancreatic cancer. New therapies targeting ZIP4 have potential clinical significance in both human pancreatic cancer and other cancers with high expression of ZIP4.

Supplementary Material

Acknowledgments

We thank Dr. Lawrence A. Donehower for helpful suggestions, and Drs. Hao Liu and Susan G. Hilsenbeck for statistical analysis. We thank Dr. Robert J. Cousins (University of Florida) for providing the human ZIP4 Ab. This work was supported in part by the American Cancer Society Grant #IRG-93-034-09, the MacDonald Research Fund 06RDM013, the Dan L. Duncan Cancer Center pilot grant (M Li), and the Michael E. DeBakey Department of Surgery, Baylor College of Medicine.

Footnotes

Translational Relevance

Zinc levels have been correlated with cancer risk, though the role of zinc and zinc transporters in cancer progression is largely unknown. We have found that a zinc transporter, ZIP4, is overexpressed in human pancreatic cancer and contributes to tumor progression. In the current study, we have found that silencing of ZIP4 using shRNA is associated with decreased cell proliferation, migration, and invasion in vitro, and significant reduction in tumor growth in a nude mouse xenograft model. More importantly, silencing of ZIP4 significantly increased the survival rate of nude mice with orthotopic xenografts. These results identify a previously uncharacterized role of ZIP4 in pancreatic cancer progression, and indicate that ZIP4 could be a promising marker for pancreatic cancer. Knocking down ZIP4 by shRNA might be a novel treatment strategy for pancreatic cancers with ZIP4 overexpression.

References

1. Mao X, Kim BE, Wang F, Eide DJ, Petris MJ. A histidine-rich cluster mediates the ubiquitination and degradation of the human zinc transporter, hZIP4, and protects against zinc cytotoxicity. J Biol Chem. 2007;282:6992–7000. [PubMed]
2. Wang K, Zhou B, Kuo YM, Zemansky J, Gitschier J. A novel member of a zinc transporter family is defective in acrodermatitis enteropathica. Am J Hum Genet. 2002;71:66–73. [PubMed]
3. King JC, Cousins RJ. Modern Nutrition in Health and Disease. In: SM ME, Ross AC, Caballero B, Cousins RJ, editors. Modern Nutrition in Health and Disease. Baltimore: Lippincott Williams and Wilkins; 2005. pp. 271–85.
4. Juhasz M, Chen J, Lendeckel U, et al. Expression of carbonic anhydrase IX in human pancreatic cancer. Aliment Pharmacol Ther. 2003;18:837–46. [PubMed]
5. Garcea G, Doucas H, Steward WP, Dennison AR, Berry DP. Hypoxia and angiogenesis in pancreatic cancer. ANZ J Surg. 2006;76:830–42. [PubMed]
6. Kim BE, Wang F, Dufner-Beattie J, Andrews GK, Eide DJ, Petris MJ. Zn2+-stimulated endocytosis of the mZIP4 zinc transporter regulates its location at the plasma membrane. J Biol Chem. 2004;279:4523–30. [PubMed]
7. Liuzzi JP, Cousins RJ. Mammalian zinc transporters. Annu Rev Nutr. 2004;24:151–72. [PubMed]
8. Guerinot ML. The ZIP family of metal transporters. Biochim Biophys Acta. 2000;1465:190–8. [PubMed]
9. Eide DJ. The SLC39 family of metal ion transporters. Pflugers Arch. 2004;447:796–800. [PubMed]
10. Cousins RJ, Liuzzi JP, Lichten LA. Mammalian zinc transport, trafficking, and signals. J Biol Chem. 2006;281:24085–9. [PubMed]
11. Lee R, Woo W, Wu B, Kummer A, Duminy H, Xu Z. Zinc accumulation in N-methyl-N-nitrosourea-induced rat mammary tumors is accompanied by an altered expression of ZnT-1 and metallothionein. Exp Biol Med (Maywood) 2003;228:689–96. [PubMed]
12. Taylor KM, Morgan HE, Johnson A, Hadley LJ, Nicholson RI. Structure-function analysis of LIV-1, the breast cancer-associated protein that belongs to a new subfamily of zinc transporters. Biochem J. 2003;375:51–9. [PubMed]
13. Kagara N, Tanaka N, Noguchi S, Hirano T. Zinc and its transporter ZIP10 are involved in invasive behavior of breast cancer cells. Cancer Sci. 2007;98:692–7. [PubMed]
14. Li M, Zhang Y, Liu Z, et al. Aberrant expression of zinc transporter ZIP4 (SLC39A4) significantly contributes to human pancreatic cancer pathogenesis and progression. Proc Natl Acad Sci U S A. 2007;104:18636–41. [PubMed]
15. Liuzzi JP, Bobo JA, Lichten LA, Samuelson DA, Cousins RJ. Responsive transporter genes within the murine intestinal-pancreatic axis form a basis of zinc homeostasis. Proc Natl Acad Sci U S A. 2004;101:14355–60. [PubMed]
16. Kury S, Dreno B, Bezieau S, et al. Identification of SLC39A4, a gene involved in acrodermatitis enteropathica. Nat Genet. 2002;31:239–40. [PubMed]
17. Landis SH, Murray T, Bolden S, Wingo PA. Cancer statistics. CA Cancer J Clin. 1998;48:6–29. [PubMed]
18. Torrisani J, Buscail L. Molecular pathways of pancreatic carcinogenesis. Ann Pathol. 2002;22:349–55. [PubMed]
19. Warshaw AL, Fernandez-del Castillo C. Pancreatic carcinoma. N Engl J Med. 1992;326:455–65. [PubMed]
20. Nothlings U, Wilkens LR, Murphy SP, Hankin JH, Henderson BE, Kolonel LN. Meat and fat intake as risk factors for pancreatic cancer: the multiethnic cohort study. J Natl Cancer Inst. 2005;97:1458–65. [PubMed]
21. Jiao L, Mitrou PN, Reedy J, et al. A combined healthy lifestyle score and risk of pancreatic cancer in a large cohort study. Arch Intern Med. 2009;169:764–70. [PubMed]
22. Bae JM, Lee EJ, Guyatt G. Citrus fruit intake and pancreatic cancer risk: a quantitative systematic review. Pancreas. 2009;38:168–74. [PubMed]
23. Wang Z, Desmoulin S, Banerjee S, et al. Synergistic effects of multiple natural products in pancreatic cancer cells. Life Sci. 2008;83:293–300. [PMC free article] [PubMed]
24. Li M, Bharadwaj U, Zhang R, et al. Mesothelin is a malignant factor and therapeutic vaccine target for pancreatic cancer. Mol Cancer Ther. 2008;7:286–96. [PMC free article] [PubMed]
25. Li M, Zhai Q, Bharadwaj U, et al. Cyclophilin A is overexpressed in human pancreatic cancer cells and stimulates cell proliferation through CD147. Cancer. 2006;106:2284–94. [PubMed]
26. Margalioth EJ, Schenker JG, Chevion M. Copper and zinc levels in normal and malignant tissues. Cancer. 1983;52:868–72. [PubMed]
27. Tang Z, Sahu SN, Khadeer MA, Bai G, Franklin RB, Gupta A. Overexpression of the ZIP1 zinc transporter induces an osteogenic phenotype in mesenchymal stem cells. Bone. 2006;38:181–98. [PubMed]
28. Chesters JK, Boyne R. Nature of the Zn2+ requirement for DNA synthesis by 3T3 cells. Exp Cell Res. 1991;192:631–4. [PubMed]
29. Kim AH, Sheline CT, Tian M, et al. L-type Ca(2+) channel-mediated Zn(2+) toxicity and modulation by ZnT-1 in PC12 cells. Brain Res. 2000;886:99–107. [PubMed]
30. Gansauge S, Gansauge F, Ramadani M, et al. Overexpression of cyclin D1 in human pancreatic carcinoma is associated with poor prognosis. Cancer Res. 1997;57:1634–7. [PubMed]
31. Kornmann M, Ishiwata T, Itakura J, Tangvoranuntakul P, Beger HG, Korc M. Increased cyclin D1 in human pancreatic cancer is associated with decreased postoperative survival. Oncology. 1998;55:363–9. [PubMed]
32. Biliran H, Jr, Wang Y, Banerjee S, et al. Overexpression of cyclin D1 promotes tumor cell growth and confers resistance to cisplatin-mediated apoptosis in an elastase-myc transgene-expressing pancreatic tumor cell line. Clin Cancer Res. 2005;11:6075–86. [PubMed]
33. Liu S, Ballian N, Belaguli NS, et al. PDX-1 acts as a potential molecular target for treatment of human pancreatic cancer. Pancreas. 2008;37:210–20. [PubMed]