PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Arterioscler Thromb Vasc Biol. Author manuscript; available in PMC 2010 September 1.
Published in final edited form as:
PMCID: PMC2755066
NIHMSID: NIHMS143663

Association of Scavenger Receptors in Adipose Tissue With Insulin Resistance in Nondiabetic Humans

Abstract

Objective

Scavenger receptors play crucial roles in the pathogenesis of atherosclerosis, but their role in insulin resistance has not been explored. We hypothesized that scavenger receptors are present in human adipose tissue resident macrophages, and their gene expression is regulated by adiponectin and thaizolidinediones.

Methods and Results

The gene expression of scavenger receptors including scavenger receptor-A (SRA), CD36, and lectin-like oxidized LDL receptor-1 (LOX-1) were studied in subcutaneous adipose tissue of nondiabetic subjects and in vitro. Adipose tissue SRA expression was independently associated with insulin resistance. Pioglitazone downregulated SRA gene expression in adipose tissue of subjects with impaired glucose tolerance and decreased LOX-1 mRNA in vitro. Macrophage LOX-1 expression was decreased when macrophages were cocultured with adipocytes or when exposed to adipocyte conditioned medium. Adding adiponectin neutralizing antibody resulted in a 2-fold increase in LOX-1 gene expression demonstrating that adiponectin regulates LOX-1 expression.

Conclusion

Adipose tissue scavenger receptors are strongly associated with insulin resistance. Pioglitazone and adiponectin regulate gene expression of SRA and LOX-1, and this may have clinical implications in arresting the untoward sequalae of insulin resistance and diabetes, including accelerated atherosclerosis.

Keywords: scavenger receptors, insulin resistance, pioglitazone, adiponectin

Obesity, insulin resistance and other associated comorbidities, including atherosclerosis, are characterized by chronic inflammation.1 Insulin resistance and atherosclerosis are both associated with elevated levels of proinflammatory cytokines, and insulin resistance is a powerful and prevalent predictor of atherosclerosis and cardiovascular events. Activation and migration of macrophages into the arterial wall and adipose tissue play an important role in the pathogenesis of both atherosclerosis and insulin resistance, respectively. Oxidized LDL (oxLDL) is now thought to be a more potent mediator of atherogenesis than native LDL.2 OxLDL is internalized by a group of scavenger receptors (SRs) leading to macrophage activation, foam-cell formation, and secretion of growth factors and proinflammatory cytokines.3 Although increased infiltration of macrophages in adipose tissue has been proposed as a source of proinflammatory cytokines and potentially a common denominator linking obesity to insulin resistance,4 the role of scavenger receptors in pathogenesis of insulin resistance has not yet been studied.

Scavenger receptors are a group of transmembrane proteins involved in cellular functions, such as adhesion, and elimination of apoptotic cells and modified lipoproteins, such as oxLDL. Scavenger receptor A, (SRA, class A), CD36 (class B), and lectin-like oxidized LDL receptor-1 (LOX-1, class E) are responsible for approximately 90% of the uptake of oxLDL.3,5 In murine models, deletion of scavenger receptors such as LOX-1,6 SRA,7 or CD368 decreased formation of atherosclerotic lesions in an apolipoprotein E–null or LDLR-null background. Despite mounting evidence supporting the role of scavenger receptors in atherogenesis, their role in adipose tissue in relation to obesity and insulin resistance remains unknown. We hypothesized that scavenger receptors are present in adipose tissue resident macrophages and play an important role in obesity induced insulin resistance in humans. In this study, we quantified SRA, LOX-1, and CD36 gene expression in subcutaneous adipose tissue of nondiabetic subjects in relation to obesity and insulin resistance, as well as in response to insulin sensitizers. We also studied the effect of macrophage-adipocyte interaction on the expression of scavenger receptor genes in vitro and in response to pioglitazone.

Research Design and Methods

Human Subjects

Nondiabetic healthy subjects with no known history of coronary artery disease were recruited to the General Clinical Research Center (GCRC) by local advertisement. Subjects provided written informed consent approved by the local Institutional Review Board. Subjects were included if the fasting glucose and the 2-hour postchallenge glucose levels were under 126 mg/dL and 200 mg/dL, respectively, determined by an initial 75-g oral glucose tolerance test (OGTT). Based on the OGTT, subjects were defined as either normal glucose tolerant (NGT, 2-hour glucose <140 mg/dL), or impaired glucose tolerant (IGT, 2-hour glucose 140 to 199 mg/dL). A total of 86 subjects between age 21 and 66 years old were recruited (14 men, 72 whites, 13 blacks, and 1 Hispanics). Subjects were not taking any antiinflammatory medications, angiotensin converting enzyme-inhibitors, or angiotensin II receptor blockers during the study. Subjects had a wide range of BMI (19 to 40 kg/m2) and insulin sensitivity (SI=0.6 to 13.6×10−4 min−1/µU/mL). Total body fat percentage was determined by dual X- ray absorbsiometry. All subjects underwent an incisional subcutaneous adipose tissue biopsy from the lower abdominal wall. IGT subjects (n=38) were randomized to receive either metformin or pioglitazone. Each drug was administered in a 2-week dose escalation followed by 8 weeks at a maximum dose (1000 mg of metformin twice a day, or 45 mg of pioglitazone daily). After 10 weeks of treatment, the glucose tolerance tests, insulin sensitivity measurements, and biopsy were repeated. The mean BMI of the IGT subjects was 33±0.5 kg/m2 and mean age was 47±1 years. There was no significant difference in the baseline characteristics between the 2 drug treatment groups.

Insulin Sensitivity and Adiponectin Measurement

Insulin sensitivity was measured by an insulin-modified intravenous glucose tolerance test (FSIGT) using 11.4 g/m2 of glucose and 0.04 U/kg of insulin, as described elsewhere.9 Insulin was measured using an immunochemiluminescent assay (MLT Assay) in the GCRC Core Laboratory. This assay has sensitivity of 0.25 mU/L for insulin, with 1% cross reactivity with proinsulin and 4% to 8% coefficient of variation. Plasma glucose was measured in duplicate by a glucose oxidase assay. Insulin sensitivity was calculated from the insulin and glucose data using the MinMod Millennium program.10,11 Plasma adiponectin was measured using ELISA method (Linco Research Inc) following the manufacturer’s instruction.

Separation of Adipocytes and Stromal Vascular Fraction (SVF) From Whole Adipose Tissue

Adipocyte and SVF were isolated from adipose tissue obtained by biopsy. Briefly, the adipose tissue was digested with an equal volume of collagenase type I (Sigma) containing 1% BSA, for 30 minutes at 37°C in a shaking water bath. After complete digestion, the adipocytes were separated from the SVF by centrifugation at 300g for 5 minutes. The floating adipocytes were transferred to a fresh tube, and the remaining medium was aspirated. RNA lysis buffer was added to the pellet containing the SVF and also to the transferred adipocyte fraction and RNA was isolated using the Lipid RNeasy kit (Qiagen) according the manufacturers instructions.

Cell Culture Studies

Human Adipocytes From Stem Cells

Cultured human adipocytes were obtained by the induction of differentiation of adult derived human adipocyte stem cells (ADHASCs) isolated from discarded adipose tissue from normal women undergoing liposuction, based on the method as described previously.4 Briefly, the adipose tissue obtained from liposuction was minced and washed twice with Krebs-Ringer-Bicarbonate solution to wash out any contaminating blood. The preadipocytes were separated from the floating adipocytes by collagenase digestion as described above.

The isolated preadipocytes were maintained in preadipocyte medium (DMEM:HamsF10 vol/vol 1:1 (Invitrogen), 10% FBS, 15 mmol/L HEPES pH 7.4 (Sigma), 1% pencillin/streptomycin (Invitrogen). For experiments, preadipocytes were plated on polyester membrane inserts with 0.4-µm pore size and pore density 4×106 per cm2, for 6-well culture dishes (Corning) and grown to confluence. Differentiation was induced 2 days postconfluence using differentiation medium (DMEM:Ham’s F-10 vol/vol 1:1 (Invitrogen), 3% FBS, 15 mmol/L Hepes pH 7.4 (Invitrogen), Biotin 33 µmol/L (Sigma), pantothenate 17 µmol/L (Sigma), dexamethazone 1 µmol/L (Sigma), IBMX 0.25 mmol/L (Sigma), Insulin 1×10−7mol/L (Novo Nordisk) and rosiglitazone-1 µmol/L (Smith-Kline Beecham) for 3 days. After this, the cells were transferred to adipocyte medium that was similar in composition to the differentiation medium but without IBMX and rosiglitazone. The cells were maintained in adipocyte medium for 10 to 14 days until they were at least up to 60% differentiated. Differentiation to adipocytes was assessed by Oil Red O staining and expression of the adipocyte-specific mRNA aP2. The adipocytes at this stage cocultured with macrophages as described later.

THP-1 Macrophages

THP-1 cells, a human myelomonocytic cell line (ATCC, Manassas, VA), were maintained in RPMI medium (Invitrogen) with 10% FBS and 1% penicillin/ streptomycin (Invitrogen). To differentiate to macrophages, the THP-1 monocytes were plated at 14×106 cells per 100-mm culture dish, in serum-free medium with 1% penicillin/streptomycin and 250 nmol/L phorbol ester 12-O-tetradecanoylphorbol-13-acetate (TPA) for 3 days, after which they were used in coculture with adipocytes as described below.

ADHASC-THP-1 Macrophage Coculture Experiments

ADHASC were grown on polyester membrane inserts with 0.4-µm pore size and pore density 4×106 per cm2, for 6-well culture dishes (Corning, Sigma) and differentiated as described above. THP-1 cells were differentiated to macrophages as described above. The THP-1 macrophages were then scraped, counted using trypan blue, and seeded in the wells of the 6-well companion plate, corresponding to the adipocytes on inserts, at 30% of the confluent adipocyte numbers. The coculture was set up when ADHASC were at least 60% differentiated. The differentiated adipocytes and THP-1 macrophages were separated by 0.9 mm (membrane to bottom of well) in the same well but free to exchange medium. The differentiated adipocytes and THP-1 macrophages were cocultured for 48 hours, in alpha MEM medium (Invitrogen) containing 5 mmol/L glutamine (Invitrogen), 1× pencillin streptomycin, and 2% FBS along with individual control of adipocytes and macrophages cultured alone. Coculture experiments were performed in duplicate and the experiment repeated twice. After culture or coculture, the cells from the inserts and wells were collected separately with RNA lysis buffer.

For experiments examining the effect of the pioglitazone, the cultures or cocultures were exposed to 1.5 µmol/L pioglitazone, or as a control to DMSO, for 48 hours after which the adipocytes and macrophages were independently collected with RNA lysis buffer.

For the experiments examining the effects of conditioned medium (CM), THP-1 macrophages were treated with adipocyte CM or as a control, fibroblast CM, mixed with alpha MEM medium in a ratio of 1:1 for 48 hours. The cells were then harvested with RNA lysis buffer. Adipocyte CM was obtained by collecting medium from differentiated adipocytes maintained in alpha MEM medium containing 5 mmol/L glutamine, 1× pencillin streptomycin, and 2% FBS for a period of 48 hours. MRC-5 cells, a human fibroblast cell line, was grown in Dulbecco Modified Eagle Medium (DMEM), 1g/L glucose (Mediatech) containing 10% FBS and 1× pencillin streptomycin. Cells were then switched to alpha MEM containing 5 mmol/L glutamine, 1× pencillin streptomycin, and 2% FBS for 48 hours at which time fibroblast CM was collected.

For adiponectin neutralizing experiments, THP-1 macrophages were treated with adipocyte CM and alpha MEM medium in a ratio 1:1, in the presence of 100 ng of goat antihuman adiponectin antibody (R&D Systems). Goat IgG at 100 ng was used as a control. Macrophages were then incubated for 48 hous after which the cells were harvested with RNA lysis buffer.

Total RNA Isolation and Real-Time RT-PCR

Total RNA from adipose tissue were isolated using an RNAeasy Lipid Tissue Mini kit (Qiagen) and from cultured adipocytes and THP-1 macrophages using the RNAqueous kit (Ambion Inc), per the manufacturer’s instruction. The quantity and quality of the isolated RNA was determined by Agilent 2100 Bioanalyzer. Real-time RT-PCR was conducted as described previously.4 All data were expressed in relation to 18S RNA, where the standard curves were generated using pooled RNA from the samples assayed. Therefore, the data represent arbitrary units which accurately compare each set of samples to each other, but do not necessarily accurately compare samples between different assays. The primers for 18S and CD68 were as published before.4 The primer sequences for LOX-1, CD 36, and SRA were as follows: LOX-1 forward CTCCTTTGATGCCCCACTTA and reverse TTTCCGCATAAACAGCTCCT; CD36 forward AGATGCAGCCTCATTTCCAC and reverse CGTCGGATTCAAATACAGCA; SRA forward GCAGTTCTCATCCCTCTCAT and reverse TCTTCGTTTCCCACTTCAGG.

Western Blotting

THP-1 macrophages were treated with adipocyte CM or as a control, fibroblast CM, mixed with alpha MEM medium in a ratio of 1:1 for 48 hours. After treatment, the THP-1 cells were washed with PBS and stimulated with 0 or 10 nmol/L insulin (Novolin, NovoNordisk) for 20 minutes at 37°C and then harvested using M-Per Mammalian protein extraction reagent (Pierce) containing protease inhibitor cocktail mix (1:100) and phosphatase inhibitor cocktail 1 and 2 (1:100) (Sigma). Fifteen µg protein was electrophoresed in 4 to 15% SDS polyacryl-amide gels (Biorad) and transferred onto nitrocellulose membrane at 100 V for 1 hour at 4°C. Membranes were blocked for 30 minutes using Casein Blocker (Pierce) and immunobloted with antibodie for LOX-1 (JTX-92),12 IκBα, and phosphorylated Akt (Ser 473; Cell Signaling) overnight at 4°C with gentle rocking. Immunoblotting with a β-actin antibody (Santa Cruz) for 30 minutes at room temperature was used as the control. After washing, the blots were incubated for 1 hour at room temperature with antimouse secondary Ig (Pierce) or antirabbit secondary Ig (Pierce) or appropriately. Bands were visualized using SuperSignal West Dura Extended Duration substrate (Pierce) followed by exposure to x-ray film. Densitometric analysis was performed using ImageQuant software (Molecular Dynamics) and expressed as arbitrary densitometric value normalized to β-actin.

Statistical Analyses

The distributions of the variables of interest were examined using quantile–qualtile plots and tests of normality were performed using Shapiro-Wilk tests. Where the data were found to be nonnormally distributed (SI, gene expressions), natural logarithm transformations were used to attain approximate normality before analysis. Pearson correlation coefficients were used to describe the linear association between pairs of variables, partial correlations coefficients were used to describe the association between variables after adjusting for important covariates. Student 2-sample t tests were used to compare the pioglitazone and metformin groups with respect to SRA, LOX-1, and CD36 expression, and paired t tests were used to compare baseline and posttreatment measurements within a group. All data from samples were expressed as mean±SEM. A probability value ≤0.05 was taken to indicate statistical significance.

Results

SRA and LOX-1 mRNAs Are Expressed Predominantly in the Stromal Vascular Fraction of Adipose Tissue

Adipose tissue consists of both adipocytes and other cell types, including macrophages, preadipocytes, and other stromal cells. To investigate the source of scavenger receptors in adipose tissue, we separated the adipocytes from the stromal vascular fraction derived from 14 fat biopsy specimens and quantified the expression of SRA, LOX-1, and CD36 genes. SRA and LOX-1 mRNA levels were significantly higher in the stromal vascular fraction compared to the adipocyte fraction, whereas CD36 mRNA was more highly expressed in adipocytes (Table 1).

Table 1
Distribution of Scavenger Receptor Gene Expression Between Adipose Tissue Fractions

Expression of Scavenger Receptor Genes in Adipose Tissue Correlated Strongly With Obesity and Insulin Resistance

To explore the relationship between insulin resistance and the expression of scavenger receptor genes, we studied a group of nondiabetic subjects with a wide range of adiposity. The baseline characteristics of subjects are summarized in supplemental Table I (available online at http://atvb.ahajournals.org).

As shown in Figure 1, SRA, LOX-1, and CD36 gene expression in subcutaneous adipose tissue correlated with both BMI and SI (P≤0.1). In addition, the scavenger receptor mRNAs all correlated strongly with each other, in a pairwise correlation analysis (Table 2, upper section). However, after adjusting for BMI and other SRs, only the gene expression of SRA was associated with insulin resistance (r=−0.34, P=0.003, Table 2, upper section). SI demonstrated a stronger correlation with SRA mRNA levels than with BMI (Table 2, lower section). LOX-1 mRNA was weakly associated with SI (r=−0.21, P=0.077) while taking away the effects of other variables. We also reanalyze these data including only white subjects to eliminate the effect of ethnicity, and it did not change the results.

Figure 1
Relationship between scavenger receptors (SRA, LOX-1, and CD36) mRNA with obesity and insulin resistance. SRA and LOX-1 mRNA correlated more strongly with either BMI (P=10−10 for both) or insulin sensitivity index (P=10−12 for both) compared ...
Table 2
Pairwise Correlations (Upper Table) and Partial Correlations (Lower Table)

Effect of Insulin Sensitizers on Scavenger Receptors Genes Expression

Because scavenger receptor transcript levels (especially SRA and LOX-1) were associated with insulin sensitivity, we investigated the effect of insulin sensitizers on the expression of these receptor genes in subcutaneous adipose tissue. Pioglitazone but not metformin improved SI by 59% in subjects with IGT as reported previously.13

Treatment of subjects with pioglitazone decreased the expression of SRA mRNA in adipose tissue by 40% (0.78±0.15 to 0.45±0.06, P=0.04; Figure 2A) whereas metformin had no effect (0.78±0.12 to 0.82±0.22, P=0.84). Neither pioglitazone nor metformin had a significant effect on LOX-1 mRNA expression (1.28±0.29 to 0.89±0.25, P=0.19 for pioglitazone, 1.35±0.25 to 1.74±0.48, P=0.39 for metformin; Figure 2B). However, to determine whether there was a pleomorphic response to pioglitazone, we divided subjects into tertiles based on their baseline levels of the expression of either SRA or LOX-1 mRNA. As described above, pioglitazone decreased SRA gene expression significantly in all subjects, and this effect was especially pronounced in subjects with higher baseline SRA mRNA (Figure 2C). The response of LOX-1 to pioglitazone was also pleomorphic. Pioglitazone significantly decreased LOX-1 mRNA in subjects with the highest baseline LOX-1 mRNA, despite the fact that it had no significant effect on overall LOX-1 mRNA expression when all subjects were included (Figure 2D). Neither pioglitazone nor metformin changed the expression of CD36 mRNA in subcutaneous adipose tissue (1.03±0.20 to 0.99±0.14, P=0.87 for pioglitazone, 0.98±0.22 to 0.86±0.18, P=0.57 for metformin).

Figure 2
Effects of insulin sensitizers on SRA and LOX-1 gene expression. A, Pioglitazone decreased mRNA expression of SRA. B, Neither pioglitazone nor metformin changed the LOX-1 mRNA level significantly. C and D, In response to pioglitazone, SRA and LOX-1 expression ...

Adipocyte–Macrophage Interactions in Coculture and the Effect of Pioglitazone

Because scavenger receptor genes are expressed at high levels in the adipose tissue stromal fraction, and are correlated with CD68 gene expression, we hypothesized that the adipose environment influences gene expression in macrophages. To test this hypothesis, we analyzed gene expression in THP-1–derived macrophages cocultured with ADHASC-derived adipocytes, with and without pioglitazone. Coculture of macrophages with adipocytes had no effect on mRNA levels of CD36 or SRA, nor did pioglitazone treatment (Figure 3A). In contrast, LOX-1 gene expression in THP-1 macrophages was significantly affected by both pioglitazone and coculturing with adipocytes. As shown in Figure 3A, the addition of pioglitazone to macrophages down-regulated LOX-1 expression by 21% (P=0.0003) and coculture with adipocytes decreased expression by 79% (P=0.0003). Interestingly, the addition of pioglitazone to THP-1 macrophages during the coculture with adipocytes decreased LOX-1 mRNA expression even further, by 91% (P=1.1×10−5; Figure 3A). The expression of scavenger receptors mRNA particularly SRA and LOX-1 were very low in adipocytes. Pioglitazone treatment or macrophage coculture did not affect CD36, SRA, or LOX-1 mRNA levels in adipocytes (Figure 3B).

Figure 3
Adipocyte-macrophage interactions and the effects of pioglitazone on scavenger receptor expression in vitro. A, Treatment of THP-1 macrophages with pioglitazone or cocultured with adipocytes. (*P<0.05 compared to THP-1 macrophage, †P<0.05 ...

These data suggest that an adipocyte secretory protein modulates macrophage LOX-1 expression. To confirm this, either adipocyte or fibroblast CM was added to macrophages, and CD36, LOX-1, and SRA mRNA levels were quantified. Adipocyte CM downregulated the expression of the LOX-1 gene and protein in macrophages by 82% (P<0.01) and 34% (P=0.02), respectively (Figure 4A and 4B) compared to adding fibroblast CM to macrophages as a control. Fibroblast and adipocyte conditioned media had similar effect on CD36 and SRA mRNA and protein expression (data not shown). In addition to downregulation of LOX-1, adipocyte CM improved insulin signaling measured by phosphorylated Akt (pAkt) both in the absence or presence (10 nmol/L) of insulin by 87% (P=0.03) and 37% (P=0.01), respectively compared to fibroblast CM (Figure 4B). Similarly, IκBα protein in macrophages was higher 60% (P<0.01) when treated with adipocyte compared to fibroblast CM suggesting decreased activity in the NFκB pathway (Figure 4B).

Figure 4
Regulation of LOX-1 expression by adipocyte CM and adiponectin. A, Representative Western blots for LOX-1, IκB, and pAkt in the absence and presence of insulin. B, Summary of Western blot results (n=3), and effects of A CM on LOX-1 m RNA expression. ...

Adiponectin Antibody Prevents Adipocyte-Mediated LOX-1 Regulation

As described above, adipocytes induced a downregulation of macrophage LOX-1, IκBα, and increased pAkt suggesting that a factor secreted or released by adipocytes regulates LOX-1 gene expression, insulin signaling, and NFκB pathway. One possible candidate for such a product is adiponectin, which is an antiinflammatory adipokine, and it is stimulated by thiazolidinediones.14 To determine whether adiponectin affects macrophage LOX-1 expression, IκBα protein, and pAkt, we added adiponectin neutralizing antibody to adipocyte CM before treatment of macrophages. As shown in Figure 4, as expected adipocyte CM decreased LOX-1 expression compared to fibroblast CM but adiponectin antibody resulted in upregulation of LOX-1 mRNA in macrophages by 2-fold (Figure 4C). Similarly, adiponectin antibody partially reversed upregulation of pAkt and IκBα proteins caused by adipocyte CM (Figure 4C). The protein expression of IκBα and pAkt in THP-1 macrophages was increased by 72% and 38%, respectively when treated with adipocyte CM compared to fibroblast CM, but the change was only 36% and 20%, respectively for IκBα and pAkt protein expression when adiponectin antibody was added to adipocyte CM (Figure 4C). These results suggests that the improved insulin signaling and decreased NFκB activity observed in macrophages treated with adipocyte CM was associated with LOX-1 downregulation and were diminished by blocking adiponectin.

Discussion

Scavenger receptors, specifically SRA, CD36, and LOX-1 play crucial roles in the pathogenesis of atherosclerotic lesions by identifying and facilitating the uptake of oxidized LDL by macrophages,3,5 and the expression of scavenger receptors in human atherosclerotic lesions has been measured in a few studies.15,16 Despite the important role of adipose tissue resident macrophages in the pathogenesis of insulin resistance, to our knowledge this is the first study measuring expression of scavenger receptor genes in human adipose and their association with obesity and insulin resistance. SRA and LOX-1 mRNAs were predominantly expressed in the stromal vascular fraction of adipose tissue in contrast to CD36 mRNA, which was more abundant in adipocytes, reflecting its other function as a facilitator of long chain fatty acid uptake in adipocytes.17,18 The adipose tissue of obese, non-diabetic, insulin resistant subjects contains more CD68-expressing macrophages,4 and the correlation between scavenger receptors and CD68 gene expression and obesity/insulin resistance may be a direct result of increased macrophage number. To determine whether these receptors were independently associated with insulin resistance, we examined the correlation between SI and each scavenger receptor after adjusting for obesity, CD68, and the other scavenger receptors. Of the 3 scavenger receptor genes studied, only SRA expression remained independently associated with SI suggesting an important role for adipose tissue SRA in the pathogenesis of insulin resistance. Other relationships that remained significant after adjustment for other factors included the relationships among the different scavenger receptors and the relationship between BMI and SI.

We did not notice any differences in the gene expression of scavenger receptors between ethnic group and reanalyzed data using only white, which did not change the result.

There are a number of possible mechanisms for the upregulation of SRA in the adipose macrophages of insulin resistant subjects. The induction of SRA could be in response to increased endoplasmic reticulum stress associated with insulin resistance, as suggested previously.19 It has been proposed that macrophages are present in adipose tissue to scavenge debris from necrotic adipocytes20; we suggest that SRA expression may be important in this process. It is also possible that the upregulation of SRA plays a key role in promoting insulin resistance by activating inflammatory pathways and recruiting additional macrophages into adipose tissue.

It is also interesting to identify whether upregulation of scavenger receptors with insulin resistance occurs in other tissues, and if so, could it explain the accelerated atherosclerosis related to enhanced oxLDL uptake in insulin resistance state? The effect of pioglitazone on scavenger receptor expression becomes more important in light of recent evidence of the inhibitory effect of pioglitazone in progression of atherosclerosis in coronary vascular bed.21 Whether it is a direct effect of pioglitazone on the expression of scavenger receptors or involves other mediators such as adiponectin remains unclear.

Results from both our labs and others suggested that pioglitazone and other PPARγ activators downregulated LOX-1 mRNA in endothelial and aortic smooth muscle cells2224; however, the effect of pioglitazone on scavenger receptors gene expression in adipose tissue in human was not previously studied. In this study, treatment of IGT subjects with pioglitazone for 10 weeks downregulated the expression of SRA mRNA in subcutaneous adipose tissue and decreased LOX-1 mRNA expression in the subgroup of subjects with the highest baseline LOX-1 mRNA levels. There is a considerable literature on the antiinflammatory effects of thiazolidinediones, and our previous studies demonstrated a decrease in adipose macrophage number following pioglitazone treatment.25 In addition to reducing macrophage number, our in vitro studies suggest that pioglitazone has additional effects on macrophage gene expression. Although pioglitazone in vitro did not decrease the expression of SRA mRNA in macrophages, LOX-1 gene expression in macrophages was reduced by 21% in response to pioglitazone. However, macrophage LOX-1 expression was decreased by 70% when macrophages were cocultured with adipocytes, or when exposed to adipocyte CM, and this effect was further augmented by the treatment of cells with pioglitazone. Thus, the tissue environment likely influences macrophage scavenger receptor gene expression and response to pioglitazone. We further investigated whether the modulation of LOX-1 expression by adipocyte CM would affect insulin signaling and inflammatory pathways in THP-1 macrophages. The downregulation of LOX-1 expression was associated with improved insulin signaling and decreased activity in NFκB pathway.

Because adiponectin is secreted by adipocytes and increased in response to pioglitazone, adiponectin neutralizing antibody was added to adipocyte CM. This resulted in a 2-fold increase in LOX-1 gene expression, along with a 30% and 20% decrease in IκBα and pAkt, respectively, suggesting that adiponectin secreted by adipocytes downregulates macrophage LOX-1 gene expression in the coculture system and consequently results in beneficial effects on insulin signaling and inflammatory pathways. By neutralizing adiponectin in the adipocyte CM, these changes in LOX-1, IκBα, and pAkt were reversed, although the reversal of LOX-1 expression was greater than that of IκBα and pAkt, suggesting that other factors in adipocyte CM may be important besides adiponectin. Some human studies have shown a negative correlation between plasma adiponectin and cardiovascular disease.26,27 In addition, in vitro studies have suggested vasculoprotective effects of adiponectin mediated via an increase in endothelial nitric oxide production, or via modulation of expression of adhesion molecules.28 The present study suggests that down-regulation of LOX-1 in macrophages could be another potential mechanism for the vasculoprotective effect of adiponectin. LOX-1 is also expressed in endothelium, and an inhibitory effect of adiponectin on LOX-1 in endothelial cells could lead to a decrease in the endothelial dysfunction associated with metabolic syndrome. Pioglitazone had a small direct effect to decrease macrophage LOX-1 gene expression, which was additive with adipocyte coculture. From this we conclude that the regulation of LOX-1 by adiponectin and pioglitazone are through separate independent mechanisms. LOX-1 and SRA were expressed at much lower levels in adipocytes compared to macrophages, and we observed no significant change in adipocyte LOX-1 and SRA mRNA levels after pioglitazone treatment. A previous study reported an increase in LOX-1 mRNA in 3T3 L1 adipocytes after treatment by rosiglita-zone.29 This difference between our study and the previous study could be attributable to the different adipose cell lines or in the PPARγ ligand used or there may be other explanations.

One of the limitations of our study is the lack of information on the protein expression of scavenger receptors in human adipose tissue. As mentioned before, the expression of scavenger receptor was low in adipocytes, and they were predominantly present in stromal vascular fraction of adipose tissue. Hence, the significant correlation of scavenger receptors gene expression with insulin sensitivity is likely attributable to upregulation of SRA or LOX-1 in macrophages that infiltrate in adipose tissue of obese subjects.

Despite the abundant literature on the role of scavenger receptors in foam cell formation and atherosclerotic lesions, the association between scavenger receptors, especially SRA and LOX-1, with insulin resistance is novel. Downregulation of LOX-1 by adiponectin could be an important mechanism behind the inverse association between adiponectin and cardiovascular disease. Further studies are needed to investigate the molecular mechanisms that underlie the role of scavenger receptors in activating the adipose tissue innate immune system associated with insulin resistance. Targeting scavenger receptors such as SRA and LOX-1 may dissociate obesity from insulin resistance and may be a promising therapeutic strategy to reduce cardiovascular events.

Supplementary Material

Acknowledgments

We acknowledge technical assistance of Bounleut Phanavanh and Greg T. Nolen in measuring gene expression and cell culture experiments. We also thank Leslie Miles and Regina Dennis for assisting with subject recruitment, S. Ranganathan for insulin measurement, the nursing and laboratory staff of the GCRC for their invaluable assistance, and Richard Harris for assistance with database design and data management.

Sources of Funding

This work was supported by the Research Service of the Department of Veterans Affairs (Merit and REAP funds to N.R. and J.L.M.), and in part by the General Clinical Research Center (grant M01RR14288 from National Center for Research Resources), DK 39176 and DK 71277 (P.A.K.), and DK 71349 (C.A.P.) from the National Institutes of Health.

Footnotes

Reprints: Information about reprints can be found online at http://www.lww.com/reprints

Disclosures

N.R. and P.A.K. have received honoraria for speaking engagements from Takeda Pharmaceuticals.

References

1. Berg AH, Scherer PE. Adipose tissue, inflammation, and cardiovascular disease. Circ Res. 2005;96:939–949. [PubMed]
2. Mehta JL. Oxidized or Native Low-Density Lipoprotein Cholesterol: Which Is More Important in Atherogenesis? J Am Coll Cardiol. 2006;48:980–982. [PubMed]
3. Martin-Fuentes P, Civeira F, Recalde D, Garcia-Otin AL, Jarauta E, Marzo I, Cenarro A. Individual variation of scavenger receptor expression in human macrophages with oxidized low-density lipoprotein is associated with a differential inflammatory response. J Immunol. 2007;179:3242–3248. [PubMed]
4. Di Gregorio GB, Yao-Borengasser A, Rasouli N, Varma V, Lu T, Miles LM, Ranganathan G, Peterson CA, McGehee RE, Kern PA. Expression of CD68 and macrophage chemoattractant protein-1 genes in human adipose and muscle tissues: association with cytokine expression, insulin resistance, and reduction by pioglitazone. Diabetes. 2005;54(8):2305–2313. [PubMed]
5. Kunjathoor VV, Febbraio M, Podrez EA, Moore KJ, Andersson L, Koehn S, Rhee JS, Silverstein R, Hoff HF, Freeman MW. Scavenger receptors class A-I/II and CD36 are the principal receptors responsible for the uptake of modified low density lipoprotein leading to lipid loading in macrophages. J Biol Chem. 2002;277:49982–49988. [PubMed]
6. Mehta JL, Sanada N, Hu CP, Chen J, Dandapat A, Sugawara F, Satoh H, Inoue K, Kawase Y, Jishage Ki, Suzuki H, Takeya M, Schnackenberg L, Beger R, Hermonat PL, Thomas M, Sawamura T. Deletion of LOX-1 reduces atherogenesis in LDLR knockout mice fed high cholesterol diet. Circ Res. 2007;100:1634–1642. [PubMed]
7. Suzuki H, Kurihara Y, Takeya M, Kamada N, Kataoka M, Jishage K, Ueda O, Sakaguchi H, Higashi T, Suzuki T, Takashima Y, Kawabe Y, Cynshi O, Wada Y, Honda M, Kurihara H, Aburatani H, Doi T, Matsumoto A, Azuma S, Noda T, Toyoda Y, Itakura H, Yazaki Y, Horiuchi S, Takahashi K, Kruijt JK, van Berkel TJC, Steinbrecher UP, Ishibashi S, Maeda N, Gordon S, Kodama T. A role for macrophage scavenger receptors in atherosclerosis and susceptibility to infection. Nature. 1997;386:292–296. [PubMed]
8. Febbraio M, Podrez EA, Smith JD, Hajjar DP, Hazen SL, Hoff HF, Sharma K, Silverstein RL. Targeted disruption of the class B scavenger receptor CD36 protects against atherosclerotic lesion development in mice. J Clin Invest. 2000;105:1049–1056. [PMC free article] [PubMed]
9. Bergman RN, Prager R, Volund A, Olefsky JM. Equivalence of the insulin sensitivity index in man derived by the minimal model method and the euglycemic glucose clamp. J Clin Invest. 1987;79:790–800. [PMC free article] [PubMed]
10. Bergman RN, Ider YZ, Bowden CR, Cobelli C. Quantitative estimation of insulin sensitivity. Am J Physiol Endocrinol Metab. 1979;236:E667–E677. [PubMed]
11. Boston RC, Stefanovski D, Moate PJ, Sumner AE, Watanabe RM, Bergman RN. MINMOD Millennium: a computer program to calculate glucose effectiveness and insulin sensitivity from the frequently sampled intravenous glucose tolerance test. Diabetes Technology & Therapeutics. 2003;5:1003–1015. [PubMed]
12. Marwali MR, Hu CP, Mohandas B, Dandapat A, Deonikar P, Chen J, Cawich I, Sawamura T, Kavdia M, Mehta JL. Modulation of ADP-induced platelet activation by aspirin and pravastatin: role of lectin-like oxidized low-density lipoprotein receptor-1, nitric oxide, oxidative stress, and inside-out integrin signaling. J Pharmacol Exp Ther. 2007;322:1324–1332. [PubMed]
13. Rasouli N, Kern PA, Reece EA, Elbein SC. Effects of pioglitazone and metformin on beta-cell function in nondiabetic subjects at high risk for type 2 diabetes. Am J Physiol Endocrinol Metab. 2007;292:E359–E365. [PubMed]
14. Rasouli N, Yao-Borengasser A, Miles LM, Elbein SC, Kern PA. Increased plasma adiponectin in response to pioglitazone does not result from increased gene expression. Am J Physiol Endocrinol Metab. 2006;290:E42–E46. [PubMed]
15. Kataoka H, Kume N, Miyamoto S, Minami M, Moriwaki H, Murase T, Sawamura T, Masaki T, Hashimoto N, Kita T. Expression of lectinlike oxidized low-density lipoprotein receptor-1 in human atherosclerotic lesions. Circulation. 1999;99:3110–3117. [PubMed]
16. Morawietz H, Erbs S, Holtz J, Schubert A, Krekler M, Goettsch W, Kuss O, Adams V, Lenk K, Mohr FW, Schuler G, Hambrecht R. Endothelial protection, AT1 blockade and cholesterol-dependent oxidative stress: The EPAS Trial. Circulation. 2006;114:I-296. [PubMed]
17. Abumrad NA, el-Maghrabi MR, Amri EZ, Lopez E, Grimaldi PA. Cloning of a rat adipocyte membrane protein implicated in binding or transport of long-chain fatty acids that is induced during preadipocyte differentiation. Homology with human CD36. J Biol Chem. 1993;268:17665–17668. [PubMed]
18. Febbraio M, Silverstein RL. CD36: Implications in cardiovascular disease. Int J Biochem Cell Biol. 2007;39:2012–2030. [PMC free article] [PubMed]
19. Han S, Liang CP, Vries-Seimon T, Ranalletta M, Welch CL, Collins-Fletcher K, Accili D, Tabas I, Tall AR. Macrophage insulin receptor deficiency increases ER stress-induced apoptosis and necrotic core formation in advanced atherosclerotic lesions. Cell Metabolism. 2006;3:257–266. [PubMed]
20. Cinti S, Mitchell G, Barbatelli G, Murano I, Ceresi E, Faloia E, Wang S, Fortier M, Greenberg AS, Obin MS. Adipocyte death defines macrophage localization and function in adipose tissue of obese mice and humans. J Lipid Res. 2005;46:2347–2355. [PubMed]
21. Nissen SE, Nicholls SJ, Wolski K, Nesto R, Kupfer S, Perez A, Jure H, De Larochelliere R, Staniloae CS, Mavromatis K, Saw J, Hu B, Lincoff AM, Tuzcu EM. Comparison of pioglitazone vs glimepiride on progression of coronary atherosclerosis in patients with type 2 diabetes: the PERISCOPE randomized controlled trial. JAMA. 2008;299:1561–1573. [PubMed]
22. Mehta JL, Hu B, Chen J, Li D. Pioglitazone inhibits LOX-1 expression in human coronary artery endothelial cells by reducing intracellular superoxide radical generation. Arterioscler Thromb Vasc Biol. 2003;23:2203–2208. [PubMed]
23. Hofnagel O, Luechtenborg B, Stolle K, Lorkowski S, Eschert H, Plenz G, Robenek H. Proinflammatory Cytokines Regulate LOX-1 Expression in Vascular Smooth Muscle Cells. Arterioscler Thromb Vasc Biol. 2004;24:1789–1795. [PubMed]
24. Chiba Y, Ogita T, Ando K, Fujita T. PPARγ Ligands Inhibit TNF-α-Induced LOX-1 Expression in Cultured Endothelial Cells. Biochem Biophys Res Comm. 2001;286:541–546. [PubMed]
25. Bodles AM, Varma V, Yao-Borengasser A, Phanavanh B, Peterson CA, McGehee REJ, Rasouli N, Wabitsch M, Kern PA. Pioglitazone induces apoptosis of macrophages in human adipose tissue. J Lipid Res. 2006 M600235-MJLR200. [PubMed]
26. Goldstein BJ, Scalia R. Adipokines and vascular disease in diabetes. Curr Diab Rep. 2007;7:25–33. [PubMed]
27. Pischon T, Girman CJ, Hotamisligil GS, Rifai N, Hu FB, Rimm EB. Plasma adiponectin levels and risk of myocardial infarction in men. JAMA. 2004;291:1730–1737. [PubMed]
28. Zhu W, Cheng KKY, Vanhoutte PM, Lam KSL, Xu A. Vascular effects of adiponectin: molecular mechanisms and potential therapeutic intervention. Clinical Science. 2008;114:361–374. [PubMed]
29. Chui PC, Guan HP, Lehrke M, Lazar MA. PPAR{γ} regulates adipocyte cholesterol metabolism via oxidized LDL receptor 1. J Clin Invest. 2005;115:2244–2256. [PMC free article] [PubMed]