Search tips
Search criteria 


Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Biochem Biophys Res Commun. Author manuscript; available in PMC 2010 November 13.
Published in final edited form as:
PMCID: PMC2754605

PLD2 has both enzymatic and cell proliferation-inducing capabilities, that are differentially regulated by phosphorylation and dephosphorylation


Phospholipase D2 (PLD2) overexpression in mammalian cells results in cell transformation. We have hypothesized that this is due to an increase of de novo DNA synthesis. We show here that overexpression of PLD2-WT leads to an increased DNA synthesis, as measured by the expression levels of the proliferation markers PCNA, p27KIP1 and phospho-histone-3. The enhancing effect was even higher with phosphorylation-defficient PLD2-Y179F and PLD2-Y511F mutants. The mechanism for this did not involve the enzymatic activity of the lipase, but, rather, the presence of the protein tyrosine phosphatase CD45, as silencing with siRNA for CD45 abrogated the effect. The two Y→F mutants had in common a YxN consensus site that, in the phosphorylated counterparts, could be recognized by SH2-bearing proteins, such as Grb2. Even though Y179F and Y511F cannot bind Grb2, they could still find other protein partners, one of which, we have reasoned, could be CD45 itself. Affinity purified PLD2 is indeed activated by Grb2 and deactivated by CD45 in vitro. We concluded that phosphorylated PLD2, aided by Grb2, mediates lipase activity, whereas dephosphorylated PLD2 mediates an induction of cell proliferation, and the specific residues involved in this newly discovered regulation of PLD2 are Y179 and Y511.

Keywords: PCNA, cell proliferation, phospholipase, tyrosine, phosphatase


Phospholipase D (PLD) catalyzes the hydrolysis of phosphatidylcholine to generate the lipid second messenger phosphatidic acid (PA), and choline, in response to mitogenic signals such as PDGF, EGF, FGF, insulin, IGF, VEGF and serum [1-9]. The expression levels of the PLD gene are under developmental control and can also vary during the different stages of cell differentiation. Cell differentiation is accompanied with a very large increase in PLD2 expression. It has been demonstrated that PLD can also contribute to increased cell transformation [10]. Rat fibroblasts are transformed during elevated expression of Src or EGF-R and overexpression of PLD1 or PLD2 [11-13]. PLD activity has been reported to be elevated in cells transformed by v-Src, v-Fps, v-Ras and v-Raf and tyrosyl-phosphorylated PLD2 has been reported [14-19]. In general, the phosphotyrosine motif p-YxN serves as docking sites for recruitment of SH2-domain containing proteins like the growth factor receptor bound protein 2 (Grb2) [20]. As indicated previously by our laboratory, PLD2 exists as a complex with Grb2 and PTP1b [21]. Also, Grb2 is found complexed with Sos in vivo [22-24] and PLD2 binds Grb2 and recruits Sos [25]. PLD-produced PA can bind directly to PLD [26] and it has been proposed that once activated, the cell could follow different paths alternatively during different stages of development: PLD2/Grb2/Sos and, through PA binding to Sos, resulting in either case in the activation of Ras and the ERK pathway [27]. Nevertheless, the signaling mechanisms that are in play for cell proliferation are not completely understood.

We have hypothesized that an increase in cell transformation in PLD2-overexpressing cells could be due to an increase of de novo DNA synthesis induced by PLD2. We uncovered an unexpected dual regulation by phosphorylation and dephosphorylation of lipase activity and proliferation-inducing capabilities of the human isoform PLD2 and show the specific tyrosine residues involved in those functions: Y179 and Y511.



COS-7 cells (ATCC) were initially seeded at 1×105 cells/well in 6-well tissue culture plates, in 2 ml D-MEM containing 10% FBS and non-essential amino acids. Cells were grown at 37 °C in a CO2 incubator until they were 60-70% confluent (~36 h). Human breast cancer MCF-7 cells were maintained in Dulbecco's modified Eagle's medium (DMEM), phenol free, with 10% bovine calf serum.

Affinity purification of PLD2

Six well plates of COS-7 cells (~60% confluency) were transfected with pcDNA3.1-mycPLD2 (0.3 ml of a lipid-DNA complex with 2 μg pcDNA-mycPLD2 plasmid, 3 μl lipofectamine (Invitrogen, Carlsbad, CA) and 5 μl “plus” reagent (Invitrogen, Carlsbad, CA) in Opti-MEM (Invitrogen, Carlsbad, CA), previously mixed in sterile glass test tubes. After a 3-hour incubation, cells were washed and re-fed with DMEM/FBS complete media). After 36 hours, cells were harvested, washed 2x in PBS and lysed in lysis buffer (0.3% Triton X-100, 5 mM HEPES, pH 7.4, plus freshly added 1 μg/ml aprotinin, and 1 μg/ml leupeptin). The lysate (1.0-1.5 mg/ml protein) was sonicated, and the supernatant was applied to a 8 μl batch of α-myc agarose matrix (Santa Cruz, Santa Cruz, CA) and rotated for 2 hr at 4 °C. Immunocomplex beads were then washed with LiCl (100 mM Tris-HCl, pH 7.4, 400 mM LiCl) and NaCl (10 mM Tris-HCl, pH 7.4 100 mM NaCl, 1 mM EDTA) Wash Buffers. PLD2-bound α-myc agarose was resuspended in 100 μl of 5mM HEPES, pH 7.5. Reactions were split into 2 × 50 μl aliquots for various assays. Purity of purified PLD2 was assessed by immunoblotting. Samples were loaded onto a 4-20% gradient SDS gel and electrophoresed, transferred onto PVDF membrane and immunoblotted with 1:1,000 α-myc rabbit antibody and 1:3,000 Sheep anti-rabbit HRP IgG antibody. The immunoreactivity was visualized using ECL reagents (GE Healthcare, Piscataway, NJ).

Phospholipase activity

Measurement of lipase activity began with the addition of the following reagents (final concentrations): 3.5 mM PC8 phospholipid, 45 mM HEPES (pH 7.8), and 1 μCi [3H]n-Butanol in a liposome form, as indicated in [28,29]. Samples were incubated for 20 minutes at 30 °C with continuous shaking. Addition of 0.3 ml ice-cold chloroform/methanol (1:2) stopped the reactions. Lipids were then isolated and resolved by thin layer chromatography. The amount of [3H]-PBut that co-migrated with PBut standards was measured by scintillation spectrometry. Control reactions lacking PC8 were used to remove background counts.

Cell proliferation markers

De novo DNA synthesis was quantified as protein expression of the proliferation marker PCNA (proliferating cell nuclear antigen) [30], using a specific purified anti-PCNA antibody (PC10, BioLegend, CA). Samples were further treated with FITC-conjugated secondary antibodies and observed by fluorescence microscopy. Positive nuclei were counted under the microscope at 16x objective in 5 different fields and averages were then calculated. P27KIP1 and phospho-histone-3 were monitored by their expression levels after PLD2 overexpression by immunoprecipitation and Western blotting using specific antibodies.

Preparation of phosphorylation-deficient PLD2 mutants

The construct pcDNA-mycPLD2 [26] was used as a template to create four Y→F point substitutions (Y179F, Y296F, Y415F and Y511F) following the QuickChange XL Site-Directed mutagenesis protocol (Stratagene, La Jolla, CA), using the following sets of primers: Y179F-sense: TCTTGACCATGTCTTTCTTTCGAAACTACCATGCC, Y179-antisense: GGCATGGTAGTTTCGAAAGAAAGACATGGTCAAGA; Y296F-sense: CTCAAGTGCAGCAGCTTTCGGCAGGCACGGTGG, Y296F-antisense: CCACCGTGCCTGCCGAAAGCTGCTGCACTTGAG; Y415F-sense: GGCATCAACAGTGGCTTTAGCAAGAGGGCG, Y415F-antisense: CGCCCTCTTGCTAAAGCCACTGTTGATGCC; Y511F-sense: GGCTGGGCAAGGACTTCAGCAATCTTATCACC, Y511F-antisense: GGTGATAAGATTGCTGAAGTCCTTGCCCAGCC. All oligonucleotides and their reverse complements were PAGE/HPLC purified (Integrated DNA Technologies, Coralville, IA). Molecular identity of the three pcDNA-mycPLD2 mutants was confirmed by direct sequence analysis (Agencourt Bioscience Corporation, Beverly MA).


As indicated by several authors [11,12,32,33], PLD2 overexpression induces transformation. We began our experiments with the hypothesis that PLD2 expression would increase de novo DNA synthesis. We transfected COS-7 with the PLD2-wild type and saw that the cell proliferation maker PCNA (as positive stained nuclei) was elevated in PLD2-WT expressing cells with respect to mock controls (Figure 1A,B). PCNA is a nuclear protein whose expression is elevated when cells are committed to enter the S phase of the cell cycle as is taken here as an index for de novo DNA synthesis. As demonstrated in earlier work from our laboratory [25], PLD2 is regulated by phosphorylation, with the Y179 residue playing an important role. We have prepared phosphorylation-deficient mutant PLD2-Y179F as well as three new Y→F point mutants (PLD2-Y296F, PLD2-Y415F and PLD2-Y511F) targeting suspected sites of tyrosine kinase phosphorylation. Figure 1C-F shows that while PLD2-Y296F and PLD2-Y415F failed to elicit a proliferation response, PLD2-Y179F and PLD2-Y511F, show an increase in proliferation-inducing capabilities even larger than that observed for PLD2-WT. A quantification of PCNA positive nuclei with all PLD2 constructs is presented in Figure 1G. Additionally, Figure 3H presents two other cell cycle markers (for Y179F, as an example), p27KIP1 and phosphohistone. The figure shows an elevation of p27KIP1 expression in WT with respect to mock, and more so in Y179F, and an increase of phospho-histone expression with respect to mock of both PLD2-wt and PLD2-Y179F, all consistent with an induction of cell cycling as seen in cell proliferation.

Figure 1
Study of DNA synthesis-inducing capabilities of PLD2 and four phosphorylation-deficient mutants
Figure 3
Cofactors needed for full PLD2 activity

We next investigated the possible mechanism that could govern the observed PLD2-proliferation inducing effect, first looking at the activity of the enzyme. Transfection of COS-7 cells with PLD2-WT led to a robust increase in lipase activity, as expected. Transfection with any of the four mutants resulted in a near-abrogation of PLD2 activity (Figure 2A), indicating that Y179, Y296, Y415 and Y511 may need to be phosphorylated in order for PLD2 to exhibit its high lipase activity. Comparing these results with those of Fig. 1, a preliminary correlation between PLD activity and induction of de novo DNA synthesis could not be derived, as Y179F and Y511F had enhancing effects on PCNA but had lost their enzymatic activity. We therefore explored other signaling mechanisms.

Figure 2
Identification of the mechanism of PLD2-induced DNA synthesis

A close look at the PLD2 amino acid sequence indicated that the only trait that set PLD2-Y179F/PLD2-Y511F and PLD2-Y296F/PLD2-Y415F apart was that the former set had the two tyrosines within the consensus site YxN. This site is precisely recognized by SH2-bearing proteins, one of those being Grb2 [25]. However, PLD2-Y179F and PLD2-Y511F are phosphorylation-deficient mutants and cannot be phosphorylated, making binding to Grb2 unlikely. Nevertheless, nothing prevents those mutants from binding to other proteins, and we hypothesized that the protein phosphatases could be at play. The protein tyrosine phosphoatase-1B has been reported to form a complex with PLD2 in vivo [21]. As Figure 2B presents, silencing CD45 expression with ds-RNA led to a significant decrease in PCNA induction of the Y→F mutants, but not in the wild type. This indicates that the proliferation-inducing capabilities of PLD2 are CD45-dependent.

We reasoned then that if de-phospho-PLD2 could associate with CD45, then the phospho-PLD2 form with Y179 and Y511 residues fully phosphorylated within the pYxN consensus sites, would be targets for docking SH2-beareing proteins, such as Grb2. We tested this hypothesis in two systems: lysates from cells overexpressing PLD2-wt and Y→F mutants, and with a purified enzyme. In the first approach, lysates from PLD2-overeexpressing cells were mixed with or without recombinant Grb2 and taken for PLD activity. As Figure 3A shows, Grb2 had a positive effect on the enzymatic activity in the wild type PLD2, but not in the PLD2-Y179F or PLD2-Y511F mutants, indicating that it is only the phosphorylated form that binds to Grb2. The PLD2 activity was expressed in cells as a phosphorylated enzyme [21].

Lastly, we utilized the same myc-pcDNA3-PLD2a-WT overexpression construct [31] in COS-7 cells and generated an immunoaffinity-purified enzyme taking advantage of the myc tag during immunoprecipitation and affinity-purification procedures. Figure 3B shows purity of PLD2. This preparation bears a relatively high level of lipase activity (~1,800 dpm/mg protein) indicating that the cells produced a constitutively active enzyme that retained its activity throughout the process of affinity purification and dialysis. The protein tyrosine phosphatase CD45 at 5 μg/ml caused a loss of activity of ~40% of the immunoaffinity purified PLD2 enzymatic activity (Figure 3C). The effect was abrogated with pretreatment of CD45 with a cocktail of phosphatase inhibitors. Conversely, the addition of recombinant Grb2 further increased the activity of the lipase. The positive effect of Grb2 on purified PLD2 is significantly larger than that seen in Fig 3A in crude cell lysates. This is probably due to that the basal level of the purified enzyme was not masked by co-factors left behind during purification/dialysis. As Figure 3C clearly indicates, the level of enzymatic activity is fully restored and dramatically inhibited with the exogenously added Grb2 or CD45, respectively.


The results presented in this study point at a dual phosphorylation-dephosphorylation mechanism that finely regulate PLD2. Grb2 could dock to tyrosine-phosphorylated PLD2 with the p-YxN motifs Y179 and Y511. Conversely, these residues, when dephosphorylated, would mediate other biological activities, particularly and as shown here, de novo DNA synthesis.

Our laboratory has shown earlier that phosphorylated PLD2 complexes with Grb2 [21] through two newly defined SH2 recognition sites on PLD2 that in turn bind to Sos [25]. Importantly, PLD2-derived phosphatidic acid (PA) directly serves to modulate Sos and Ras GTP/GDP exchange that brings the PLD system to the Ras/MEK/ERK pathway [26]. As the Foster group has demonstrated [14,31] PLD2 overexpression induces DNA proliferation and cell transformation. We studied DNA de novo synthesis and thought initially that we could correlate enhanced lipase activity to a cell function. PLD2 was capable of increasing cell growth (as measured by PCNA-positively stained nuclei) in agreement with previous reports showing that PLD2 overexpression induces transformation of cells [11,12,33] and that two phosphorylation-deficient mutants, with low lipase activity had low proliferation-inducing actions.

However, PLD2-Y179F and PLD2-Y511F, furthered the proliferative inducing increase observed in PLD2-wild type and, as such, the regulation had to be more complex than initially thought. When fully phosphorylated, Y179 and Y511 could be the site for binding of PLD2 to Grb2 as the two tyrosines are within a YxN SH2-recognition site (Figure 4A). The situation reverses itself when the residues are dephosphorylated as CD45 silencing inhibited PLD2-mediated proliferation. We have concluded that phosphorylated PLD2, aided by Grb2, mediates lipase activity, whereas dephosphorylated PLD2 mediates an induction of cell proliferation. The model presented in Fig. 4B incorporates the specific residues involved in this newly discovered regulation of PLD2: Y179 and Y511.

This could be important for cell transformation, for example. PLD promotes cell proliferation and suppresses the default apoptotic programs that prevent cancer. PLD activity is further elevated in cancer cell lines in response to the stress of serum withdrawal [10]. Dephosphorylation of Y179 or Y511 could be the signal for both decreasing PLD activity and concomitant high proliferation level that can help prevent the onset of cell transformation. Understanding signals activated in human cancers offers interesting therapeutic opportunities, since suppression of these signals (such as dephosphorylation) could theoretically lead to deactivation of proliferative capabilities of certain cancer cells.


The grant HL056653 (J.G.-C.) from the National Institutes of Health has supported this work.


Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.


1. Plevin R, Cook SJ, Palmer S, Wakelam MJ. Multiple sources of sn-1,2-diacylglycerol in platelet-derived-growth-factor-stimulated Swiss 3T3 fibroblasts. Evidence for activation of phosphoinositidase C and phosphatidylcholine-specific phospholipase D. Biochem. J. 1991;279:559–565. [PubMed]
2. Motoike T, Bieger S, Wiegandt H, Unsicker K. Induction of phosphatidic acid by fibroblast growth factor in cultured baby hamster kidney fibroblasts. FEBS Lett. 1993;332:164–68. [PubMed]
3. Song J, Jiang YW, Foster DA. Epidermal growth factor induces the production of biologically distinguishable diglyceride species from phosphatidylinositol and phosphatidylcholine via the independent activation of type C and type D phospholipases. Cell Growth & Differ. 1994;5:79–85. [PubMed]
4. Seymour LW, Shoaibi MA, Martin A, Ahmed A, Elvin P, Kerr DJ, Wakelam MJ. Vascular endothelial growth factor stimulates protein kinase C-dependent phospholipase D activity in endothelial cells. Lab. Invest. 1996;75:427–437. [PubMed]
5. Karnam P, Standaert ML, Galloway L, Farese RV. Activation and translocation of Rho (and ADP ribosylation factor) by insulin in rat adipocytes. Apparent involvement of phosphatidylinositol 3-kinase. J. Biol. Chem. 1997;272:6136–6140. [PubMed]
6. Exton JH. Biochim. Biophys. Acta. 1999;1439:121–133. [PubMed]
7. Sa G, Das T. Basic fibroblast growth factor stimulates cytosolic phospholipase A2, phospholipase C-g1 and phospholipase D through distinguishable signaling mechanisms. Mol. Cell. Biochem. 1999;198:19–30. [PubMed]
8. Zhu T, Ling L, Lobie PE. Identification of a JAK2-independent pathway regulating growth hormone (GH)-stimulated p44/42 mitogen-activated protein kinase activity. GH activation of Ral and phospholipase D is Srcdependent. J. Biol. Chem. 2002;277:45592–45603. [PubMed]
9. Banno Y, Takuwa Y, Yamada M, Takuwa N, Ohguchi K, Hara A, Nozawa Y. Involvement of phospholipase D in insulin-like growth factor-I-induced activation of extracellular signal-regulated kinase, but not phosphatidylinositol 3-kinase or Akt, in Chinese hamster ovary cells. Biochem. J. 2003;369:363–368. [PubMed]
10. Foster DA, Xu L. Phospholipase D in cell proliferation and cancer. Mol Cancer Res. 2003;1:789–800. [PubMed]
11. Lu Z, Hornia A, Joseph T, Sukezane T, Frankel P, Zhong M, Bychenok S, Xu L, Feig LA, Foster DA. Phospholipase D and RalA cooperate with the EGF receptor to transform 3Y1 rat fibroblasts. Mol. Cell Biol. 2000;20:462–467. [PMC free article] [PubMed]
12. Joseph T, Wooden R, Bryant A, Zhong M, Lu Z, Foster DA. Transformation of cells overexpressing a tyrosine kinase by phospholipase D1 and D2. Biochem. Biophys. Res. Comm. 2001;289:1019–1024. [PubMed]
13. Ahn BH, Kim SY, Kim EH, Choi KS, Kwon TK, Lee YH, Chang JS, Kim MS, Jo YH, Min DS. Transmodulation between phospholipase D and c-Src enhances cell proliferation. Mol. Cell. Biol. 2003;23:3103–3115. [PMC free article] [PubMed]
14. Song J, Pfeffer LM, Foster DA. v-Src increases diacylglycerol levels via a type D phospholipase-mediated hydrolysis of phosphatidylcholine. Mol. Cell. Biol. 1991;11:4903–4908. [PMC free article] [PubMed]
15. Jiang YW, Song J, Zang Q, Foster DA. Phosphatidylcholine-specific phospholipase D activity is elevated in v-Fps-transformed cells. Biochem. Biophys. Res. Comm. 1994;203:1195–1203. [PubMed]
16. Carnero A, Cuadrado A, del Peso L, Lacal JC. Activation of type D phospholipase by serum stimulation and ras-induced transformation in NIH3T3 cells. Oncogene. 1994;9:1387–1395. [PubMed]
17. Jiang H, Lu Z, Luo JQ, Wolfman A, Foster DA. Ras mediates the activation of phospholipase D by v-Src. J. Biol. Chem. 1995;270:6006–6009. [PubMed]
18. Frankel PA, Ramos M, Flom J, Bychenok S, Joseph T, Kerkhoff E, Rapp UR, L.A.
19. Feig, Foster DA. Ral and Rho dependent activation of phospholipase D in v-Raf transformed cells. Biochem. Biophys. Res. Comm. 1999;255:502–507. 19. [PubMed]
20. Schlessinger J. Curr Opin Genet Dev. 1994;4:25–30. [PubMed]
21. Horn J, Lopez I, Miller MW, Gomez-Cambronero J. The uncovering of a novel regulatory mechanism for PLD2: formation of a ternary complex with protein tyrosine phosphatase PTP1B and growth factor receptor-bound protein GRB2. Biochem. Biophys. Res. Commun. 2005;332:58–67. [PMC free article] [PubMed]
22. Chardin P, Camonis JH, Gale NW, van Aelst L, Schlessinger J, Wigler MH, Bar-Sagi D. Science. 1993;260:1338–43. [PubMed]
23. Egan SE, Giddings BW, Brooks MW, Buday L, Sizeland AM, Weinberg RA. Nature. 1993;363:45–51. [PubMed]
24. Li N, Batzer A, Daly R, Yajnik V, Skolnik E, Chardin P, Bar-Sagi D, Margolis B, Schlessinger J. Nature. 1993;363:85–8. [PubMed]
25. Di Fulvio M, Lehman N, Lin X, Lopez I, Gomez-Cambronero J. The elucidation of novel SH2 binding sites on PLD2. Oncogene. 2006;25:3032–40. [PMC free article] [PubMed]
26. Zhao C, Du G, Skowronek K, Frohman MA, Bar-Sagi D. Phospholipase D2-generated phosphatidic acid couples EGFR stimulation to Ras activation by Sos. Nat. Cell Biol. 2007;9:706–12. [PubMed]
27. Hancok JF. PA promoted to Manager. Nature Cell Biol. 2007;9:615–17. [PubMed]
28. Gomez-Cambronero J, Horn J, Paul CC, Baumann MA. Granulocyte-macrophage colony stimulating factor is a chemoattractant cytokine for human neutrophils: involvement of the ribosomal p70 S6 kinase signaling pathway. J. Immunol. 2003;171:6846–6855. [PubMed]
29. Lehman N, Di Fulvio M, McCray N, Campos I, Tabatabaian F, Gomez-Cambronero J. Phagocyte cell migration is mediated by phospholipases PLD1 and PLD2. Blood. 2006;108:3564–72. [PubMed]
30. Prelich G, Stillman B. Coordinated leading and lagging strand synthesis during SV40 DNA replication in vitro requires PCNA. Cell. 1998;53:117–26. [PubMed]
31. Lopez I, Arnold RS, Lambeth JD. Cloning and initial characterization of a human phospholipase D2 (hPLD2). ADP-ribosylation factor regulates hPLD2. J. Biol. Chem. 1998;273:12846–12852. [PubMed]
32. Xu L, Shen Y, Joseph T, Bryant A, Luo JQ, Frankel P, Rotunda T, Foster DA. Mitogenic phospholipase D activity is restricted to caveolin-enriched membrane microdomains. Biochem. Biophys. Res. Commun. 2000;273:77–83. [PubMed]
33. Min DS, Kwon TK, Park WS, Chang JS, Park SK, Ahn BH, Ryoo ZY, Lee YH, Lee YS, Rhie DJ, Yoon SH, Hahn SJ, Kim MS, Jo YH. Neoplastic transformation and tumorigenesis associated with overexpression of phospholipase D isozymes in cultured murine fibroblasts. Carcinogenesis. 2001;22:1641–1647. [PubMed]