PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Cancer Res. Author manuscript; available in PMC 2010 September 15.
Published in final edited form as:
PMCID: PMC2753283
NIHMSID: NIHMS134473

Matrix-metalloproteinase 12 Overexpression in Lung Epithelial Cells Plays a Key Role in Emphysema to Lung Bronchioalveolar Adenocarcinoma Transition

Abstract

Chronic obstructive pulmonary disease (COPD) and lung cancer are two diseases that are related to smoking in humans. The molecular mechanism linking these two diseases is poorly understood. Matrix metalloproteinase 12 (MMP12) is a member of the matrix-metalloproteinase family, which can be induced by smoking. Since MMP12 overexpression in epithelial cells has been reported in inflammation-triggered lung remodeling, a murine CCSP-rtTA/(tetO)7-MMP12 bitransgenic model was created. In this model, MMP12-Flag fusion protein overexpression and its increased enzymatic activity were observed in the lung in an inducible manner, which led to inflammatory cell infiltration and increased epithelial growth. In sequential events, spontaneous emphysema and bronchioalveolar adenocarcinoma were developed as a result of MMP12 overexpression. During this process, the concentration of IL-6 was steadily increased in bronchioalveolar lavage fluid, which activated the oncogenic Stat3 in alveolar type II epithelial cells. Expression of Stat3 downstream genes that are knownto stimulate inflammation and tumor formation was significantly increased in the lung. When tested in humans, MMP12 up-regulation was highly associated with COPD and lung cancer in patients. Together, these studies support that MMP12 is a potent pro-inflammatory and oncogenic molecule. MMP12 up-regulation plays a critical role in emphysema to lung cancer transition that is facilitated by pulmonary inflammation.

Introduction

Smoking leads to chronic obstructive pulmonary disease (COPD, the major phenotype is emphysema) and lung cancer, which are associated with pulmonary inflammation. Human COPD patients (especially with smoking history) are a high risk population for developing lung cancer. Even after having given up smoking, lung inflammation persists and progresses in humans with COPD (1). The molecular mechanism that links COPD and lung cancer is poorly understood.

Matrix metalloproteinases (MMPs) are a family of more than 20 secreted or transmembrane proteins that arecapable of degrading extracellular matrix and basement membranecomponents under physiologic conditions. MMPs play very important roles in normal connective tissue turnover during morphogenesis, tissue development, wound healing and reproduction. MMPs also act as modulators of inflammation and innate immunity by activating, deactivating or modifying the activity of signaling cytokines, chemokines and receptors (2, 3). In oncology, MMPs have long been considered as molecules necessary to promote tumor invasion and metastasis through the degradation of the extracellular matrix (4, 5). Nevertheless, their roles in directly initiating and inducing tumor have never been reported. MMP12 is a 22-kDa metal-dependent proteinase that was first detected by Werb and Gordon in 1975 (6). It can degrade elastin, and other substrates, such as type IV collagen, fibronectin, laminin, gelatin, vitronectin, entactin, heparin, and chondroitin sulphates (7). In the lung, MMP12 is identified in alveolar macrophages of cigarette smokers as an elastolytic MMP (8). Inactivation of the MMP12 gene in MMP12 knock-out mice suggests that MMP-12 plays a critical role in smoking-induced COPD (9). The clinical relevance of MMP12 in non small cell lung cancer (NSCLC) had been studied, in which MMP12 correlates with early cancer-related deaths in NSCLC, especially for those associated with tobacco cigarette smoke exposure (10). It has been reported that the MMP1-MMP3-MMP12 gene cluster plays important roles in lung cancer development and progression (11). Studies utilizing comparative genomic hybridization (CGH) analysis obtained a high-resolution map of frequent chromosomal gains and losses associated with lung cancer. An amplified MMP cluster region (11q22) with over-expressed MMP1, MMP12, and MMP13 was identified (12). Although these studies showed association of MMP12 overexpression with lung cancer, the role of MMP12 up-regulation in lung cancer as a causer remains to be defined. In addition to macrophages, MMP12 is overexpressed in lung epithelial cells (13, 14). During lysosomal acid lipase (LAL) deficiency in the lung, blockage of cholesteryl esters and triglycerides to free cholesterol and free fatty acids triggered pulmonary inflammation, emphysema and hypercellularity (1418). MMP12 was highly over-expressed (100 fold) in the lal−/− lung as determined by the Affymetrix GeneChip Microarray analysis. Expression of the MMP12 gene is down-regulated by lipid mediators and anti-inflammatory peroxisome proliferator-activated receptors (PPAR) γ(14).

The roles of inflammation, tumor microenvironment and extracellular membrane (ECM) remodeling during tumorigenesis are complex, as multiple cell types are involved in intricate crosstalk that is difficult to recapitulate in vitro. Thus, to understand the role of MMP12 in the process of emphysema to tumor transition and tumor associated inflammation, conditional overexpression of MMP12 in lung epithelial cells was created by utilizing the reverse tetracycline transactivator (rtTA) that is under the control of the Clara cell secretory protein (CCSP)promoter.

Materials and Methods

Animal care

Same as previously described (19).

Generation of doxycycline-controlled MMP12 transgenic mice

To generate the (tetO)7-CMV-MMP12 transgenic mouse line, MMP12 cDNA was amplified by PCR using a downstream primer (5′-AAGGAAAAAAGCGGCCGCTGATCACTTGTCATCGTCGTCCTTGTAGTCACA ACCAAACCAGCTTGTAC-3′) that contains a Flag sequence (underlined), a stop coden and a Not I site, and an upstream primer (5′-AGCGGATCCGCCACCATGAAATTTCTCATGATG-3′) that contains a Kozak sequence and a BamH I site. The PCR product was digested with BamHI/NotI and subcloned downstream of the (tetO)7-CMV minimal promoter linked to seven Tet-responsive elements (7-TRE) at the BamHI and NotI sites in the pTRE2 vector (Clontech). The expression cassette, containing the CMV minimal promoter, the MMP12 cDNA, and the human globin polyadenylation signaling sequence was dissected out and purified for microinjection into fertilized eggs of FVB/N mice by the Transgenic Core Facility at University of Cincinnati College of Medicine. Founder lines were identified by a pair of primers corresponding to a pTRE2 plasmid sequence (5′-CCATCCACGCTGTTTTGACC-3′) and a MMP12 cDNA coding region sequence (5′-GACTTGAGTTGTCCAGTTGCCC-3′). The CCSP-rtTA transgenic mice were genotyped with an upstream primer corresponding to the CCSP promoter sequence (5′ACTGCCCATTGCCCAAACAC3′) and a downstream primer corresponding to the rtTA code region sequence (5′AAAATCTTGCCAGCTTTCCCC3′). CCSP-rtTA/(tetO)7-CMV-MMP12 double transgenic mice were generated from cross-breeding of CCSP-rtTA transgenic mice and (tetO)7-CMV-MMP12 transgenic mice.

MMP-12 activity

The MMP-12 specific activity from bronchioalveolar lavage fluid (BALF) was measured by the SensoLyte490 MMP-12 Assay Kit (AnaSpec, San Jose, CA, USA) (Demedts IK).

Histology, tumor incidence and Metamorph quantification of emphysema

Same as described previously (20, 21).

FACS analysis

Same as previously described (19).

Reverse transcription and Real-Time PCR

Same as previously described (22, 23). Human MMP12 primers were: upstream, 5 ′-GATGCACGCACCTCGATGT-3′; downstream, 5′-GGCCCCCCTGGCATT-3′.

AnnexinV binding and BrdU proliferation analyses

Previous procedures were used (18, 19).

IL-6 analysis

The secreted IL-6 protein level in bronchioalveolar lavage fluid (BALF) was measured by IL-6 ELISA kit (R&D Systems, Minneapolis, MN).

CD11b+Gr-1+ and CD4+ T cells isolation and In vitro suppression assay

MDSCs were isolated according to a previously described procedure (24). CD4+ T cells were isolated from the wild type spleens with CD4 mAb-coated magnetic beads and MACS-LS columns according to the manufacturer’s instructions. Isolated wild type CD4+ cells were labeled with carboxyfluorescein diacetate succinimidyl diester (CFSE) (Molecular Probes). Labeled cells were stimulated with anti-CD3 mAb plus anti-CD28 mAb for 3 days in the absence or presence of CD11b+/Gr-1+ cells isolated from the spleens of doxycycline-treated CCSP-rtTA/(tetO)7-CMV-MMP12 bitransgenic mice as mentioned above. The ratios of MDSC:CD4+ T cells were 0:1, 1:25, 1:5, 1:1 respectively. Proliferation of CD4+ T cells was evaluated as CFSE dilution by flow cytometry. The IL-2 concentration in the cultured medium was measured by ELISA according to the protocol by Pharmingen.

MMP12 Immuno-histochemcal Staining

Sam as previously described (13).

Results

Generation of CCSP-rtTA/(tetO)7-CMV-MMP12 bitransgenic mice

A doxycycline-controlled bitransgenic mouse model was generated to specifically direct MMP12 expression in lung epithelial cells. In this system, a previously established CCSP-rtTA transgenic mouse line (25) was crossbred with a newly generated (tetO)7-CMV-MMP12 transgenic mouse line. In this founder line, a Flag sequence was added at the C terminus of the MMP12 cDNA to distinguish it from the endogenous MMP12 molecule. CCSP-rtTA/(tetO)7-CMV- MMP12 bitransgenic mice were identified by PCR using specific primers and purified mouse tail DNA (Supplemental Fig. 1). Induction of MMP12 mRNA expression in AT II epithelial cells was achieved by doxycycline treatment as monitored by Real-Time PCR assay. WT and MMP12 single-transgenic mice were also treated as controls with no MMP12 mRNA inductionobserved (Fig 1A). By FACS analysis, expression of the MMP12-Flag fusion protein was also significantly induced in AT II epithelial cells as co-stained with Flag antibody and SP-C antibody (AT II cell marker) in doxycycline-treated bitransgenic mice compared with doxycycline-untreated bitransgenic and wild type mice (Fig. 1B). No MMP12-Flag fusion protein was detected in Clara cells and alveolar macrophages as co-stained with Flag antibody and CCSP (Clara cell marker) or CD11b antibody (macrophage marker) regardless of doxycycline treatment. To confirm that overexpressed MMP12-Flag fusion protein was secreted into alveolar lumen and had the enzymatic activity, bronchioalveolar lavage fluid (BALF) from doxycycline-treated (n=3) and untreated (n=4) bitransgenic mice was collected and incubated with a fluorescence-quenched MMP12 substrate. Compared with the doxycycline-untreated BALF samples (230±26 ng/μl), the enzymatic product of MMP-12 was 10 times higher in the doxycycline-treated BALF samples (2270±120 ng/μl) (Fig. 1C). The MMP12 enzymatic activity remained lower in other controls as well, including doxycycline-treated (tetO)7- CMV-MMP12 single transgenic mice (210±55 ng/μl, n=3), and wild-type mice (135±30 ng/μl, n=4). Immunohistochemical staining revealed MMP12 overexpression on the alveolar epithelial wall and hyperplasia cells in the doxycycline-treated bitransgenic lung (Fig. 1D).

Figure 1
Expression of MMP12 in doxycycline-inducible bitransgenic mice

Emphysema and Bronchioalveolar adenocarcinoma in the lung of bitransgenic mice

To assess the pathophysiological consequence of MMP12 overexpression in lung epithelial cells, bitransgenic mice were treated with doxycycline for various time lengths. Histopathological analyses revealed lung abnormalities in bitransgenic mice beginning at 6 weeks of doxycycline treatment. At this stage, marked inflammatory cell infiltration and emphysema were readily detectable (Fig. 2A, +Dox 6W). Quantitative characterization revealed decreased alveolar number and increased alveolar perimeter, alveolar radius, alveolar mean cord length (Lm), alveolar surface area and alveolar volume in doxycycline-treated bitransgenic lungs compared with those in doxycycline-untreated bitransgenic lungs (Supplemental Table 1). These resulted in significant reduction of the overall alveolar surface area (69.16%) for gas exchange in doxycycline-treated bitransgenic mice. After 10–15 weeks of doxycycline treatment, the bitransgenic mice began to develop adenomatoid hyperplasia in both parenchyma and small conductingairways (Fig. 2A, +Dox 10W), which resembles to the histopathologic feature of dysplasia in clinical lesions. Bronchioalveoar adenocarcinomas were observed in the lungs of bitransgenic mice after doxycycline treatment as early as 16 weeks (Fig 2A, +Dox 16W). To determine the tumor incidence rate, bitransgenic mice were euthanized at 9–11 months after doxycycline treatment for histopathological analyses (Fig. 2B). Of 40 doxycycline-untreated bitransgenic mice, only one had lung bronchioalveolar adenocarcinoma (2.5%) and 2 others developed pulmonary dysplasia without cancer. In marked contrast, 16 of 47 doxycycline-treated bitransgenic mice in the same age group had lung bronchioalveolar adenocarcinoma (34.04%). Five of them developed both pulmonary dysplasia and bronchioalveolar adenocarcinoma, and three mice had dysplasia without bronchioalveolar adenocarcinoma. In most tumor incidences, one tumor per lung was observed (Fig. 2A, +Dox 40W). A few mice showed tumors on both sides of lung lobes (lobectomy). None of wild-type and single transgenic mice developed bronchioalveolar adenocarcinoma regardless of doxycycline treatment (n = 10, respectively). In the soft agar assay, tumor cell colonies were observed from lung cells that were isolated from doxycycline-treated bitransgenic mice. No tumor cell colony was observed from those of untreated mice (Figure 2C). This observation suggests that MMP12 over-expression facilitates the neoplasia process. Finally, a doxycycline on/off experiment was performed. First, bitransgenic mice were treated with doxycycline for 2 months to allow emphysema formation. One group of mice was terminated of doxycycline treatment, while another group of mice continued to be treated. Interestingly, both groups of mice developed hyperplasia two months later. This observation suggests that an MMP12-initiated pathogenic mechanism is irreversible to induce emphysema to hyperplasia transition.

Figure 2
Pathology of bitransgenic lung

Proliferation and apoptosis of alveolar epithelial cells in bitransgenic mice

Lung adenocarcinoma formation depends on both uncontrolled epithelial cell growth and apoptotic inhibition. To evaluate if MMP12 overexpression stimulates epithelial cell proliferation during tumor initiation and progression, BrdU was injected into 3, 6 and 9 months-doxycycline-treated or untreated bitransgenic mice (n=3). After 72 hours, the BrdU-labeled cells were analyzed by FACS after double staining of whole lung cells with fluorochrome-conjugate anti-BrdU and anti-SP-C antibodies. As shown in Fig. 3A, there was a steady increase of BrdU pulse-labeled AT II epithelial cells in the doxycycline-treated bitransgenic mice compared with untreated littermates. The increase of MMP12-induced cell proliferation was time-dependent. To evaluate if MMP12 overexpression alters apoptotic activity in lung epithelial cells during tumor initiation and progression, whole lung cells were labeled with Annexin V and fluorochrome-conjugate anti-SP-C antibodies (Fig. 3B). FACS analysis showed a more than 5-fold decrease of Annexcin V-labeled AT II epithelial cells in 9-months-doxycycline-treated bitransgenic mice compared with untreated littermates (21.41% vs 4.91%). The decrease of MMP12-induced apoptosis was also time-dependent. Furthermore, expression of a spectrum of pro-apoptotic genes (Apaf-1, Bax, Bid FasL, Casp3, 7, 9, CideA) were down-regulated in AT II epithelial cells of bitransgenic mice after 3 months of doxycycline treatment as analyzed by Real-Time PCR (Fig. 3C, n=3).

Figure 3
Proliferation and apoptosis of alveolar epithelial cells in bitransgenic mice

Activation of oncogenic pathways in the lung of bitransgenic mice

In searching for molecular mechanism by which MMP12 overexpression stimulates emphysema to bronchioalveolar adenocarcinoma transition, the IL-6/Stat3 pathway was studied. This is because IL-6 up-regulation causes emphysema (26). More importantly, persistent activation of IL-6 downstream Stat3 in AT II epithelial cells directly induced lung inflammation and bronchioalveolar adenocarcinoma (22). To determine secreted IL-6 in bronchioalveolar lavage fluid (BALF), bitransgenic mice at 1 month old were treated with doxycycline for 0, 1, 3, 6 and 9 months. Protein concentrations of secreted IL-6 in BALF were measured by ELISA. As demonstrated in Fig. 4A, IL-6 concentration in BALF of doxycycline-treated mice were steadily increased compared with those in untreated bitransgenic mice in a time-dependent fashion, correlated well with the process from emphysema to bronchioalveolar adenocarcinoma transition. Increase of the IL-6 concentration can potentially activates downstream Stat3 (phosphorylation) in AT II epithelial cells to induce bronchioalveolar adenocarcinoma. To test this assumption, cells from whole lungs of 9-month doxycycline-treated or untreated bitransgenic mice were isolated and double labeled with fluorochrome-conjugated anti-phospho-Stat3Y705 and SP-C (AT II cell marker) antibodies. Labeled cells were analyzed by flow cytometry. In gated SP-C positive cells, percentage (35.07% vs 4.13%), total positive cells and MFI of phospho-Stat3Y705 were dramatically increased in doxycycline-treated bitransgenic mice compared with untreated bitransgenic mice and wild type mice (Fig 4B). At the gene transcriptional level, both IL-6 and Stat3 mRNA levels were up-regulated in response to MMP12 overexpression (Fig. 4C). Other intracellular oncogenic molecules were also analyzed (Supplementary Fig. 2). NFκB, Erk, P38 and AKT were all significantly activated in doxycycline-treated bitransgenic mice compared with untreated bitransgenic mice.

Figure 4
Activation of the IL-6/Stat3 pathway in AT II epithelial cells of bitransgenic mice

We identified multiple Stat3 downstream cytokines and chemokines in AT II epithelial cells that play important roles in initiating inflammation-triggered bronchioalveolar adenocarcinoma in vivo (22). To further establish the connection between the IL-6/Stat3 pathway and MMP12-induced tumorigenesis, expression levels of these molecules were measured in bitransgenic mice prior to tumor formation. Total RNAs were purified from AT II epithelial cells after 1 month of doxycycline treatment. The expression levels of Stat3 downstream cytokines and chemokines were quantitatively determined by Real-TimePCR. In comparison with untreated bitransgenic mice, these molecules were highly induced in response to MMP12 overexpression. Among them, proinflammatory cytokine and chemokine gene Gp130 was up-regulated to 199.4-fold, LIF to 80.57-fold, IL-6 to 84.8-fold, CSF-2 to 162.2-fold, TNFsf9 to 128.8-fold, CCL5 to 98-fold, CCL8 to 208-fold, CXCR2 to 1930-fold, and VEGF to 160.3-fold in doxycycline treated bitransgenic mice compared to those untreated mice (Fig. 4D). CSF-1 remained unchanged. In addition, Stat3-induced downstream developmental gene HNF4αwas up-regulated to 78.6-fold, Foxa3 to 9.3-fold and SHH to 3.3-fold (Fig. 4D). None of these molecules was induced in WT and MMP12 single transgenic mice regardless of doxycycline treatment. Interestingly, increased expression of several other MMPs was also observed in doxycycline-treated bitransgenic mice compared with untreated mice.

Inflammatory cell infiltration in the lung of bitransgenic mice

One major manifestation in Stat3-induced bronchioalveolar adenocarcinoma is inflammatory cell infiltration in the lung (22). Since persistent activation of the IL-6/Stat3 pathway was observed by MMP12 overexpression, it is necessary to assess if MMP12 overexpression induces inflammatory cell infiltration during the course of pathogenesis in the lung of bitransgenic mice. Whole lung cells were isolated from the lungs of 3, 6, 9-month doxycycline-treated or untreated bitransgenic mice and wild type mice for staining with fluorochrome-conjugate anti-mouse CD 11b (for monocytes) or Gr-1 (for neutrophils) antibody in FACS analysis. Compared with untreated bitransgenic mice, the percentage numbers of CD11b+ (2.59% to 11.84%) and Gr-1+ (0.64% to 5.87%) inflammatory cells were significantly increased in the lung of 3-month doxycycline-treated bitransgenic mice (Figure 5A). Importantly, the percentage number of CD11b/Gr-1 double positive cells (2.91% to 15.58%) was significantly increased in the lung of doxycycline-treated mice (Figure 5A). CD11b/Gr-1 double positive cells are myeloid-derived suppressor cells (MDSCs). Constant influx of these cells supports the angiogenesis and stroma remodeling for tumor growth (27). With disease progression, the total number of this cell population was gradually increased in the lungs of 3-, 6- and 9-month-doxycycline-treated bitransgenic mice (Figure 5B). MDSCs isolated from doxycycline-treated bitransgenic mice were able to inhibit T cell proliferation, in which CFSE-labeled CD4+ T cells were stimulated with anti-CD3 mAb plus anti-CD28 mAb. The inhibition was MDSC concentration-dependent (Fig. 5C). IL-2 secretion from stimulated CD4+ T cells was also inhibited by MDSCs in the co-cultured study as measured by ELISA, an indication of functional impairment of T cells (Fig. 5D). These results indicate that inflammatory cell infiltration plays a critical role in emphysema to bronchioalveolar adenocarcinoma transition.

Figure 5
Inflammatory cell infiltration in bitransgenic mice

MMP12 up-regulation in human adenocarcinoma, squamous cell carcinoma and COPD

Since MMP12 overexpression caused lung tumor formation in the CCSP- rtTA/(tetO)7-CMV-MMP12 bitransgenic mouse model, it is important to determine if up-regulation of MMP12 is associated with lung cancers and COPD in humans. The expression levels of MMP12 mRNA in human adenocarcinomas (n=24), squamous cell carcinomas (n=22), COPD without smoking (n=21) and COPD with smoking (n=25) vs normal samples (n=12) were examined by quantitative Real-Time PCR (Figure 6). In comparison with normal human lungs, the average of MMP12 mRNA expression levels was 10.06-fold higher in adenocarcinomas, 5.31-fold higher in squamous cell carcinomas, 2.23-fold higher in lung tissues with COPD from non-smokers and 2.92-fold higher in lung tissues with COPD from smokers. Therefore, up-regulation of MMP12 is associated with emphysema and lung cancer in humans. Stat3 upregulation has been observed in the same human samples as we previously described (23). Co-upregulation of MMP12 and Stat3 in human patients provides additional evidence supporting that both molecules are connected and contribute to lung cancer formation.

Figure 6
MMP12 up-regulation in human adenocarcinoma, squamous cell carcinoma and COPD

Discussion

In order to understand the pathophysiological roles of MMP12 in the lung, a conditional bitransgenic mouse model was generated to overexpress MMP12 in lung epithelial cells. In this bitransgenic model, doxycycline treatment induced MMP12-Flag fusion protein expression at both mRNA and protein levels (Fig. 1A and B). In BALF of bitransgenic mice after doxycycline treatment, the MMP12 enzymatic activity was significantly increased (Fig. 1C). Together, these results suggest that CCSP-rtTA/(tetO)7-CMV-MMP12 bitransgenic mice are able to synthesize and secret the active form of the MMP12-Flag fusion protein in the alveolar lumen.

As a pathological consequence, persistentoverexpression of the MMP12-Flag fusion protein in AT II cells caused emphysema 6 weeks after doxycycline treatment in bitransgenic mice (Fig. 2A). This is probably due to degradation of extracellular matrix (ECM) that weakens the interstitial alveolar structure. With longer MMP12 exposure, dysplasia (10–15 weeks of doxycycline treatment) and bronchioalveolar adenocarcinoma (16–40 weeks of doxycycline treatment) were observed. This sequential emphysema to lung cancer transition resembles the clinical situation that COPD is highly likely to develop lung cancer in humans. It seems that MMP12 serves as a trigger. In the doxycycline on/off study (Fig. 2D), in which doxycycline treatment was terminated once emphysema was established but prior to hyperplasia, the mice still developed hyperplasia two months later. This may be explained by that inflammation (e.g. inflammatory cell infiltration and cytokine/chemokine upregulation) had already been induced, which triggered irreversible pathologic cascades toward tumorigenesis. In a similar clinical situation, some smokers develop lung cancer even after quitting smoking. Prior to and during tumor formation, AT II epithelial cells underwent both increased cell proliferation as determined by BrdU pulse-labeling analysis and decreased apoptosis as determined by Annexin V labeling analysis under MMP12 overexpression (Fig. 3).

It has been proposed previously that degraded fragments from extracellular matrix by MMPs serve as chemotactants for inflammatory cell infiltration in the lung (28). This seems to be supported by our observation that inflammatory cells are readily detectable in the alveolar region before and after tumor formation in MMP12 bitransgenic lungs after doxycycline treatment (Fig. 5). Especially, tumor promoting MDSCs were significantly increased in the lung of bitransgenic mice. As we reported recently, increased concentration of MDSCs alone by apoptosis inhibition is sufficient to cause bronchioalveolar adenocarcinoma in vivo (19). Infiltration of innate andadaptive immune cells into lung changed the local microenvironment and hijacked the immune surveillance system to favor tumor growth. These cells change the microenvironment to assist tumorigenesis to influence angiogenesis, remodel extracellular matrix and increase mutational rate that leads to genetic or epigenetic instabilities.

One obvious microenvironment change in BALF of bitransgenic mice is the steady increase of IL-6 concentration (Fig. 4A). Interestingly and importantly, IL-6 up-regulation has been reported to cause emphysema and to play a role in lung adenocarcinoma (22, 26). Phosphorylation of IL-6 downstream effector Stat3 in AT II epithelial cells was significantly increased as a result of IL-6 surge in BALF of doxycycline-treated bitransgenic mice (Fig. 4B). Simultaneously, IL-6 and Stat3 gene transcription was activated in AT II epithelial cells after doxycycline treatment (Fig. 4C). We reported previously, persistent activation of Stat3 in AT II epithelial cells directly induced lung bronchioalveolar adenocarcinoma (22). As a result, Stat3 downstream genes in AT II epithelial cells were activated in bitransgenic mice (Fig. 4D). These genes are known to promote inflammation (e.g. LIF, IL-6, CSF-2, TNFsf9, CCL5, CCL8, CXCR2 and VEGF) and to stimulate epithelial growth (e.g. HNF4α, Foxa3 and SHH). It is conceivable that up-regulation of theseStat3 downstream genes along with other MMP genes exacerbates inflammation and induces epithelial cell transformation into bronchioalveolar adenocarcinoma in the lung of bitransgenic mice. Therefore, activation of the IL-6/Stat3 pathway is responsible, at least partially, for MMP12-induced emphysema and tumorigenesis. To formally prove this concept, disruption of the IL-6/Stat3 pathway in CCSP-rtTA/(tetO)7-CMV-MMP12 bitransgenic mice by crossbreeding with IL-6 and Stat3 knock-out mice should be performed in the future. As we reported recently, Stat3 and its downstream genes serve as biomarkers for lung adenocarcinoma and COPD diagnosis in humans (23). Importantly, up-regulation of MMP12 is associated with human COPD, adenocarcinomas and squamous cell carcinomas (Fig. 6). Other oncogenic molecules (e.g. Erk1/2, AKT, p38 and NFκB) were also activated in doxycycline treated bitransgenic mice compared to untreated bitransgenic mice (Supplementary Fig. 2), suggesting that MMP12 induced tumorigenesis is a complex process.

In summary, sequential appearance of emphysema, epithelial dysplasia and bronchioalveolar adenocarcinoma in the CCSP-rtTA/(tetO)7-CMV-MMP12 bitransgenic mouse model supports that MMP12 is a key player that controls emphysema to tumor transition in the lung. This seems achieved by activation of the pro-inflammatory IL-6/Stat3 pathway (at least partially) and inflammatory cell infiltration, therefore providing additional evidence demonstrating that chronic inflammation facilitates formation of emphysema and lung cancer. As we demonstrated previously, MMP12 is under the control of anti-inflammatory PPARγ and its lipid hormonal ligands (14). Activation of PPARγ inhibits the proliferation of lung carcinoma cells (29). Therefore, our study supports a concept that the balance and antagonism between anti-inflammatory PPARγ and pro-inflammatory IL-6/Stat3 determine lung cancer formation, similar to that observed in myeloma (30).

Supplementary Material

Acknowledgments

National Institutes of Health HL087001 (H. Du), HL-061803 and HL-067862 (C. Yan)

We thank Miss Jennifer Roberts for assisting RealTime PCR and Mrs. Marjorie E. Albrecht for assisting tissue collection and animal maintenance. This study was supported by National Institute of Health Grants HL087001 (H. Du), HL-061803 (C. Yan and H. Du), HL-067862 (C. Yan and H. Du) and Indiana University Cancer Center ITRAC Award (C. Yan).

References

1. Mannino DM, Aguayo SM, Petty TL, Redd SC. Low lung function and incident lung cancer in the United States: data From the First National Health and Nutrition Examination Survey follow-up. Arch Intern Med. 2003;163:1475–80. [PubMed]
2. Page-McCaw A, Ewald AJ, Werb Z. Matrix metalloproteinases and the regulation of tissue remodelling. Nat Rev Mol Cell Biol. 2007;8:221–33. [PMC free article] [PubMed]
3. Parks WC, Wilson CL, Lopez-Boado YS. Matrix metalloproteinases as modulators of inflammation and innate immunity. Nat Rev Immunol. 2004;4:617–29. [PubMed]
4. Westermarck J, Kahari VM. Regulation of matrix metalloproteinase expression in tumor invasion. FASEB J. 1999;13:781–92. [PubMed]
5. Moses MA. The regulation of neovascularization of matrix metalloproteinases and their inhibitors. Stem Cells. 1997;15:180–9. [PubMed]
6. Werb Z, Gordon S. Elastase secretion by stimulated macrophages. Characterization and regulation. J Exp Med. 1975;142:361–77. [PMC free article] [PubMed]
7. Gronski TJ, Jr, Martin RL, Kobayashi DK, et al. Hydrolysis of a broad spectrum of extracellular matrix proteins by human macrophage elastase. J Biol Chem. 1997;272:12189–94. [PubMed]
8. Shapiro SD, Kobayashi DK, Ley TJ. Cloning and characterization of a unique elastolytic metalloproteinase produced by human alveolar macrophages. J Biol Chem. 1993;268:23824–9. [PubMed]
9. Hautamaki RD, Kobayashi DK, Senior RM, Shapiro SD. Requirement for macrophage elastase for cigarette smoke-induced emphysema in mice. Science. 1997;277:2002–4. [PubMed]
10. Hofmann HS, Hansen G, Richter G, et al. Matrix metalloproteinase-12 expression correlates with local recurrence and metastatic disease in non-small cell lung cancer patients. Clin Cancer Res. 2005;11:1086–92. [PubMed]
11. Sun T, Gao Y, Tan W, et al. Haplotypes in matrix metalloproteinase gene cluster on chromosome 11q22 contribute to the risk of lung cancer development and progression. Clin Cancer Res. 2006;12:7009–17. [PubMed]
12. Dehan E, Ben-Dor A, Liao W, et al. Chromosomal aberrations and gene expression profiles in non-small cell lung cancer. Lung Cancer. 2007;56:175–84. [PubMed]
13. Lian X, Qin Y, Hossain SA, et al. Overexpression of Stat3C in Pulmonary Epithelium Protects against Hyperoxic Lung Injury. J Immunol. 2005;174:7250–6. [PubMed]
14. Lian X, Yan C, Qin Y, Knox L, Li T, Du H. Neutral lipids and peroxisome proliferator-activated receptor-{gamma} control pulmonary gene expression and inflammation-triggered pathogenesis in lysosomal acid lipase knockout mice. Am J Pathol. 2005;167:813–21. [PubMed]
15. Lian X, Yan C, Yang L, Xu Y, Du H. Lysosomal acid lipase deficiency causes respiratory inflammation and destruction in the lung. Am J Physiol Lung Cell Mol Physiol. 2004;286:L801–7. [PubMed]
16. Yan C, Lian X, Li Y, et al. Macrophage-Specific Expression of Human Lysosomal Acid Lipase Corrects Inflammation and Pathogenic Phenotypes in lal−/− Mice. Am J Pathol. 2006;169:916–26. [PubMed]
17. Yan C, Lian X, Dai Y, et al. Gene delivery by the hSP-B promoter to lung alveolar type II epithelial cells in LAL-knockout mice through bone marrow mesenchymal stem cells. Gene Ther. 2007;14:1461–70. [PubMed]
18. Qu P, Du H, Wilkes DS, Yan C. Critical roles of lysosomal acid lipase in T cell development and function. Am J Pathol. 2009;174:944–56. [PubMed]
19. Qu P, Du H, Li Y, Yan C. Myeloid-specific expression of Api6/AIM/Sp alpha induces systemic inflammation and adenocarcinoma in the lung. J Immunol. 2009;182:1648–59. [PMC free article] [PubMed]
20. Bolender RP, Hyde DM, Dehoff RT. Lung morphometry: a new generation of tools and experiments for organ, tissue, cell and molecular biology. American Journal of Physiology. 1993;265:L521–48. [PubMed]
21. Massaro GD, Massaro D. Retinoic acid treatment abrogates elastase-induced pulmonary emphysema in rats [see comments] [published erratum appears in Nat Med 1997 Jul;3(7):805] Nat Med. 1997;3:675–7. [PubMed]
22. Li Y, Du H, Qin Y, Roberts J, Cummings OW, Yan C. Activation of the signal transducers and activators of the transcription 3 pathway in alveolar epithelial cells induces inflammation and adenocarcinomas in mouse lung. Cancer Res. 2007;67:8494–503. [PubMed]
23. Qu P, Roberts J, Li Y, et al. Stat3 downstream genes serve as biomarkers in human lung carcinomas and chronic obstructive pulmonary disease. Lung Cancer. 2009;63:341–7. [PMC free article] [PubMed]
24. Bronte V, Apolloni E, Cabrelle A, et al. Identification of a CD11b(+)/Gr-1(+)/CD31(+) myeloid progenitor capable of activating or suppressing CD8(+) T cells. Blood. 2000;96:3838–46. [PMC free article] [PubMed]
25. Tichelaar JW, Lu W, Whitsett JA. Conditional expression of fibroblast growth factor-7 in the developing and mature lung. J Biol Chem. 2000;275:11858–64. [PubMed]
26. Kuhn C, 3rd, Homer RJ, Zhu Z, et al. Airway hyperresponsiveness and airway obstruction in transgenic mice. Morphologic correlates in mice overexpressing interleukin (IL)-11 and IL-6 in the lung. Am J Respir Cell Mol Biol. 2000;22:289–95. [PubMed]
27. Sica A, Bronte V. Altered macrophage differentiation and immune dysfunction in tumor development. J Clin Invest. 2007;117:1155–66. [PMC free article] [PubMed]
28. Shapiro SD, Senior RM. Matrix metalloproteinases. Matrix degradation and more. Am J Respir Cell Mol Biol. 1999;20:1100–2. [PubMed]
29. Han SW, Roman J. Activated PPARgamma Targets Surface and Intracellular Signals That Inhibit the Proliferation of Lung Carcinoma Cells. PPAR Res. 2008;2008:254108. [PMC free article] [PubMed]
30. Wang LH, Yang XY, Zhang X, et al. Transcriptional inactivation of STAT3 by PPARgamma suppresses IL-6-responsive multiple myeloma cells. Immunity. 2004;20:205–18. [PubMed]