PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of aemPermissionsJournals.ASM.orgJournalAEM ArticleJournal InfoAuthorsReviewers
 
Appl Environ Microbiol. 2009 October; 75(19): 6102–6109.
Published online 2009 August 7. doi:  10.1128/AEM.00308-09
PMCID: PMC2753093

Transcriptional and Functional Studies of Acidithiobacillus ferrooxidans Genes Related to Survival in the Presence of Copper[down-pointing small open triangle]

Abstract

The acidophilic Acidithiobacillus ferrooxidans can resist exceptionally high copper (Cu) concentrations. This property is important for its use in biomining processes, where Cu and other metal levels range usually between 15 and 100 mM. To learn about the mechanisms that allow A. ferrooxidans cells to survive in this environment, a bioinformatic search of its genome showed the presence of at least 10 genes that are possibly related to Cu homeostasis. Among them are three genes coding for putative ATPases related to the transport of Cu (A. ferrooxidans copA1 [copA1Af], copA2Af, and copBAf), three genes related to a system of the resistance nodulation cell division family involved in the extraction of Cu from the cell (cusAAf, cusBAf, and cusCAf), and two genes coding for periplasmic chaperones for this metal (cusFAf and copCAf). The expression of most of these open reading frames was studied by real-time reverse transcriptase PCR using A. ferrooxidans cells adapted for growth in the presence of high concentrations of Cu. The putative A. ferrooxidans Cu resistance determinants were found to be upregulated when this bacterium was exposed to Cu in the range of 5 to 25 mM. These A. ferrooxidans genes conferred to Escherichia coli a greater Cu resistance than wild-type cells, supporting their functionality. The results reported here and previously published data strongly suggest that the high resistance of the extremophilic A. ferrooxidans to Cu may be due to part or all of the following key elements: (i) a wide repertoire of Cu resistance determinants, (ii) the duplication of some of these Cu resistance determinants, (iii) the existence of novel Cu chaperones, and (iv) a polyP-based Cu resistance system.

Cells in general have developed a series of mechanisms to control the levels of free Cu in their compartments. Thus, when the concentration of copper exceeds acceptable levels, mechanisms of resistance are activated in order to survive in the adverse environment (17, 26, 29, 31). In gram-negative bacteria, one of the pathways described for Cu resistance is an active efflux of this metal from the cytoplasm to the periplasmic space, carried out by ATPases located in the internal membrane of the bacteria. The most-studied example of this type of transport is the P-type ATPase CopA from Escherichia coli (27). It has also been postulated that microorganisms may pump the metal from both the cytoplasm and the periplasm to the extracellular space by systems of the resistance nodulation cell division family of carriers, the Cus system of E. coli being the best-known detoxification organization of this kind (19, 26). The capacity of some species to bind the metal in the periplasmic space has also been reported (21). Copper is therefore retained by these periplasmic proteins through their Cu-binding sites. An example of this mechanism is the CopABCD system from Pseudomonas syringae pv. tomato, in which proteins involved in the binding of Cu (CopB and CopC) and a multicopper oxidase (CopA) are present. Most likely, the activity of CopA is responsible for Cu resistance (21). A detailed DNA microarray transcriptional profiling of Cu-adapted and Cu-shocked Pseudomonas aeruginosa cells with similar metal tolerance systems has also been recently reported (31). These systems from gram-negative microorganisms allow them to tolerate relatively low Cu levels. Thus, E. coli has a MIC of 3 mM for Cu in LB medium (9), and in P. syringae, a MIC of 8 mM was reported (21). These are very low concentrations compared to those present in environments such as mining operations or acid mine drainages, where the concentrations of heavy metals, especially Cu, are 1 or 2 orders of magnitude higher (7). Acidithiobacillus ferrooxidans is a gram-negative, acidophilic chemolithoautotroph that can use ferrous iron, reduced sulfur species, or metal sulfides as energy sources (11, 24, 28, 33). This microorganism can also be adapted to grow in the presence of 800 mM Cu (5). These abilities make this bacterium and others with similar properties potentially valuable in the extraction and recovery of metals such as copper or gold by means of biomining processes (36). Therefore, it is very interesting to determine the molecular mechanisms that allow these microorganisms to resist extremely high concentrations of metals in their environment. Very little is known about the mechanisms that acidophiles use to tolerate metal and acid toxicity (8). When A. ferrooxidans is exposed to Cu, its surface changes and proteins yet to be identified appear on the surface (5). In addition, when this bacterium is exposed to Cu, it loses extrachromosomal structures, suggesting that if the bacterium possesses genes coding for proteins involved in Cu resistance, they would be present on its genome (4). Hence, it is reasonable to assume that A. ferrooxidans expresses surface resistance determinants when exposed to Cu.

Only few genes have been previously identified by RNA arbitrarily primed PCR as being induced or repressed in A. ferrooxidans subjected to Cu. Nevertheless, the role of these genes in the mechanism of Cu resistance is still unclear, and their expression may be related to indirect metabolic responses to stress (20). Novo et al. (18) also studied changes in some proteins from A. ferrooxidans when subjected to Cu and other metals, but the proteins were not identified.

Very recently, by using PCR-restriction fragment length polymorphism, the expression of genes Afe0663 (A. ferrooxidans copA1 [copA1Af]) and Afe0329 (copA2Af) from A. ferrooxidans has been reported, and the authors of the report suggested that copA2Af might be more important for Cu homeostasis in this bacterium (16).

An additional polyP-dependent system for Cu resistance has been suggested for polyP-accumulating A. ferrooxidans (1) that would be similar to that previously proposed for E. coli (12, 14). In this system, polyP is degraded by exopolyphosphatase (PPX) to inorganic phosphate monomers, which bind the metal in the cytoplasm of the bacterium, and then metal-phosphate complexes are thought to be pumped out to the periplasmic space by means of inorganic phosphate carriers. It was found that in the presence of Cu, A. ferrooxidans degrades polyP with the concomitant efflux of phosphate (1). A similar phenomenon has also been observed in the mineral sulfide-oxidizing acidophilic archaeon Sulfolobus metallicus, which is also a polyP-accumulating microorganism highly resistant to Cu (25).

The purpose of the present work was to characterize in detail several of the putative Cu resistance genes present in the genome of A. ferrooxidans ATCC 23270 and to study their transcriptional expression under the Cu concentrations these microorganisms normally encounter in their environment. The expression of these open reading frames (ORFs) with Cu resistance roles was analyzed, and the majority of them were upregulated when A. ferrooxidans was exposed to different extracellular Cu concentrations. Finally, most of the A. ferrooxidans putative Cu resistance determinants conferred a higher Cu tolerance to E. coli ΔcopA and ΔcusCFBA ΔcueO mutants, strongly suggesting that they are part of at least one of the functional mechanisms for Cu resistance in A. ferrooxidans.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

The type strain of A. ferrooxidans (ATCC 23270) was grown at 30°C in ferrous sulfate-containing 9K medium at pH 1.5 as described before (23). Growth was monitored by determining cell numbers under a phase-contrast Olympus BX50 microscope with a Petroff-Hauser counting chamber. E. coli K-12, ΔcopA and ΔcusCFBA ΔcueO mutants of K-12, and all transformants of these strains were grown at 37°C in Luria-Bertani (LB) medium supplemented with the required compounds as indicated for the different experiments.

Extraction of total RNA from A. ferrooxidans.

To determine the effect of different Cu concentrations on the expression of the genes of interest, cells were adapted to grow continuously in the presence of the concentrations of Cu sulfate indicated in the figures until they reached between 9 × 107 and 1 × 108 cells per ml, the time at which total RNA was extracted from each culture condition. To minimize cell damage and RNA degradation during storage, bacteria harvested by centrifugation were immediately processed for RNA extraction and reverse transcriptase PCR (RT-PCR) and real-time RT-PCR transcriptional expression determinations. Total RNA was prepared from A. ferrooxidans cultures after lysing the cells as previously reported (34) except that TRIzol (Invitrogen) was used for the extraction. DNA was eliminated by the addition of 4 U of RNase-free RQ1 DNase (Promega).

Cotranscriptional analysis by RT-PCR.

The expression of adjacent genes in some of the putative operons of interest was studied by means of cotranscriptional experiments. cDNA was synthesized by using reverse primers hybridizing to cusAAf or copDAf and 0.8 μg of total RNA from an A. ferrooxidans culture grown in the presence of 5 mM Cu. The primers used for the upstream and downstream genes are shown in Table Table1.1. PCR amplifications were performed with 1 μl of a 1/10 dilution of the cDNA and 25 pmol of each primer. Amplification conditions included an initial 3 min of denaturation at 95°C, followed by 35 cycles of 30 s at 95°C, 30 s at 55°C, and 1.5 min at 72°C and finished by 10 min at 72°C.

TABLE 1.
Oligonucleotides used in this work

Real-time RT-PCR.

Primers for real-time RT-PCR were designed with the software Light Cycler Probe Design (Roche). For cDNA synthesis, 0.8 μg of total RNA were reverse transcribed for 1 h at 42°C by using ImProm-II (Promega), 0.5 μg of random hexamers (Promega), and 3 mM MgCl2. PCR was carried out by using the Corbett Rotor Gene 6000 system following the manufacturer's instructions by using SYBR green master mix (Roche). Thermal cycling conditions were an initial denaturation at 95°C for 10 min, followed by 40 cycles at 95°C for 5 s, 55 to 64°C for 5 s, and 72°C for 16 s. Fluorescence measurements were recorded at the end of each extension step. Mean values and standard deviations were obtained by analyzing cDNA obtained from three independently grown cultures for each data series. Each mRNA expression value was normalized against 16S rRNA gene expression.

Cloning A. ferrooxidans genes in an expression vector.

A. ferrooxidans genes of interest were cloned in the commercial vector pBAD-TOPO (Invitrogen) by following the manufacturer's instructions. For the ligation reaction, 25 ng of the DNA to be cloned and 10 ng of the vector DNA were used, and incubation was for 30 min at room temperature. Two microliters of this reaction was used to transform TOP10 cells (Invitrogen). The clones obtained were analyzed for the correct orientation and the expected sizes of the PCR fragments. This was done by PCRs using GoTaq DNA polymerase (Promega). The forward primer (pBAD fw) hybridized with the promoter of the vector, and the following reverse primers hybridized with the 3′ end of the cloned PCR products: afcopA1 rvex for copA1Af, afcopB rvex for copBAf, afcopC rvex for copCAf, afcopD rvex for copDAf, and afcusF rvex for cusFAf (Table (Table1).1). The amplification conditions included an initial 2 min of denaturation at 95°C, followed by 30 cycles of 30 s at 95°C, 30 s at 50°C, and 2 min at 72°C and finished by 10 min at 72°C. The nucleotidic sequence of all the inserts was also checked by DNA sequencing.

Generation of the E. coli ΔcopA and ΔcusCFBA ΔcueO deletion mutants.

Deletions of the copA or cueO and cusCFBA genes from E. coli K-12 were performed according to the method of Datsenko and Wanner (6). Briefly, PCR primers (60 nucleotides [nt]) were designed with homology to 40 nt of the E. coli K-12 genes to be deleted and 20 nt of the plasmid pKD4 or pKD3. Plasmids pKD3 and pKD4 contain an FLP recombination target-flanked chloramphenicol or kanamycin resistance cassette, respectively, and they are used as templates for the PCRs. In this context, the primers used (nucleotides corresponding to the target gene are underlined) were as follows: copA (fw), 5′AATACCGATACT GTTGTAGATAAACGCACCGAGCAGGTTCTGTAGGCTGGAGCTGCTT CG3′; copA (rev), 5′GGATGTGTCTATCACTGAAGCGCACGTTACCGGGACTGCCCATATGAATATCCTCCTTAG3′; cueO (fw), 5′CTTAAAATATTC CGTCGCGCTGGGTGTGGCTTCGGCTTTGCTGTAGGCTGGAGCTGCT TCG3′; cueO (rev), 5′CTGGCGGTTTGCCATTTTCTGCACCGCTACGGAACTGCGTCATATGAATATCCTCCTTAG3′; cus operon (fw), 5′CAGAACGGCCTGGTTAACGCAGCAGATAACTATCAGAACGCTGTAGGCTGGAGCTGCTTCG3′; and cus operon (rev), 5′CTGAACCAGCCCCCGTTCCCCACAGAATCGGCAGCAGACCCATATGAATATCCTCCTTAG3′.

DNA products were obtained by PCRs using GoTaq DNA polymerase (Promega) and plasmid pKD4 or pKD3 as DNA templates (6). The deletion of each gene of interest was obtained by using the corresponding primers described above. Amplification conditions included an initial 2 min of denaturation at 95°C, followed by 30 cycles of 30 s at 95°C, 30 s at 50°C, and 2 min at 72°C and finished by 10 min at 72°C. E. coli K-12/pKD46 cells (6) grown at 30°C in LB medium supplemented with 10 mM l-arabinose and 100 mg liter−1 ampicillin were then transformed by electroporation with the purified DNA fragments obtained by PCR as already described.

Bacteria were plated on LB agar plates (1.5% agar) supplemented with kanamycin or chloramphenicol and were incubated at 37°C to select for the allelic exchange that took place and to cure the microorganisms from plasmid pKD46. The presence of the mutant alleles was confirmed by PCR amplification by using primers flanking the substitution sites.

Copper resistance and functional assays.

MICs were determined by using the E. coli K-12 ΔcopA and ΔcusCFBA ΔcueO generated mutants transformed with the different putative Cu resistance genes from A. ferrooxidans. Overnight-grown cultures of each transformant were diluted 1:1,000 in LB medium supplemented with ampicillin (100 mg liter−1), 0.1% (wt/vol) arabinose or glucose (to either induce or repress the cloned genes, respectively), and Cu ranging from 0.2 to 4 mM. Cultures were incubated at 37°C with shaking for 10 h. Finally, the lowest Cu concentration inhibiting growth by 50% (monitored by reading the optical density at 600 nm) relative to that of the control cells (not exposed to Cu) was considered the MIC for the tested transformant.

RESULTS AND DISCUSSION

Putative Cu resistance genes present in the genome of A. ferrooxidans ATCC 23270 and their possible organization.

In the annotated A. ferrooxidans ATCC 23270 genome sequence, several ORFs have been proposed to code for putative proteins related to Cu resistance. Figure Figure11 shows the genomic contexts of all of these putative A. ferrooxidans genes. Based on their similarities to known genes, two ORFs encoding potential Cu P-type ATPases have been suggested (22). copA2Af would be involved in Cu efflux, and copBAf in Cu import to the cytoplasm, as it has been proposed for copA from Enterococcus hirae (17). Additionally, we found a third possible Cu P-type ATPase (copA1Af) as shown in Fig. Fig.11 and Table Table2.2. Curiously, these A. ferrooxidans predicted paralog ATPases (copA1Af and copA2Af) may contribute to a higher Cu resistance in A. ferrooxidans than neutrophils such as E. coli that have only one type of CopA protein. These ATPases from A. ferrooxidans showed several of the conserved characteristic domains and motifs present in these metal transporters (30, 35) (Table (Table2).2). The heavy metal ATPases are a subclass of the P-type ATPases called CPx (Cys-Pro-X)-type ATPases. This name arises from the CPC or CPH (sometimes also SPC) motif located in the middle of a predicted membrane helix in the most-conserved core structure of these ATPases. The amino acids flanking the first proline of this motif (CPC/CPH/SPC) vary between transporters and have been suggested to yield information about the ion specificity. Thus, a CPx-type ATPase with a CPCALVIS translation motif is proposed to transport Cd2+, Zn2+, Pb2+, or Hg2+, while in most Cu-translocating ATPases, this motif is CPCALGLA (30). CopA1Af and CopA2Af contained the motif CPHALGLA present in E. hirae CopB, whereas CopBAf contained CPCAMGLA (Table (Table2).2). The copA1Af and copA2Af nucleotide sequences show high identity (94.5%) with one another (16). However, when the upstream sequence present in the DNA coding for these two ORFs was analyzed, no potential common regulatory elements were found (results not shown). This strongly suggests that the expression of these genes may have a different kind of regulation.

FIG. 1.
Genomic contexts of the genes coding for putative Cu resistance determinants in A. ferrooxidans ATCC 23270. Unfilled arrows represent all the ORFs predicted to be related to Cu homeostasis. Their equivalent annotations in the genome (www.tigr.org/db.shtml ...
TABLE 2.
Alignment of putative Cop proteins from A. ferrooxidans with experimentally characterized Cu transporters from other bacteriaa

E. coli CopA ATPase is part of the Cue (Cu efflux) system, together with the oxidase CueO and the transcriptional regulator CueR. Analyzing the promoter sequences of copA and cueO from E. coli, Outten et al. (19) noticed a palindromic region on them where CueR binds to upregulate the expression of the Cue system when this bacterium is exposed to Cu. An ORF with homology to cueO was not found in A. ferrooxidans. On the other hand, an ORF in this microorganism (putative cueRAf) coding for a protein with 37% identity to the DNA binding domain of E. coli CueR was present. However, the nucleotide sequences of the putative promoters present upstream of all the studied A. ferrooxidans ORFs did not show the palindromic region present in the E. coli promoters, suggesting that A. ferrooxidans has different regulatory elements.

In the genetic context of cueRAf (Fig. (Fig.1),1), there was an ORF, czcD, that might encode for a protein of the cation diffusion facilitator family, related to the efflux of cadmium, zinc, and cobalt but not Cu. This genetic organization suggests that CueRAf might be involved in the regulation of the expression of czcD and not necessarily in those genes related to Cu resistance. Obviously, the existence of other transcriptional regulators controlling the expression of A. ferrooxidans Cu resistance is expected.

The genomic context of some of the A. ferrooxidans ORFs potentially related to Cu resistance in Fig. Fig.11 showed an organization in possible transcriptional units, such as copCAf and copDAf. These ORFs from A. ferrooxidans encoded putative proteins showing 32% and 30% identities to CopC and CopD from P. syringae, respectively, which are part of the copABCD operon in this microorganism (2). However, A. ferrooxidans did not show genes with significant homology to copA and copB from P. syringae. In the latter microorganism, the periplasmic CopC is a Cu chaperone with two binding sites for the metal (2). In this regard, protein CopCAf was experimentally found in the periplasm of A. ferrooxidans (3), but it only holds the site for Cu(II) conserved (not shown).

Figure Figure11 also shows that A. ferrooxidans contained a possible operon formed by the genes cusCBAAf. On the other hand, E. coli has an operon that contains cusCBA and a cusF gene. The expression of these genes is regulated by a two-component system (CusRS) (9). E. coli CusF is a periplasmic protein containing one binding site for Cu. Once the metal is bound, CusF is thought to deliver it to the Cus system for its efflux to the extracellular medium (9). Recent crystal structures of E. coli CusF revealed an intriguing Cu-binding site, HXXXXXXXWXXMXMXF (15), that includes tryptophan. The close proximity of this amino acid to Cu suggested an unusual cation-π interaction between Cu(I) and the aromatic ring of tryptophan (37). Figure Figure11 shows the presence in A. ferrooxidans of an ORF coding for a protein with 25% identity to CusF from E. coli but with a different genomic organization since it is located distantly from cusCBAAf and divergently from copA2Af. The amino acid sequence of the putative CusFAf showed one possible Cu-binding site differing from that in E. coli only in the presence of a methionine instead of histidine (MXXXXXXXWXXMXMXF) and a signal peptide, suggesting that it is also an exported protein most likely being delivered to the periplasmic space. Furthermore, if this putative Cu-binding site was functional in A. ferrooxidans, one could predict that CusFAf might not only contain this newly described and unprecedented type of Cu-binding site but also that it would bind Cu(I) in the periplasm. Interestingly, a second cusF-like gene is present in the genome of A. ferrooxidans ATCC 23270, having the same Cu-binding motif of the CusFAf gene reported here. Its genomic context contains at least three annotated proteins possibly related to metal resistance: a copper-translocating P-type ATPase, an efflux transporter of the resistance nodulation cell division family, and a heavy metal efflux pump of the CzcA family (not shown).

The genomic sequence of A. ferrooxidans ATCC 53993 has recently been annotated (http://www.jgi.doe.gov/). This strain contains all the Cu resistance genes from A. ferrooxidans ATCC 23270 that have been confirmed experimentally as being expressed in the presence of Cu (see below). These ORFs present in both A. ferrooxidans strains show 100% identity between their corresponding DNA sequences. However, strain ATCC 53993 contains several additional putative Cu resistance determinants, such as Lferr_0167, a putative Cu ATPase, and a putative Cus system with four ORFs (Lferr_0170 to Lferr_0172). These putative genes are clustered in a short DNA region coding for several different metal resistance ORFs, a region which is absent in the genome of strain ATCC 23270. It is therefore possible that gene duplications are a key element to metal resistance in these extremophiles. It will be very interesting to determine experimentally whether A. ferrooxidans ATCC 53993 has a higher Cu resistance than the ATCC 23270 strain due to the presence of these additional genes.

Adaptation of A. ferrooxidans ATCC 23270 to different Cu concentrations.

To study the differential expression of the putative Cu resistance genes from A. ferrooxidans when the microorganism was subjected to different concentrations of the metal, it was first necessary to determine the appropriate concentrations of Cu and their effect on the growth of the acidophile. It has been reported that a strain of A. ferrooxidans was affected in its iron-oxidizing activity by high concentrations of Cu when the cells were not previously adapted to grow in the presence of the metal (5).

A. ferrooxidans cells were adapted to grow for at least three subcultures in the presence of 5, 25, and 100 mM Cu. Figure Figure22 shows the growth curves of these adapted cells. In the presence of 25 mM and 100 mM Cu, there was a greater initial growth lag and a lower growth rate than in 5 mM Cu or in the untreated culture. In addition, cell numbers obtained at the early stationary phase in the presence of 25 and 100 mM Cu were fairly smaller than those seen in the absence of the metal or in the presence of 5 mM Cu (Fig. (Fig.2).2). Although A. ferrooxidans cells were still able to grow in 100 mM Cu, total RNA was extracted from A. ferrooxidans cells grown in the presence or absence of 5 or 25 mM Cu for most of the experiments.

FIG. 2.
Growth curves of cultures used for transcriptional studies. A. ferrooxidans ATCC 23270 was previously adapted to grow for at least three subcultures in the presence of 5 mM, 25 mM, or 100 mM Cu. These cells were then inoculated in the same fresh medium ...

Several genes coding for putative Cu resistance determinants are cotranscribed in A. ferrooxidans.

Fig. Fig.11 shows the possible existence of two operons: copCAf-copDAf and cusCAf-cusBAf-cusAAf. Our previous results acquired through Northern blot experiments (not shown) suggested that the sizes of the copCAf and copDAf transcripts (about 1.5 kb) were identical when using their respective probes and corresponded to the sum of the sizes of each gene (375 bp for copCAf and 1,072 bp for copDAf), strongly suggesting that both ORFs were cotranscribed. This was confirmed by carrying out cotranscription experiments (Fig. (Fig.3)3) in which the cDNAs were obtained by using RNA extracted from a culture grown in the presence of 5 mM Cu by using a reverse primer hybridizing with the cusAAf (Fig. (Fig.3A)3A) or copDAf (Fig. (Fig.3B)3B) gene. PCR amplifications were carried out by using the corresponding cDNAs as templates and each pair of primers lying in adjacent genes. The presence of an amplicon of the expected size in each case indicated the adjacent genes were part of polycistronic messengers. These results clearly show that A. ferrooxidans genes coding for CusCAf, CusBAf, and CusAAf and those for CopDAf and CopCAf were expressed in the form of transcriptional units. The first was composed of three genes (cusCAf-cusBAf-cusAAf) and the latter composed of two (copCAf-copDAf).

FIG. 3.
Two sets of Cu resistance genes are cotranscribed in A. ferrooxidans. cDNA was synthesized with a reverse primer (unfilled arrows) hybridizing toward the 3′ end of cusAAf (A) or copDAf (B). A. ferrooxidans total RNA was extracted at the late exponential ...

The transcription of most putative Cu resistance genes is upregulated in A. ferrooxidans grown in the presence of Cu.

Real-time RT-PCR experiments showed that the transcription of all of the Cu resistance genes took place in the absence of Cu but some of them at low relative copy numbers (Table (Table3),3), indicating the existence of a minimum variable basal level of expression under these conditions. copA2Af has recently been reported to be expressed in higher levels than copA1Af when grown in ferrous iron and in the presence of Cu by using PCR-restriction fragment length polymorphism, suggesting that copA2Af might be more important than copA1Af for Cu homeostasis in A. ferrooxidans (16). Since copA1Af and copA2Af have 94.5% nucleotide sequence identity, it is unlikely that their differential expression can be determined by using real-time RT-PCR. Therefore, we did not include them in this analysis.

TABLE 3.
Induction of transcript levels for Cu resistance genes from A. ferrooxidans ATCC 23270 as determined by real-time RT-PCRa

CopBAf has been predicted to be similar to E. hirae CopA ATPase (22) and showed a canonical metal-binding site (Table (Table2).2). Although a downregulation of the expression of copBAf would be expected in the presence of a high concentration of Cu, copBAf was also induced by the presence of Cu during growth (Table (Table3).3). In order to find out about the possible function of copBAf, a functional analysis would be required (see below).

The relative copy numbers of copCAf in the absence of Cu was rather high (Table (Table3),3), in agreement with the detection of CopCAf in the periplasm of A. ferrooxidans under the same conditions (3). In the presence of 25 mM Cu, copCAf was induced about eightfold, strongly suggesting that this protein is involved in Cu resistance in this acidophilic bacterium. copDAf was also induced in the presence of Cu, albeit at a lower level.

Table Table33 shows that the genes coding for the potential efflux Cus system from A. ferrooxidans were those with the highest induction ratios, reaching values between 100- and 300-fold. This strongly suggests their importance in the Cu resistance mechanism of this extremophile. These results are in agreement with those reported for E. coli (13).

The E. coli Cus operon is induced at high Cu concentrations (i.e., close to its MIC for this metal). Under these conditions, E. coli could directly eliminate Cu to the cell's exterior through the Cus complex, avoiding Cu toxicity on the periplasm and at the same time using its proton motive force. This proton motive force is a very important feature in the acidophilic A. ferrooxidans, given that the ΔpH between the cytoplasm and the exterior can be up to 4 pH units.

Cu resistance genes from A. ferrooxidans confer higher resistance to the metal when expressed in E. coli.

Having established the expression of the putative A. ferrooxidans Cu resistance determinants under different Cu concentrations made it necessary to search for their functionality. Currently, there is no efficient and reproducible methodology for the generation of knockouts for these genes in this acidophile. Therefore, to ascertain that the A. ferrooxidans genes characterized conferred Cu resistance to a heterologous host, they were expressed in E. coli. Several of these genes were cloned in the pBAD-TOPO expression vector under the control of a promoter induced by arabinose and repressed by glucose. After these plasmids were used to transform an E. coli ΔcopA mutant, their ability to give this microorganism more resistance to Cu was studied by determining their MICs as described in Materials and Methods. As seen in Fig. Fig.4A,4A, except for copDAf, all of the A. ferrooxidans putative Cu resistance determinants conferred resistance to Cu when expressed in E. coli. On the contrary, copDAf generated a slight Cu sensitivity in E. coli. This was a predictable result given that it has been described that when copD is expressed in a P. syringae mutant lacking the complete cop operon, this mutant is more sensitive to Cu than the wild type (2). Nonetheless, the mechanism concerning the functionality of CopCAf and CopDAf in A. ferrooxidans is presently unknown.

FIG. 4.
Heterologous functional analysis of A. ferrooxidans genes in E. coli. Most of the A. ferrooxidans genes predicted to code for Cu resistance determinants were cloned in the vector pBAD-TOPO, and these constructions were used to transform E. coli Δ ...

Luo et al. suggested that copA1Af (AFE0663) was the least important of the two copA genes for Cu homeostasis in A. ferrooxidans (16). However, when this gene was expressed in the E. coli ΔcopA mutant, it also conferred to the bacteria higher Cu tolerance as seen in Fig. Fig.4A.4A. Therefore, the importance of copA1Af should probably not be underestimated as a Cu resistance determinant in A. ferrooxidans.

copBAf also conferred to E. coli ΔcopA a greater resistance to Cu. The results in Fig. Fig.4A4A suggest that copBAf is more probably related to a Cu efflux protein rather than to a Cu import protein, as had been previously proposed through a bioinformatic prediction (22). Obviously, the exact functional role for CopBAf remains to be proven.

Figure Figure4B4B clearly shows that when cusFAf and copCAf are expressed in the E. coli ΔcusCFBA ΔcueO mutant, the MICs for Cu are increased in the bacterium. Although this E. coli construction showed low Cu MICs, as reported before (10), it was possible to detect an increased Cu resistance when the two periplasmic Cu chaperones from A. ferrooxidans were expressed in it. It is unknown whether CusFAf is able to interact with the E. coli Cus system or not. However, it should be highlighted that the ΔcusCFBA ΔcueO mutant cannot bind CusFAf. As a consequence, the observed increase in Cu resistance when both cusFAf and copCAf were expressed (Fig. (Fig.4B)4B) could most likely be explained by the capacity of CusFAf and CopCAf to bind the toxic metal.

If any, a fairly smaller increase in Cu resistance was apparent when the entire cusCBAAf operon was expressed in E. coli ΔcusCFBA ΔcueO (Fig. (Fig.4B).4B). When the expression of the plasmid containing cusCBAAf was induced by the addition of arabinose to the medium, the mutant cells grew considerably more slowly, most certainly due to a toxic effect caused by the A. ferrooxidans proteins. An alternative explanation would be that the cusCBAAf operon only partially complemented the E. coli double mutant, perhaps because of the great differences in periplasmic pH between the neutrophilic and acidophilic microorganisms which may have made it difficult for the E. coli mutant to form a functional Cus complex when complemented with the A. ferrooxidans proteins.

The results presented here strongly support the functionality of the Cu resistance determinants from A. ferrooxidans and will also contribute to the functional annotation of the genes coding for Cu resistance determinants in A. ferrooxidans.

The working model in Fig. Fig.55 speculates on the possible relationship between the A. ferrooxidans Cu resistance determinants studied in this work and polyP. When external Cu concentration increases, all of the Cu resistance determinants would be induced in order to eliminate Cu from the periplasm or cytoplasm of the cells. This requires high levels of ATP to activate the metal efflux ATPases. The concomitant decrease of polyP in the presence of Cu (1) may be the result of its hydrolysis by PPX in order to remove Cu-phosphate complexes that arise. Alternatively, the decrease of polyP might be a consequence of its use by the cell in order to regenerate ATP. PolyP is synthesized by PPK by using ATP. However, when there is an excess of ADP generated by the use of cellular ATP, the reverse reaction of PPK synthesizes more ATP from polyP. In this way, the reserve polyP would supply energy to the metal detoxifying systems as well.

FIG. 5.
Scheme summarizing the possible role of Cu resistance determinants in A. ferrooxidans. This proposal is based on the expression results presented in this work and previously published results from our laboratory and other laboratories (1, 2, 12, 14, ...

In summary, the current experimental evidence indicates that the high resistance of A. ferrooxidans to Cu may be due to part or all of the following key elements: (i) a wide repertoire of Cu resistance determinants, (ii) the duplication of some of these Cu resistance determinants, (iii) the existence of novel Cu chaperones, and (iv) a polyP-based Cu resistance system.

Acknowledgments

This work was supported by FONDECYT 1070986 and in part by ICM P-05-001-F project and a doctoral fellowship from CONICYT to C.A.N.

We also thank R. Arancibia for proofreading the manuscript and TIGR for the use of their complete A. ferrooxidans ATCC 23270 genome sequence (www.tigr.org/db.shtml), as well as the U.S. Department of Energy Joint Genome Institute (http://www.jgi.doe.gov/) for the A. ferrooxidans ATCC 53993 genome sequence.

Footnotes

[down-pointing small open triangle]Published ahead of print on 7 August 2009.

REFERENCES

1. Alvarez, S., and C. A. Jerez. 2004. Copper ions stimulate polyphosphate degradation and phosphate efflux in Acidithiobacillus ferrooxidans. Appl. Environ. Microbiol. 70:5177-5182. [PMC free article] [PubMed]
2. Cha, J. S., and D. A. Cooksey. 1993. Copper hypersensitivity and uptake in Pseudomonas syringae containing cloned components of the copper resistance operon. Appl. Environ. Microbiol. 59:1671-1674. [PMC free article] [PubMed]
3. Chi, A., L. Valenzuela, S. Beard, A. J. Mackey, J. Shabanowitz, D. F. Hunt, and C. A. Jerez. 2007. Periplasmic proteins of the extremophile Acidithiobacillus ferrooxidans: a high throughput proteomic analysis. Mol. Cell. Proteomics 6:2239-2251. [PubMed]
4. Chisholm, I., L. Leduc, and G. Ferroni. 1998. Metal resistance and plasmid DNA in Thiobacillus ferrooxidans. Antonie van Leeuwenhoek 73:245-254. [PubMed]
5. Das, A., J. M. Modak, and K. A. Natarajan. 1998. Surface chemical studies of Thiobacillus ferrooxidans with reference to copper tolerance. Antonie van Leeuwenhoek 73:215-222. [PubMed]
6. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645. [PubMed]
7. Dopson, M., C. Baker-Austin, P. R. Koopineedi, and P. L. Bond. 2003. Growth in sulfidic mineral environment: metal resistance mechanism in acidophilic micro-organism. Microbiology 149:1959-1970. [PubMed]
8. Franke, S., and C. Rensing. 2007. Acidophiles: mechanisms to tolerate metal and acid toxicity, p. 271-278. In C. Gerday and N. Glansdorff (ed.), Physiology and biochemistry of extremophiles. ASM Press, Washington, DC.
9. Franke, S., G. Grass, C. Rensing, and D. H. Nies. 2003. Molecular analysis of the copper-transporting efflux system CusCFBA of Escherichia coli. J. Bacteriol. 185:3804-3812. [PMC free article] [PubMed]
10. Grass, G., and C. Rensing. 2001. Genes involved in copper homeostasis in Escherichia coli. J. Bacteriol. 183:2145-2147. [PMC free article] [PubMed]
11. Jerez, C. A. 2008. The use of genomics, proteomics and other OMIC technologies for the global understanding of biomining microorganisms. Hydrometallurgy 94:162-169.
12. Keasling, J. D. 1997. Regulation of intracellular toxic metals and other cations by hydrolysis of polyphosphate. Ann. N. Y. Acad. Sci. 829:242-249. [PubMed]
13. Kershaw, C. J., N. L. Brown, C. Constantinidou, M. D. Patel, and J. L. Hobman. 2005. The expression profile of Escherichia coli K-12 in response to minimal, optimal and excess copper concentrations. Microbiology 151:1187-1198. [PubMed]
14. Kornberg, A., N. Rao, and D. Ault-Riché. 1999. Inorganic polyphosphate: a molecule of many functions. Annu. Rev. Biochem. 68:89-125. [PubMed]
15. Loftin, I. R., S. Franke, S. A. Roberts, A. Weichsel, A. Héroux, W. R. Montfort, C. Rensing, and M. M. McEvoy. 2005. A novel copper-binding fold for the periplasmic copper resistance protein CusF. Biochemistry 44:10533-10540. [PubMed]
16. Luo, Y., Y. Liu, C. Zhang, H. Luo, H. Guan, H. Liao, G. Qiu, and X. Liu. 2008. Insights into two high homogenous genes involved in copper homeostasis in Acidithiobacillus ferrooxidans. Curr. Microbiol. doi: .10.1007/s00284-008-9189-6 [PubMed] [Cross Ref]
17. Magnani, D., and M. Solioz. 2007. How bacteria handle copper, p. 259-285. In D. H. Nies and S. Silver (ed.), Bacterial transition metal homeostasis. Springer, Heidelberg, Germany.
18. Novo, M. T., A. C. da Silva, R. Moreto, P. C. Cabral, A. Costacurta, O. Garcia, Jr., and L. M. Ottoboni. 2000. Thiobacillus ferrooxidans response to copper and other heavy metals: growth, protein synthesis and protein phosphorylation. Antonie van Leeuwenhoek 77:187-195. [PubMed]
19. Outten, F. W., D. L. Huffman, J. A. Hale, and T. V. O′Halloran. 2001. The independent cue and cus system confer copper tolerance during aerobic and anaerobic growth in Escherichia coli. J. Biol. Chem. 276:30670-30677. [PubMed]
20. Paulino, L. C., M. P. de Mello, and L. M. Ottoboni. 2002. Differential gene expression in response to copper in Acidithiobacillus ferrooxidans analyzed by RNA arbitrarily primed polymerase chain reaction. Electrophoresis 23:520-527. [PubMed]
21. Puig, S., E. M. Rees, and D. J. Thiele. 2002. The ABCDs of periplasmic copper trafficking. Structure 10:1292-1295. [PubMed]
22. Quatrini, R., C. Lefimil, F. Veloso, I. Pedroso, D. S. Holmes, and E. Jedlicki. 2007. Bioinformatic prediction and experimental verification of Fur-regulated genes in the extreme acidophile Acidithiobacillus ferrooxidans. Nucleic Acids Res. 35:2153-2166. [PMC free article] [PubMed]
23. Ramirez, P., H. Toledo, N. Guiliani, and C. A. Jerez. 2002. An exported rhodanese-like protein is induced during growth of Acidithiobacillus ferrooxidans in metal sulfides and different sulfur compounds. Appl. Environ. Microbiol. 68:1837-1845. [PMC free article] [PubMed]
24. Rawlings, D. E. 2005. Characteristics and adaptability of iron- and sulfur-oxidizing microorganisms used for the recovery of metals from minerals and their concentrates. Microb. Cell Factories 4:13. [PMC free article] [PubMed]
25. Remonsellez, F., A. Orell, and C. A. Jerez. 2006. Copper tolerance of the thermoacidophilic archaeon Sulfolobus metallicus: possible role of polyphosphate metabolism. Microbiology 152:59-66. [PubMed]
26. Rensing, C., and G. Grass. 2003. Escherichia coli mechanism of copper homeostasis in a changing environment. FEMS Microbiol. Rev. 27:197-213. [PubMed]
27. Rensing, C., B. Fan, R. Sharma, B. Mitra, and B. P. Rosen. 2000. CopA: an Escherichia coli Cu(I)-translocating P-type ATPase. Proc. Natl. Acad. Sci. USA 97:652-656. [PubMed]
28. Rohwerder, T., T. Gehrke, K. Kinzler, and W. Sand. 2003. Bioleaching review part A: progress in bioleaching: fundamentals and mechanism of bacterial metal sulfide oxidation. Appl. Microbiol. Biotechnol. 63:239-248. [PubMed]
29. Silver, S., and L. T. Phung. 1996. Bacterial heavy metal resistance: new surprises. Annu. Rev. Microbiol. 50:753-789. [PubMed]
30. Solioz, M., and C. Vulpe. 1996. CPx-type ATPases: a class of P-type ATPases that pump heavy metals. Trends Biochem. Sci. 21:237-241. [PubMed]
31. Teitzel, G. M., A. Geddie, S. K. De Long, M. J. Kirisits, M. Whiteley, and M. R. Parsek. 2006. Survival and growth in the presence of elevated copper: transcriptional profiling of copper-stressed Pseudomonas aeruginosa. J. Bacteriol. 188:7242-7256. [PMC free article] [PubMed]
32. Tottey, S., P. Rich, S. Rondet, and N. Robinson. 2001. Two Menkes-type ATPases supply copper for photosynthesis in Synechocystis PCC 6803. J. Biol. Chem. 276:19999-20004. [PubMed]
33. Valenzuela, L., A. Chi, S. Beard, A. Orell, N. Guiliani, J. Shabanowitz, D. F. Hunt, and C. A. Jerez. 2006. Genomics, metagenomics and proteomics in biomining microorganisms. Biotechnol. Adv. 24:197-211. [PubMed]
34. Vera, M., F. Pagliai, N. Guiliani, and C. A. Jerez. 2008. The chemolithoautotroph Acidithiobacillus ferrooxidans can survive under phosphate-limiting conditions by the expression of a C-P lyase operon that allows it to grow on phosphonates. Appl. Environ. Microbiol. 74:1829-1835. [PMC free article] [PubMed]
35. Ward, S. K., E. A. Hoye, and A. M. Talaat. 2008. The global responses of Mycobacterium tuberculosis to physiological levels of copper. J. Bacteriol. 190:2939-2946. [PMC free article] [PubMed]
36. Watling, H. R. 2006. The bioleaching of sulphide minerals with emphasis on copper sulphides—a review. Hydrometallurgy 84:81-108.
37. Xue, Y., A. V. Davis, G. Balakrishnan, J. P. Stasser, B. M. Staehlin, P. Focia, T. G. Spiro, J. E. Penner-Hahn, and T. V. O'Halloran. 2008. Cu(I) recognition via cation-π and methionine interactions in CusF. Nat. Chem. Biol. 4:107-109. [PMC free article] [PubMed]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)