PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Cancer Prev Res (Phila). Author manuscript; available in PMC 2010 May 1.
Published in final edited form as:
PMCID: PMC2752205
NIHMSID: NIHMS115887

Short-term Prophylactic Tamoxifen Reduces Incidence of Antiestrogen-resistant/Estrogen Receptor-positive/Progesterone Receptor-negative Mammary Tumors

Abstract

Although many estrogen-receptor positive (ER+) breast cancers are effectively treated with selective estrogen-receptor modulators and down-regulators (SERMs/SERDs), some are highly resistant. Resistance is more likely if primary cancers are devoid of progesterone receptors (PR-) or have high levels of growth factor activity. In this study, a transgenic mouse line that expresses the growth factor TGFα (NRL-TGFα mice) and that develops ER+/PR- mammary tumors was used to assess the possible effects of 1) therapeutic delivery of the SERM, tamoxifen, or SERD, ICI I82,780 (ICI), on growth of established tumors and 2) short-term prophylactic tamoxifen administration on initial development of new mammary tumors. To determine the therapeutic effects of tamoxifen and ICI on growth of established tumors, mice were exposed to three weeks of drug treatment. Neither drug influenced tumor growth or glandular pathology. To determine if early prophylactic tamoxifen could alter tumorigenesis, a 60 day tamoxifen treatment was initiated in 8-week old mice. Compared to placebo treated mice, tamoxifen reduced tumor incidence by 50% and significantly decreased the degree of mammary hyperplasia. Prophylactic tamoxifen also significantly extended the life span of tumor-free mice. These data show that in this mouse model established ER+/PR- mammary tumors are resistant to SERM/SERD treatment but the development of new mammary tumors can be prevented by an early course of tamoxifen. This study validates the utility of NRL-TGFα mice for 1) identifying candidate biomarkers of efficacious tamoxifen chemoprevention and 2) modeling the evolution of tamoxifen resistance.

Keywords: Tamoxifen, chemoprevention, breast cancer, TGFalpha, transgenic mice

Introduction

Treatment and prevention of breast cancer has improved significantly due to the successful use of anti-estrogens, more specifically known as Selective Estrogen-Receptor Modulators (SERMs) or Downregulators (SERDs), and Aromatase Inhibitors (AIs). However, these drugs have proven to be effective only in clinical cases in which primary tumors express receptors for estrogen (ER+). Because approximately 70% of all clinical breast cancer cases are ER+, the use of these anti-estrogens has improved overall morbidity and mortality for a substantial number of patients.

Unfortunately, not all breast cancer patients with ER+ disease benefit from such estrogen signaling manipulations. Approximately 30% of metastatic breast cancers are de novo resistant (1), and a majority that are initially sensitive develop resistance with time. This resistance is more frequent in ER+ tumors containing very low (or undetectable) levels of progesterone receptor (ER+/PR−) than in tumors containing high progesterone receptor levels (ER+/PR+)(2). In addition, in some circumstances when growth factor and/or growth factor-receptor levels are pronounced, treatment with growth factor inhibitors can improve the sensitivity of breast cancers to anti-estrogen therapies and therefore promote efficacy of such treatment(3) pointing to the importance of understanding the mechanisms underlying antiestrogen resistance. One possibility is that resistance to anti-estrogen therapy evolves relatively late in tumorigenesis, making early prophylactic administration of chemopreventive SERMs in high-risk women a means to reduce the subsequent incidence or delay the development of SERM/SERD/AI resistant breast cancer.

Although prophylactic treatment with SERMS reduces development of ER+ breast tumors by approximately 50% in women with high risk of breast cancer development, it is not known if their growth factor or progesterone receptor status influences subsequent breast cancer development. One major hindrance in addressing hypotheses of the underlying mechanisms of anti-estrogen resistance has been the lack of appropriate rodent models. Although many mouse models are ideal for studying carcinogenesis due to their relatively short life cycle and the availability of numerous genetically-engineered mice that develop mammary cancer, there are few such models that develop ER+ tumors. Furthermore, it has been difficult to study estrogen modulation of mammary tumors in many of these transgenic mouse models because traditional mammary-specific promoters are themselves modulated by estrogen.

The recent development of the NRL-TGFα transgenic mouse lineage, which expresses the HER1 ligand and growth factor transforming growth factor alpha (TGFα) under the regulation of the NRL promoter, circumvents these limitations. NRL- TGFα mice reliably develop mammary hyperplasias and tumors between 6–24 months depending on environmental conditions. In this model, the mammary hyperplasias and tumors are ER+ and NRL-directed transgene expression is not modulated by exogenous estrogens or by oophorectomy. (4) The tumors develop with progressive loss of progesterone receptor mRNA and protein in the presence of consistently elevated level of growth factor expression. Thus, the NRL- TGFα mouse model closely simulates the ER+/PR−/growth factor+ phenotype that represents a subset of SERM/SERD/AI resistant clinical breast cancers.

Using this mouse model in the present study, we showed that de novo resistance to anti-estrogen treatment was present in late stage tumors. Furthermore, we showed that when tamoxifen was administered to mice prior to expected lesion development for a 60 day period, there was a significant beneficial effect on tumor incidence and latency as well as hyperplasia characteristics several months later. Our results document an approximate 50% reduction in tumor incidence in this model, similar to reduction rates of ER+ cancer obtained in tamoxifen prevention clinical trials involving women at high risk for developing breast cancer. This study validates the NRL-TGFα mouse model for investigating ER+ mammary tumor behavior and suggests that prophylactic tamoxifen treatment might be helpful in reducing ER+/PR− clinical breast cancers. Our findings open up important opportunities for identifying cellular and molecular predictors of efficacious tamoxifen chemoprevention and/or antiestrogen resistance in this model that may prove applicable to human disease.

Materials and Methods

Mice

NRL- TGFα mice of line 1372-1 TgN(Nrl-tgfa)29EPS in the FVB/N strain were used in this study as previously described (4) and transgenic mice were identified by PCR of tail DNA using primers that identified specific regions of the transgene and span the final intron of the rat genomic TGFα DNA to the 3’ UTR region of hGH sequences. Use of the following primers produced a 734 bp product: forward primer ATGGCTCAGGACCACACAACTT and reverse primer ACAGTGCCAAGCAAGCAACTCA. Mice were housed in AAALAC accredited facilities with 14 h on, 10 h off light cycle. Food (Purina Lab Diet 5001) and water were provided ad libitum. All procedures were IACUC approved. Transgenic mice evaluated in this study were heterozygous for the transgene.

Sensitivity of NRL-TGFa transgene expression to tamoxifen

To evaluate the effect of tamoxifen treatment on NRL-TGFα expression in the mammary gland, 8 week old transgenic mice were implanted with a single 5 mg 4-OH tamoxifen or tamoxifen-free carrier pellet (hereafter called placebo pellet; Innovative Research of America, Sarasota, FL). Three weeks later, mammary glands were isolated, flash frozen in liquid nitrogen and stored at −70 C. Quantification of TGFα transgene expression and the housekeeping gene PUM1 was carried out as described previously (4). Briefly, total RNA was isolated from frozen mammary glands and 2.5 µg were reverse-transcribed to cDNA in 25 µl using oligo(dT) (StrataScript First-Strand Synthesis System, Stratagene). Control reactions included no Reverse Transcriptase (no RT control) and without RNA (no template control). PCR was performed using 2x Brilliant SYBR Green QPCR Master Mix (Stratagene) and previously published primers.(4) Triplicate cDNA samples were run and average crossing threshold (Ct) values calculated. Reaction efficiencies were calculated from standard curves obtained from Ct data of serial dilutions of cDNA. We utilized PUM1 as our single gene normalizer. Relative gene expressions were normalized to housekeeping gene PUM1 and calculated as 2Ct(PUM1) – Ct(gene). In preliminary experiments, the mRNA levels of PUM1 as well as three other genes, UBC, RPL19 and PMSC4, were found to be constant in 17 RNA samples from NRL-TGFa mammary glands with and without tumors, indicating that these genes could be used as internal standards (data not shown).

Tumor therapy with tamoxifen and ICI 182,780, evaluations of tumor growth and sample collection

Mice with tumors were implanted with a 5 mg 4-OH tamoxifen (tamoxifen) or placebo pellet or injected s.c. five days/week with 100 µg of ICI in 100 µl of canola oil or canola oil alone. Fold growth was evaluated after 3 wks. Tumor size was measured in 2 dimensions using a calipers and volume estimated using r12 × r2 × 3.14/6 in which r1 ≤ r2. Fold growth was determined by volume at 3 weeks post-treatment/volume on day 1 of treatment. At the end of treatment, tumor containing and nontumorous glands were formalin fixed and subjected to histological and immunohistochemical evaluation as described below.

Chemopreventive tamoxifen administration and sample collection

NRL- TGFα mice received subcutaneous implants releasing 5 mg of tamoxifen (hereafter referred to as prophylactic tamoxifen) over 60 days or containing tamoxifen-free carrier (hereafter known as placebo mice). Mice were maintained under identical housing conditions and every other subject was assigned to tamoxifen or placebo cohort as they became 8 weeks of age over a 1-year assignment period. Mice were held for tumor development for up to 2 years of age.

Histological and immunohistochemical evaluations

Glands were fixed in 10% neutral buffered formalin at room temperature for 18–24 h, dehydrated in ethanols, embedded in paraffin, sectioned (4–6 μ), and stained with hematoxylin and eosin (H&E). Some tissues were evaluated for ER and PR. ER polyclonal antibody (MC-20, #sc-542; Santa Cruz Biotechnology, Santa Cruz, CA, USA) and PR polyclonal rabbit antibody (#A0098; DakoCytomation, Carpinteria, CA, USA) were employed. Deparaffinized slides were exposed to 0.5% H2O2 in methanol, subjected to antigen retrieval consisting of 15 min boiling in 0.1 M Tris, pH 9.0 for ER and 15 min boiling in 0.1 M citrate buffer, pH 6.0 for PR, blocked with 0.5% milk in PBS and incubated overnight with 1:1000 ER or 1:750 PR antibodies, rinsed and incubated with secondary antibody (BioGenex, San Ramon, CA, USA), and finally rinsed and incubated with horseradish peroxidase streptavidin conjugate. Slides were then developed with 3,3’ diaminobenzidine and counterstained with hematoxylin. Alternatively, deparrafinized slides were subjected to peroxidase blocking reagent (DakoCytomation) followed by antigen retrieval using Rodent DECLOAKER (Biocare Medical, Concord, CA USA) in a Pascal pressure cooker @125°C for 20 min. Once slides reached room temperature, they were rinsed with distilled water, followed by TBS (DakoCytomation) and protein blocked (DakoCytomation). Primary antibodies were added at 1:250 (ER) and 1:100 (PR) for 40 min. and then treated with Rodent on Rodent HRP Polymer (Biocare Medical) for 25 min, DAB for 5 min and DAB Enhancer S196 (DakoCytomation) and counterstained with hematoxylin for 5 min prior to rinsing in water and dehydration through alcohols. Prior to mounting coverslips with Permount, slides received a final rinse in Clear-Rite3. For negative controls primary antibody was omitted. Negative controls included an inactivated blocking peptide for ER (#sc-542P; Santa Cruz Biotechnology, Santa Cruz, CA, USA) and omitted primary antibody for PR. Uterine tissue was used as control tissue (not shown). Images were visualized using a Nickon Eclipse E600 microscope and acquired using a SPOT CCD digital camera (Diagnostic Instruments, Inc., Sterling Heights, MI) and Metamorph Imaging System 3.5 software and the photocollage (Supplementary Figure 1) assembled using Adobe Photoshop CS Version 8.0.

Statistical analyses

For transgene expression and tumor growth analyses, two-tailed Student t-tests were performed on log transformed data (Figure 1 & Figure 2, respectively). Tumor incidence was determined by dividing the number of mice which acquired tumors by the total number of mice in that treatment group and proportions compared using χ.2test (Figure 3 a). For survival analysis, Kaplain Meier plots were generated and differences were determined using logrank tests (Figure 3 b & c). For analysis of differences in degree of hyperplasias in tumor versus tumor-free mammary glands and in glands from mice that had received tamoxifen or placebo preventive, two-way ANOVA was carried out on nontransformed data (Figure 4). Differences between groups were considered significant for p ≤ 0.05.

Figure 1
Mammary expression of the NRL-TGFα transgene was not modulated by tamoxifen. Mice were implanted with Tamoxifen (n=6) or placebo pellets (n=6). Three weeks post-implant, mammary glands were harvested from each subject, mammary RNA was isolated ...
Figure 2Figure 2
Tumor growth was not different in mice treated with tamoxifen or placebo (a) or in mice treated with ICI or placebo for 3 weeks (b). Mice with tumors received either a tamoxifen or placebo subcutaneous implant or 5d/wk subcutaneous injections of ICI or ...
Figure 3Figure 3Figure 3
(a) Tumor incidence was reduced by 50% in mice receiving short-term placebo (n=20/31) compared to mice that received tamoxifen (n=12/37; p=0.0167; χ.2test). (b) Tumor latency was not affected by tamoxifen chemoprevention as depicted in the Kaplan ...
Figure 4
The degree of lobular hyperplasia in end stage TGFα mice (n=54) was higher in tumor containing versus tumor free mice and in mice that received placebo chemoprevention versus tamoxifen chemoprevention (p= 0.0009 and p < 0.0001, respectively, ...

Results

TGFα transgene expression is not affected by tamoxifen

We previously demonstrated that transgene expression in NRL- TGFα mice is not modulated by estrogen in vivo or in vitro or by ovariectomy. (4) Therefore we predicted that transgene expression would not be affected by tamoxifen treatment. In this study we confirmed that NRL transgene expression is not modulated by the SERM, tamoxifen when delivered continuously over 3 weeks (Figure 1).

Effects of tamoxifen or ICI therapy on tumor growth, proliferation, apoptosis and histopathology

NRL- TGFα mice with tumors were administered tamoxifen or ICI versus placebo and tumor size monitored over three weeks. Neither tamoxifen nor ICI altered the average growth of tumors during treatment as compared with controls (p=0.8182 and p=0.8918, respectively) although there were two tamoxifen treated tumors which had negative growth and two which had higher positive than placebo controls at the end of treatment, suggesting possible tamoxifen sensitivity in some cases although de novo resistance by most. ER or PR levels were not different for the 2 tumors displaying negative growth compared to the remaining tumors within the tamoxifen group or as compared to the placebo group. However, further study is required to determine if subpopulations of tumors exist that respond differently to tamoxifen treatment. (Figure 2). In addition, histological assessment of the sizes of microscopic tumors, the degree of epithelial layering, mitotic levels, degree of dysplasia or ER and PR levels in tumors showed no differences between groups (data not shown).

Effects of short-term prophylactic tamoxifen on tumor incidence and latency

NRL- TGFα mice receiving a 60 day implant of tamoxifen delivered prior to lesion developed were followed until tumor development or 2 years of age. We found that, similar to clinical responses to tamoxifen seen with ER+ cases, tumor incidence was reduced by approximately 50% in mice that received prophylactic tamoxifen compared with placebo controls (Fig 3a). Clinical trial data do not as yet reveal whether tumor latency is longer in individuals receiving tamoxifen chemopreventive and we also have been unable to find published preclinical data addressing this issue. One possibility is that tamoxifen delays the onset or progression of precancer changes in individuals at high risk of developing breast cancer. However, in NRL-TGFα mice, time of death due to tumor development was not altered with prophylactic tamoxifen. These results suggest that the tamoxifen response in this model was all or nothing. The standard deviation of tumor latency in placebo treated NRL- TGFα mice was approximately 4 months representing about 25% of the mean time to tumor development (Figure 2). This relatively large variation may mask subtle effects of tamoxifen on tumor latency. Tumor latency of TGFα mice that received tamoxifen versus placebo chemopreventive is highly similar as evidenced by similar survival curves (Fig 3b). Importantly, there is a consistent pattern of tumor incidence throughout the 2 year study indicating that there was no drift associated with genetic, epigenetic and/or environmental conditions.

Effects of short-term prophylactic tamoxifen on degree of lobularization, cell turnover and ER and PR staining

Unknown from clinical trials employing tamoxifen as a preventive is whether tumor or hyperplasia histotype is altered. We found in our model that tamoxifen did alter mammary gland histology; mammary glands collected from tamoxifen treated mice displayed a reduced number of hyperplasias compared with glands from mice that received placebo implants (Figure 4 and Supplementary Figure 1). In addition, the sizes of hyperplasias were reduced, as was the level of cellular atypia and extent of secretory vacuoles (Table 1 and Supplementary Figure 1). Furthermore, the extent of hyperplasias also was influenced by tumor presence. Mice with tumors had a larger number and larger hyperplasias than tumor-free mice (Figure 4 and Supplementary Figure 1). Tumors that developed in mice receiving prophylactic tamoxifen had reduced levels of mitotic cells. Mitotic counts ranged from 1–9 per 10 high power field (hpf) compared to a range of 0–21 mitotic counts per hpf in mice that had received placebo implants, nearing but not reaching statistical significance (two-tailed Student-t test p= 0.08.) Immunohistochemical analysis did not reveal any detectable differences in number of cells stained with ER or PR or intensity of staining of cells making up hyperplasias with and without tumors or from mice that had received tamoxifen versus placebo. Finally, differences in ER and PR staining were not detected in tumors from mice that received tamoxifen or placebo implants (data not shown).

Table 1
Tamoxifen reduces the total number of mice hat displayed mammary hyperplasias and the presence of cells with vacuoles and cellular atypia.1

Effects of short-term tamoxifen chemopreventive on life span

NRL- TGFα mice that formed tumors reached similar ages regardless of treatment. Mice developed tumors between 11–24 months of age (Figure 3b) and were sacrificed due to size of primary tumor. However, in NRL- TGFα tumor-free mice there was a marked difference in life-span between tamoxifen and placebo treated mice in that that mice which received 60 days of prophylactic tamoxifen lived significantly longer (Figure 3c; p ≤ 0.0001) than mice that received placebo. Most tamoxifen treated mice lived close to 2 years of age while death in placebo treated mice occurred between 1–2 years and was spread uniformly, without a single concentrated period of death in the placebo cohort. In addition, the underlying cause of death generally was not obvious. When mice were found dead or were euthanized, necropsy was carried out to determine cause. We identified the following causes in five mice: three mice had uterine/vaginal tumors, two mice had enlarged urinary bladders, and another had a lung abcess.

Discussion

The lack of detectable PR in ER+ clinical breast cancer increases the likelihood of tamoxifen resistance. Additionally, this outcome is correlated with an increase presence of growth factors.(5) As predicted by clinical data, established ER+/PR− mammary tumors in NRL- TGFα mice did not respond to tamoxifen therapy or to the pure antiestrogen, ICI 182,780 (the former name of the clinical drug, fulvestrant). To the best of our knowledge the effect of tamoxifen chemoprevention on incidence of clinical cases of ER+/PR− breast cancer has not been determined, but our data clearly demonstrate that short-term prophylactic tamoxifen reduces ER+/PR− tumor incidence in NRL- TGFα mice. We aimed to mimic clinical trials in that mice received tamoxifen for a limited period, 60 days in this study, representing approximately 8% of a 2 year life-span. Tumor incidence in these mice was reduced by 50%, similar to the reduction in invasive ER+ breast cancer in the Royal Marsden Trial National, the International Breast Intervention Study (IBIS) I Trial and National Surgeon Adjuvant Breast and Bowel Project (NSABP) P-1 Trial which used between 5–8 year course of tamoxifen and which have been followed for up to 20 years.(6) One earlier preclinical investigation carried out in the C3H mouse strain that spontaneously develops mammary cancer due to mouse mammary tumor virus also found that a limited course of prophylactic tamoxifen was just as effective as a longer course (3 versus 12 months) for reducing tumor incidence.(7) These collective findings suggest that a high priority should be to understand how limited exposure to tamoxifen result in a long-term breast cancer preventive effect. This information could open up new approaches to prevention and be realized as significant reductions in breast cancer morbidity and mortality.

The effect of prophylactic tamoxifen on tumor latency has not been scrutinized in clinical trials due to the limited time since the studies were commenced. Such studies will be challenging due to the heterogeneity of the disease in the population. In the present study tumor latency was not different between genetically identical NRL- TGFα mice that received tamoxifen versus placebo implants. This finding leads us to conclude that the response to prophylactic tamoxifen was all or nothing rather than simply postponing tumor development.

The effect of tamoxifen chemoprevention on tumor phenotype in clinical trials also is unknown. In NRL- TGFα mice, tumor phenotype was not altered with treatment with one exception; a reduction in mitotic cells was seen with prophylactic tamoxifen which approached statistical significance. Regardless of this finding, tumorigenesis appears to be fundamentally similar in treated versus untreated mice as tumors displayed indistinguishable growth rates, histological architecture and similar levels of ER and PR. The fact that prophylactic tamoxifen did not alter tumor phenotype may be due to unvarying cellular responses to elevated TGFα expression or to the time window in which tamoxifen was delivered. These issues could be clarified by comparing tamoxifen verses placebo outcomes in an inducible mouse lineage in which the TGFα transgene can be induced at different times before, during and after tamoxifen delivery or in the present NRL-TGFα line used in this study but with delivery of prophylactic tamoxifen at later time points. One consistent finding between our study and other investigations using rodent breast cancer models, is that delivery of tamoxifen prior to tumor establishment appears key to effective prevention. (711)

Because we know that hyperplasias (usual and atypical) precede tumor development in NRL- TGFα mice in a similar fashion as described in WAP- TGFα mice, (12) we evaluated the degree of hyperplasias in mice at necropsy. We found that the extent of hyperplastic disease, measured as the degree of lobularization was greatly reduced in tumor-free mice (Figure 4; Supplementary Figure 1). In addition, hyperplasia load was reduced significantly in glands from mice that received tamoxifen chemoprevention and this reduction occurred to a similar extent in both tumor-free or tumor-laden mice. Furthermore, there was a reduced degree of cellular atypia and vacuoles, markers of atypical hyperplasias, in mice that received tamoxifen chemopreventive compared with placebo mice (Table 1; Supplementary Figure 1). If tumors arise from hyperplasias, a decrease in hyperplasia size and degree of atypia may be key to reducing tumor incidence. Based on our earlier characterization of tumorigenesis in TGFα mice, this appears to be the case, as we find hyperplasias are 1) preceded by a higher degree of epithelial cell turnover than architecturally normal epithelia within the same mouse, 2) present prior to tumor formation and 3) coincident with tumor presence. (4, 13) By some means tamoxifen chemoprevention appears to inhibit the net cell gain that comes with high proliferative activity that is intrinsic with mammary hyperplasias in this model. This cannot be accomplished strictly by the direct tamoxifen effect of reducing proliferation as tamoxifen is not present during most of the subject’s life, in this mouse study up to 88 weeks after tamoxifen withdrawal and in clinical trials for up to 20 years. (6)

Hyperplasias may represent precursor lesions or indicate general pathological changes reflecting an increase risk of breast cancer development. Atypical hyperplasias are found more often in mastectomies or biopsies containing malignancies than in mastectomies or biopsies containing benign lesions. (14) Furthermore, low grade hyperplasias have been found more often in the margins of breast biopsies from women that later developed ipsilateral breast cancers than in women that did not. (15) The finding that hyperplastic lesions contain genetic changes that are reflected in invasive cancers in the same individual provides further evidence linking hyperplasias to cancer development. (16, 17) A few studies using rodent models of mammary cancer have shown preneoplasia reduction including hyperplasias with tamoxifen chemoprevention, even in cases in which developed tumors are hormone-independent. (711, 1821) Importantly, in women, hyperplasias typically have elevated ER+ (22) and therefore represent an excellent target for SERM chemoprevention.

Cells that form preneoplasias appear to be an important target of SERM chemoprevention not only in preclinical models but in one critical clinical trial: women in the tamoxifen arm of the National Surgical Adjuvant Breast and Bowel Project Breast Cancer Prevention Trial (P-1) realized a 50% reduction in ductal carcinoma in situ compared with women receiving placebo. (23) In spite of these findings the influence of SERMs on the incidence of usual or atypical hyperplasias has had very little scrutiny in clinical studies with one exception; there were no detectable differences in the presence of usual and/or atypical ductal hyperplasias in one small study involving approximately 50 women who received a one year course of either tamoxifen or placebo. (24) The influence of estrogen signaling in hyperplasia development is intuitive based on what is known about the mitogenic properties of estrogens in breast as well as the following clinical observations: 1) A recent evaluation of the Women’s Health Initiative randomized trial of estrogen and progestin reported an increased risk of benign breast disease in women that took these hormones(25) compared to women receiving placebo. (26) The concern is that women with benign breast disease have an increased risk of breast cancer with hormone replacement. (27) 2) Tamoxifen has been shown to reduce breast density in women, and the major determinants of breast density at baseline were menopausal state, body mass index and previous history of atypical hyperplasias. (28) 3) Women at high risk of breast cancer development due to heredity had high incidences of hyperplasias found on mastectomy, however, incidence was less in a subgroup that earlier had undergone oophorectomy. (29) Taken together, these data predict that hyperplasia development is influenced by estrogens and can be prevented or abrogated with antiestrogens. These findings in women and in the aforementioned studies involving rodents stress that evaluations of hyperplasia incidence and degree should be evaluated in SERM breast cancer prevention trials. Additionally, it would be important to correlate reductions in hyperplasias with ER and tumor status.

An unexpected result of this study was that mice receiving prophylactic tamoxifen and remained tumor-free lived longer than placebo receiving tumor-free mice. Tumor-free mice died from causes other than mammary tumor development and displayed few clues as to cause, although the underlying process(es) appear to be modulated by estrogen. Whether this is a phenomenon specific to this model, the FVB/N inbred mouse strain, or can be more generally applied is unknown. The effect of tamoxifen chemoprevention on life span in women is currently unclear and will likely remain that for many years. However, statistical modeling of tamoxifen effects on life span in women in prevention trials has been carried out. (30) These authors present a theoretical model that predicts that younger women (ages 30–49) receiving tamoxifen may live longer than placebo arm age-matched women, assuming the negative side-affects of tamoxifen, pulmonary embolism and endometrial cancer, are removed upon treatment cessation. This benefit also applied to women > 50 years of age, but only when it was assumed that cancer incidence did not change with time since receiving tamoxifen. The appropriateness of these statistical models to women in SERM prevention trials will be revealed in the future and our studies support these future evaluations.

In conclusion, identifying individuals who will respond to SERM chemoprevention is a high priority as is discerning the molecular or cellular targets of SERM and general markers of tumor outcome. In addition, understanding the basis of why some breast cancer cases respond to SERM chemoprevention while others do not would greatly enhance the field of breast cancer prevention. NRL- TGFα mice develop ER+/PR− tumors that are resistant to tamoxifen and ICI, but tumor development can be prevented by a short-term prophylactic course of tamoxifen. The cellular and molecular targets of tamoxifen as well as biomarkers for tumor outcome can be studied in this mouse model because only half of the mice respond to tamoxifen chemoprevention. Mammary epithelial cell subtypes that evolve into hyperplasias likely represent the targets of tamoxifen action in this mouse model. Investigations that reveal these targets in this and other preclinical models will shed light on the mechanism by which short-term tamoxifen chemoprevention leads to long-term tumor prevention. In addition, our data suggest that evaluation of outcomes in women enrolled in SERM prevention trials should include specific tracking of the effects of tamoxifen chemoprevention on incidence of ER+/PR− tumors and the presence of hyperplasias and precancers as well as effects on life-span.

Supplementary Material

Supp Fig 1

Supplementary Figure 1:

Glandular and cellular architecture in tumor-free and tumor-laden NRL-TGFα mice that received a 60 d course of prophylactic tamoxifen or placebo. Glands were collected at end stage, either when tumors developed or at 2 years of age in the case of tumor-free mice. The degree of hyperplasia varied with treatment and with tumor presence. Photomicrographs A, C, E and G are at 40x and represent a glandular view of lobular development reflecting alveolar budding stages (A), L1 lobular development (C), L2 lobular development (E) and L3 lobular development (G). L2 and L3 glands are considered hyperplastic as per Cardiff et al.(31) Photomicrographs B, D, F and H are at 600x and display typical cellular morphology that accompanies alveolar budding (B), L1 lobules (D) or hyperplasias (F, H). Relatively low levels of hyperplasias were found in tumor-free mice (A,C) and in mice that received prophylactic tamoxifen (A, E) and the lowest levels were in tumor-free mice that received tamoxifen. Epithelial cells of hyperplasias often displayed vacuoles (arrow in F) and cellular atypia (F, H). These structures also were found in tumors (I, J); I 600x, J 400x. Tumors and hyperplasias had a higher number of mitotic figures (arrows in I and H) than was displayed in L1 lobules (D) or in glands with alveolar buds (B). Tumors in mice receiving prophylactic tamoxifen (J) or placebo (I) had similar papillary architectural and cellular characteristics.

Acknowledgements

Funding for portions of this project was provided by NIH NCI R03CA119321, a University of Minnesota Academic Health Sciences Seed Grant and the University of Minnesota Medical Foundation to TRH. We are grateful to Dr. Lois J. Heller for critical review of this manuscript and acknowledge St. Luke’s Hospital, Duluth MN for their generous research support. We also acknowledge Rebekah Bolstad for managing tissue collections as well as Barbara Elmquist and Emily Heid for excellent histological and immunohistochemical preparations.

Footnotes

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest.

References

1. Osborne CK. Steroid hormone receptors in breast cancer management. Breast Cancer Res Treat. 1998;51(3):227–238. [PubMed]
2. Bardou VJ, Arpino G, Elledge RM, Osborne CK, Clark GM. Progesterone receptor status significantly improves outcome prediction over estrogen receptor status alone for adjuvant endocrine therapy in two large breast cancer databases. J Clin Oncol. 2003;21(10):1973–1979. [PubMed]
3. Arpino G, Wiechmann L, Osborne CK, Schiff R. Crosstalk between the estrogen receptor and the HER tyrosine kinase receptor family: molecular mechanism and clinical implications for endocrine therapy resistance. Endocr Rev. 2008;29(2):217–233. [PubMed]
4. Rose-Hellekant TA, Schroeder MD, Brockman JL, et al. Estrogen receptor-positive mammary tumorigenesis in TGFalpha transgenic mice progresses with progesterone receptor loss. Oncogene. 2007;26(36):5238–5246. [PMC free article] [PubMed]
5. Arpino G, Weiss H, Lee AV, et al. Estrogen receptor-positive, progesterone receptor-negative breast cancer: association with growth factor receptor expression and tamoxifen resistance. J Natl Cancer Inst. 2005;97(17):1254–1261. [PubMed]
6. Howell A. The endocrine prevention of breast cancer. Best Pract Res Clin Endocrinol Metab. 2008;22(4):615–623. [PubMed]
7. Jordan VC, Lababidi MK, Langan-Fahey S. Suppression of mouse mammary tumorigenesis by long-term tamoxifen therapy. J Natl Cancer Inst. 1991;83(7):492–496. [PubMed]
8. Medina D, Kittrell FS, Hill J, Shepard A, Thordarson G, Brown P. Tamoxifen inhibition of estrogen receptor-alpha-negative mouse mammary tumorigenesis. Cancer Res. 2005;65(8):3493–3496. [PubMed]
9. Menard S, Aiello P, Tagliabue E, et al. Tamoxifen chemoprevention of a hormone-independent tumor in the proto-neu transgenic mice model. Cancer Res. 2000;60(2):273–275. [PubMed]
10. Osborne MP, Ruperto JF, Crowe JP, Rosen PP, Telang NT. Effect of tamoxifen on preneoplastic cell proliferation in N-nitroso-N-methylurea-induced mammary carcinogenesis. Cancer Res. 1992;52(6):1477–1480. [PubMed]
11. Ting AY, Kimler Bruce F, Fabian Carol J, Petroff, Brain K. Tamoxifen prevents premalignant changes of breast, but not ovarian, cancer in rats at high risk for both diseases. Cancer Prevention Research. 2008;1(7):546–553. [PMC free article] [PubMed]
12. Rose-Hellekant TA, Gilchrist K, Sandgren EP. Strain background alters mammary gland lesion phenotype in transforming growth factor-alpha transgenic mice. Am J Pathol. 2002;161(4):1439–1447. [PubMed]
13. Rose-Hellekant TA, Wentworth KM, Nikolai S, Kundel DW, Sandgren EP. Mammary carcinogenesis is preceded by altered epithelial cell turnover in transforming growth factor-alpha and c-myc transgenic mice. Am J Pathol. 2006;169(5):1821–1832. [PubMed]
14. Lakhani SR. The transition from hyperplasia to invasive carcinoma of the breast. J Pathol. 1999;187(3):272–278. [PubMed]
15. Goldstein NS, Kestin LJ, Vicini FA. Monomorphic epithelial proliferations: characterization and evidence suggesting they are the pool of partially transformed lesions from which some invasive carcinomas arise. Am J Clin Pathol. 2007;128(6):1023–1034. [PubMed]
16. O'Connell P, Pekkel V, Fuqua SA, Osborne CK, Clark GM, Allred DC. Analysis of loss of heterozygosity in 399 premalignant breast lesions at 15 genetic loci. J Natl Cancer Inst. 1998;90(9):697–703. [PubMed]
17. Xu S, Wei B, Zhang H, Qing M, Bu H. Evidence of chromosomal alterations in pure usual ductal hyperplasia as a breast carcinoma precursor. Oncol Rep. 2008;19(6):1469–1475. [PubMed]
18. Medina D, Kittrell FS, Shepard A, Contreras A, Rosen JM, Lydon J. Hormone dependence in premalignant mammary progression. Cancer Res. 2003;63(5):1067–1072. [PubMed]
19. Nanni P, Nicoletti G, De Giovanni C, et al. Prevention of HER-2/neu transgenic mammary carcinoma by tamoxifen plus interleukin 12. Int J Cancer. 2003;105(3):384–389. [PubMed]
20. Telang NT, Bradlow HL, Osborne MP. Effect of tamoxifen on mammary preneoplasia: relevance to chemopreventive intervention. Cancer Detect Prev. 1994;18(4):313–321. [PubMed]
21. Yoshidome K, Shibata MA, Couldrey C, Korach KS, Green JE. Estrogen promotes mammary tumor development in C3(1)/SV40 large T-antigen transgenic mice: paradoxical loss of estrogen receptoralpha expression during tumor progression. Cancer Res. 2000;60(24):6901–6910. [PubMed]
22. Allred DC, Mohsin SK, Fuqua SA. Histological and biological evolution of human premalignant breast disease. Endocr Relat Cancer. 2001;8(1):47–61. [PubMed]
23. Fisher B, Costantino JP, Wickerham DL, et al. Tamoxifen for prevention of breast cancer: report of the National Surgical Adjuvant Breast and Bowel Project P-1 Study. J Natl Cancer Inst. 1998;90(18):1371–1388. [PubMed]
24. Mohsin SK, Allred DC, Osborne CK, et al. Morphologic and immunophenotypic markers as surrogate endpoints of tamoxifen effect for prevention of breast cancer. Breast Cancer Res Treat. 2005;94(3):205–211. [PubMed]
25. Rossouw JE, Anderson GL, Prentice RL, et al. Risks and benefits of estrogen plus progestin in healthy postmenopausal women: principal results From the Women's Health Initiative randomized controlled trial. Jama. 2002;288(3):321–333. [PubMed]
26. Rohan TE, Negassa A, Chlebowski RT, et al. Estrogen plus progestin and risk of benign proliferative breast disease. Cancer Epidemiol Biomarkers Prev. 2008;17(9):2337–2343. [PMC free article] [PubMed]
27. Wang DY, Fentiman IS. Epidemiology and endocrinology of benign breast disease. Breast Cancer Res Treat. 1985;6(1):5–36. [PubMed]
28. Cuzick J, Warwick J, Pinney E, Warren RM, Duffy SW. Tamoxifen and breast density in women at increased risk of breast cancer. J Natl Cancer Inst. 2004;96(8):621–628. [PubMed]
29. Hoogerbrugge N, Bult P, de Widt-Levert LM, et al. High prevalence of premalignant lesions in prophylactically removed breasts from women at hereditary risk for breast cancer. J Clin Oncol. 2003;21(1):41–45. [PubMed]
30. Maucort-Boulch D, Roy P. Modeling the effect of tamoxifen chemoprevention on long-term mortality in white women at high risk of breast cancer. Eur J Cancer Prev. 2006;15(4):347–352. [PubMed]
31. Cardiff RD, Anver MR, Gusterson BA, et al. The mammary pathology of genetically engineered mice: the consensus report and recommendations from the Annapolis meeting. Oncogene. 2000;19(8):968–988. [PubMed]