PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jvirolPermissionsJournals.ASM.orgJournalJV ArticleJournal InfoAuthorsReviewers
 
J Virol. 2009 October; 83(19): 10028–10035.
Published online 2009 July 29. doi:  10.1128/JVI.01015-09
PMCID: PMC2748023

Dominant CD8+ T-Lymphocyte Responses Suppress Expansion of Vaccine-Elicited Subdominant T Lymphocytes in Rhesus Monkeys Challenged with Pathogenic Simian-Human Immunodeficiency Virus[down-pointing small open triangle]

Abstract

Emerging data suggest that a cytotoxic T-lymphocyte response against a diversity of epitopes confers greater protection against a human immunodeficiency virus/simian immunodeficiency virus infection than does a more focused response. To facilitate the creation of vaccine strategies that will generate cellular immune responses with the greatest breadth, it will be important to understand the mechanisms employed by the immune response to regulate the relative magnitudes of dominant and nondominant epitope-specific cellular immune responses. In this study, we generated dominant Gag p11C- and subdominant Env p41A-specific CD8+ T-lymphocyte responses in Mamu-A*01+ rhesus monkeys through vaccination with plasmid DNA and recombinant adenovirus encoding simian-human immunodeficiency virus (SHIV) proteins. Infection of vaccinated Mamu-A*01+ rhesus monkeys with a SHIV Gag Δp11C mutant virus generated a significantly increased expansion of the Env p41A-specific CD8+ T-lymphocyte response in the absence of secondary Gag p11C-specific CD8+ T-lymphocyte responses. These results indicate that the presence of the Gag p11C-specific CD8+ T-lymphocyte response following virus challenge may exert suppressive effects on primed Env p41A-specific CD8+ T-lymphocyte responses. These findings suggest that immunodomination exerted by dominant responses during SHIV infection may diminish the breadth of recall responses primed during vaccination.

CD8+ T lymphocyte responses play a central role in controlling human immunodeficiency virus (HIV) in humans and simian immunodeficiency virus (SIV) infections in nonhuman primates (18, 20, 29, 41). Naturally occurring virus-specific CD8+ T-lymphocyte responses typically focus on a limited number of dominant epitopes (52). However, accumulating data indicate that a broad cellular immune response, in which multiple viral epitopes are recognized by CD8+ T lymphocytes, confers better protection against viral replication than a restricted cellular immune response (26, 33). Therefore, it has been suggested that increasing the magnitude of subdominant epitope-specific responses may increase the breadth of a cellular immune response and provide enhanced protection against HIV/SIV replication.

An understanding of the factors that influence the immunodominance hierarchy of viral epitopes will be needed to develop vaccination strategies that can generate the greatest breadth of virus-specific CD8+ T-lymphocyte responses. Differences in antigen processing, competition between epitope peptides for major histocompatibility complex (MHC) class I molecules, T-cell receptor (TCR) repertoire, TCR affinity for peptide class I complexes, and immunodomination have been shown to contribute to the dominance of an epitope-specific response (6, 10, 24, 32, 45, 52). In addition, studies have shown that immunodominance patterns for T-lymphocyte epitopes may differ following a primary and secondary exposure to the same viral antigen (4, 5, 43).

In the present study, we observed that Mamu-A*01+ rhesus monkeys primed with plasmid DNA and boosted with recombinant adenovirus (rAd) vaccines encoding SIVmac239 Gag-Pol-Nef and HIV-1 Env proteins generated Gag p11C- and Env p41A-specific CD8+ T-lymphocyte responses of comparable magnitude. However, while there was a significant expansion of Gag p11C-specific CD8+ T-lymphocyte populations following challenge with pathogenic simian-human immunodeficiency virus 89.6P (SHIV-89.6P), there was no significant expansion of the Env p41A-specific CD8+ T-lymphocyte populations. We hypothesized that factors influencing the relative immunodominance of the primed Gag p11C- and Env p41A-specific CD8+ T-lymphocyte responses after viral challenge may have contributed to the observed differences in their secondary expansion. In the present study, we sought to identify the potential factors contributing to this immunodominance.

MATERIALS AND METHODS

Animals, vaccination, and viral challenge.

Rhesus monkeys used in this study were maintained in accordance with the guidelines of the Institutional Animal Care and Use Committee for Harvard Medical School and the Guide for the Care and Use of Laboratory Animals. Rhesus monkeys were screened for the presence of the Mamu-A*01 allele by using a PCR-based technique as previously described (17). DNA sequence analysis was performed on all positive samples to confirm identity with the established Mamu-A*01 sequence (27). Immunized Mamu-A*01+ rhesus monkeys (n = 9) were first vaccinated intramuscularly with plasmid DNA and then boosted 18 weeks later with 1012 viral particles of rAd5 expressing SIV Gag-Pol-Nef and HIV-1 Env proteins. These monkeys were then challenged intravenously 14 weeks following rAd5 boost immunization with 1 × 108 RNA copies of either wild-type (WT) SHIV-89.6P (n = 5) or the Gag p11C mutant (Δp11C) SHIV (n = 4), a virus constructed from the SHIV-KB9 clone to contain a Gag p11C epitope mutation and a downstream compensatory substitution in gag that allow the generation of replication-competent virus (3, 34, 51).

Virus.

The WT SHIV-89.6P virus used to infect immunized rhesus monkeys was derived from in vivo passage of SHIV-89.6, a chimeric virus consisting of the SIVmac239 backbone and a primary patient CCR5/CXCR4 dual-tropic HIV-1 89.6 envelope gene (37-39). To produce mutant Δp11C SHIV for infection of immunized rhesus monkeys, the proviral plasmids for Δp11C SHIV were transfected into CEMx174 cells (American Type Culture Collection) by the DEAE-dextran method (13). To monitor for virus production, culture supernatants were assessed for SIV p27 antigen by using an SIV core antigen enzyme-linked immunosorbent assay (Beckman-Coulter). Supernatant was harvested every week for 3 weeks, pooled, and aliquoted into 1-ml quantities for use in subsequent infection studies. Prior to pooling, viruses were sequenced to confirm the presence of the gag mutations by using a OneStep reverse transcription-PCR (RT-PCR) kit (Qiagen) and the primers gag-forward (5′-AGCACCATCTAGTGGCAGAGGA-3) and gag-reverse (5′-GAAATGGCTCTTTTGGCCCTT-3′). RT-PCR products were purified using a QIAquick PCR purification kit (Qiagen) and cloned into the pGEM-T Easy vector (Promega). Individual transformed colonies were subjected to T7/SP6 dideoxy sequencing.

Antibodies, tetramers, and peptides.

The monoclonal antibodies (MAbs) used in this study were directly coupled to fluorescein isothiocyanate (FITC) or allophycocyanin (APC). The following MAbs were used: FITC-conjugated anti-CD8α (clone 7PT3F9; Beckman Coulter) and APC-conjugated anti-CD3 (clone FN18; BioSource International). Mamu-A*01/p11C/β2m (SIV Gag) and Mamu-A*01/p41A/β2m (HIV-1 Env) tetramer complexes were prepared as previously described (2, 11, 19, 30). Briefly, phycoerythrin-labeled ExtrAvidin (Sigma-Aldrich) was mixed stepwise with biotinylated Mamu-A*01/peptide complexes at a molar ratio of 1:4 to produce the tetrameric complexes. Gag p11C (CTPYDINQM) and Env p41A (YAPPITGQI) peptides were obtained from QCB/Biosource (Hopkinton, MA). Lyophilized peptides were dissolved in a minimum volume of dimethyl sulfoxide (Sigma-Aldrich) and diluted to a stock peptide concentration of 15 mg/ml in water containing 5 mM dithiothreitol (Sigma-Aldrich) and then frozen at −70°C in aliquots. Before use, peptides were diluted to a working concentration in RPMI 1640 medium (Mediatech) supplemented with glutamine, 12% fetal calf serum, penicillin, streptomycin, and gentamicin.

Tetramer staining and flow cytometry.

Whole-blood specimens were stained with Mamu-A*01/p11C/β2m or Mamu-A*01/p41A/β2m tetramer for 30 min at room temperature. Cells were then stained with a mixture of APC-anti-CD3 and FITC-anti-CD8α MAbs for 30 min. Whole-blood specimens (100 μl) were lysed using a Q-prep workstation (Beckman-Coulter) before being fixed in 1.5% formaldehyde. A total of 3 × 104 events on CD3+/CD8+ T lymphocytes were acquired using a FACSCalibur flow cytometer, and data were analyzed using CellQuest software (BD Biosciences).

MHC purification and peptide binding assay.

Stable transfectants expressing the membrane-bound rhesus monkey MHC class I molecule Mamu-A*01 were created in the HLA class I-deficient human B-cell line 721.221, as described previously (35, 47). Mamu-A*01 molecules were purified from cell lysates by using affinity chromatography with the anti-HLA class I (-A, -B, and -C) antibody W6/32 (2). Protein purity, concentration, and depletion efficiency were monitored by sodium dodecyl sulfate-polyacrylamide gel electrophoresis.

Quantitative assays for peptide binding to detergent-solubilized Mamu-A*01 molecules were based on the inhibition of binding of a radiolabeled standard probe peptide as detailed elsewhere (23). The radiolabeled indicator peptide used for the Mamu-A*01 binding assays was the clade B HxB2 HIV-1 Env p41A epitope (sequence YAPPISGQI). For each peptide tested, the concentration of unlabeled peptide yielding 50% binding inhibition (IC50) of the radiolabeled probe peptide was calculated from three independent experiments.

env sequencing.

Viral RNA was isolated from plasma samples of vaccinated, WT SHIV-infected rhesus monkeys 28 days after challenge by using a QIAamp virus RNA isolation kit (Qiagen). Virus sequence analyses were performed on a 600-bp region of env containing the Env p41A epitope by amplification with a OneStep RT-PCR kit (Qiagen) and the primers env-forward (5′-CTACTACTATTCCATCCCAGTCTAGCAGAAGAAGA-3′) and env-reverse (5′-CATCATCATCATATGAGGGACAATTCTAGAAGT-3′). RT-PCR products were purified using a QIAquick PCR purification kit (Qiagen) and cloned into the pGEM-T Easy vector (Promega). Individual transformed colonies were subjected to T7/SP6 dideoxy sequencing.

Vβ repertoire analysis.

TCR Vβ repertoire analyses were performed as previously described (24, 44). First, Mamu-A*01/p11C/β2m and Mamu-A*01/p41A/β2m tetramer-binding CD8+ T-lymphocyte populations from peripheral blood mononuclear cells (PBMCs) of vaccinated rhesus monkeys (n = 2) 62 weeks after WT SHIV challenge were isolated through live cell sorting using a fluorescence-activated-cell-sorting Vantage SE flow cytometer (BD Biosciences). RNA was then extracted from these isolated populations by using an RNeasy Mini extraction kit (Qiagen). The integrity of the RNA was confirmed using an Agilent 2100 bioanalyzer. cDNA was then synthesized from the extracted RNA by using a Super SMART PCR cDNA synthesis kit (Clontech). Briefly, the single-stranded cDNA reaction was catalyzed by using Moloney murine leukemia virus reverse transcriptase with the 3′ SMART CDS primer II A and Smart II A oligonucleotide primers provided in the Super SMART cDNA synthesis kit. Preamplified double-stranded cDNA libraries were made by a 10- to 20-cycle PCR, utilizing the 5′ PCR primer. The optimal number of cycles of preamplification was found by performing a test run in the presence of SYBR green to determine the maximum number of PCR cycles that could be performed in the log-linear amplification range. cDNA derived from each sample was equally distributed into 46 individual PCR mixtures which contained a sense Vβ family-specific primer, an antisense Cβ-specific primer, and the TaqMan Cβ probe. PCRs were carried out using Sure-Start Taq (Stratagene). The real-time PCR was carried out for 55 cycles on an MX4000 (Stratagene), using the following cycling program: 95°C for 10 min, followed by 55 cycles of 95°C for 10 s and 58°C for 30 s, followed by reading of fluorescence, and then 72°C for 30 s.

gag point mutations.

To produce Δp11C SHIV proviral plasmids, the gag position 2 p11C (T47I) and downstream compensatory (I71V) mutations (34, 51) were introduced into the SHIV-KB9 5′ plasmid obtained from the National Institutes of Health AIDS Research and Reference Reagent Program provided by Joseph Sodroski. Mutations were created by PCR mutagenesis with a QuikChange kit (Stratagene). Oligonucleotide primers T47I-Forward (5′-CAGGCACTGTCAGAAGGTTGCATCCCCTATGACATTAATCAGATGTTAAATTG) and T47I-Reverse (5′-CAATTTAACATCTGATTAATGTCATAGGGGATGCAACCTTCTGACA GTGCCTG) were used to change Thr (ACC) to Ile (ATC). Primers I71V-Forward (5′-GCGGCTATGCAGATTATCAGAGATGTTATAAACGAGGAGGCTGCAGATTG-3′) and I71V-Reverse (5′-CAATCTGCAGCCTCCTCGTTTATAACATCTCTGATAATCTGCATAG CCGC-3′) were used to change Ile (ATT) to Val (GTT).

Viral load.

Numbers of viral RNA copies per ml virus stock or plasma were quantified using an ultrasensitive branched DNA detection assay with a detection limit of >125 RNA copies per ml (Siemens).

Statistical analysis.

All statistical differences between groups were calculated by the Mann-Whitney test, using the program GraphPad Prism (version 4.03). A P value of <0.05 between groups was considered statistically significant.

RESULTS

No significant expansion of vaccine-elicited Env p41A-specific CD8+ T-lymphocyte tetramer responses following SHIV challenge, despite efficient vaccine priming.

Mamu-A*01+ rhesus monkeys (n = 5) were immunized using a heterologous prime/boost strategy with plasmid DNA and rAd encoding SIV Gag-Pol-Nef and HIV-1 Env (42). These monkeys were then challenged intravenously with WT SHIV-89.6P. Both Gag p11C- and Env p41A-specific CD8+ T-lymphocyte tetramer responses were measured following the DNA prime (week 10), following the rAd boost (week 28), on the day of challenge (week 42), and following SHIV-89.6P challenge (peak responses were detected at 16 to 28 days postchallenge) (Fig. (Fig.1).1). Significant differences in mean tetramer responses were determined using the Mann-Whitney test. Surprisingly, the mean value of the Env p41A-specific CD8+ T-lymphocyte responses (8.80% ± 2.46% of the total CD8+ T-lymphocyte population in the peripheral blood) after rAd5 vaccination was not significantly different from that of the Gag p11C-specific CD8+ T-lymphocyte responses (6.47% ± 1.96%; P = 0.7; not significant). However, infection of the vaccinated rhesus monkeys with WT SHIV resulted in a significant expansion of Gag p11C-specific CD8+ T lymphocytes (P = 0.008) but not Env p41A-specific CD8+ T lymphocytes (P = 0.2; not significant). Peak Gag p11C-specific CD8+ T-lymphocyte responses after challenge with WT SHIV increased approximately 16-fold in comparison with responses measured on the day of challenge, whereas peak Env p41A responses increased on average less than 2-fold. Therefore, we observed significantly lower percentages of Env p41A-specific CD8+ T lymphocytes compared to those of Gag p11C-specific CD8+ T lymphocytes postchallenge (P = 0.03). These data suggest that although we were able to induce equivalent epitope-specific CD8+ T-lymphocyte responses by vaccination, these vaccine-induced T lymphocytes do not expand uniformly following virus challenge. Therefore, we initiated a series of studies to determine the mechanism responsible for the deficiency in Env p41A-specific CD8+ T-lymphocyte expansion following WT SHIV challenge.

FIG. 1.
No significant expansion in the Env p41A-specific CD8+ T-lymphocyte response following SHIV challenge, despite efficient vaccine priming. Mamu-A*01+ rhesus monkeys (n = 5) were primed with plasmid DNA, boosted with rAd ...

Env p41A has a greater affinity than Gag p11C for the MHC class I molecule Mamu-A*01.

Although the affinity of an epitope peptide for a MHC class I molecule does not always predict the relative dominance of CD8+ T-lymphocyte responses following infection, sufficient binding to MHC class I molecules is required for the stability of peptide-MHC class I complexes and proper peptide presentation on the surface of the antigen-presenting cell. To determine if low-affinity binding of the Env p41A peptide might be associated with the relatively poor expansion of Env p41A-specific CD8+ T-lymphocyte responses to that peptide following SHIV challenge, we assessed the affinity of the Env p41A (YAPPITGQI) and Gag p11C (CTPYDINQM) epitope peptides for Mamu-A*01 by using a cell-free peptide binding assay (22) Mamu-A*01 molecules were incubated with a fixed amount of iodinated indicator peptide and various amounts of the cold competitor peptides Env p41A and Gag p11C or an irrelevant peptide control. These mixtures were assessed for residual I125 indicator-MHC class I complexes, and any decreases in counts were expressed as percent inhibition at the tested concentration of cold peptide (Fig. (Fig.2).2). Interestingly, nearly 2 logs fewer Env p41A peptides than Gag p11C peptides were required to inhibit 50% of indicator peptide binding, demonstrating that the Env p41A peptide has a higher affinity than the Gag p11C peptide for Mamu-A*01. These data suggest that the absence of Env p41A-specific CD8+ T-lymphocyte expansion following WT SHIV infection of immunized rhesus monkeys is not a consequence of insufficient Env p41A binding to MHC class I.

FIG. 2.
Env p41A has greater affinity for MHC class I than Gag p11C. A cell-free peptide binding assay was used to determine the inhibition of binding of a radiolabeled indicator peptide to MHC class I by various concentrations of unlabeled Gag p11C (CTPYDINQM), ...

No Env p41A escape mutations in viral clones isolated postchallenge.

Numerous studies have documented sudden decreases in epitope-specific CD8+ T-lymphocyte responses during acute HIV/SIV infection due to mutations in epitope sequences that allow virus to escape from immune recognition (1, 31). To determine whether early epitope mutation was responsible for the limited expansion of primed Env p41A-specific CD8+ T lymphocytes following SHIV infection, we sequenced a 600-bp region of env containing the p41A epitope from plasma viral RNA 28 days after SHIV-infection in four of five vaccinated rhesus monkeys. We sequenced approximately eight viral clones from each rhesus monkey plasma sample and found no mutations in the Env p41A epitope sequence in comparison with the original WT SHIV that was used to infect the animal (data not shown). Furthermore, in the ~75 amino acids flanking the Env p41A epitope, there was less than one nonsynonymous mutation per clone. The absence of mutations located in and flanking the Env p41A epitope suggests that mutation-related changes in processing or MHC class I binding of the epitope peptide cannot be implicated in the limited expansion of the Env p41A-specific CD8+ T-lymphocyte responses during acute viremia in these vaccinated rhesus monkeys.

Gag p11C- and Env p41A-specific CD8+ T-lymphocyte populations have comparably diverse TCR Vβ repertoires.

We have previously shown in Mamu-A*01+ and Mamu-A*02+ rhesus monkeys that the relative dominance of an epitope-specific CD8+ T-lymphocyte response is associated with the clonal diversity of that response (24). Dominant epitope-specific CD8+ T-lymphocyte populations had clonally diverse repertoires, whereas subdominant epitope-specific populations that consistently generate weak responses had a limited clonal repertoire.

We sought to determine whether the clonal diversity of Env p41A-specific CD8+ T-lymphocyte populations contributed to the minimal expansion of these cells in vivo following SHIV challenge. To this end, we carried out Vβ repertoire analyses of Env p41A-specific and Gag p11C-specific CD8+ T-lymphocyte populations in two vaccinated rhesus monkeys 62 weeks after WT SHIV challenge. We used samples from this late time point postchallenge because these were the only samples that were available for these two animals. However, we have previously evaluated the Vβ repertoire of epitope-specific CD8+ T-cell lymphocytes prospectively at multiple time points after infection in vaccinated and infected monkeys and found that the breadths of the repertoire are similar at early and late time points after infection (44).

First, Gag p11C and Env p41A tetramer-binding CD8+ T-lymphocyte populations were sorted from PBMCs of vaccinated, SHIV-infected rhesus monkeys. RNA was extracted from each sorted cell population, and cDNA was generated for evaluation in a real-time PCR assay developed to quantify the expression of 25 distinct rhesus Vβ families and subfamilies (44). As shown in previous studies (24), Gag p11C-specific CD8+ T-lymphocyte populations are relatively polyclonal and employ multiple Vβ families (Fig. (Fig.3A).3A). Interestingly, the Env p41A-specific CD8+ T-lymphocyte populations (Fig. (Fig.3B)3B) are as diverse in the number of TCR Vβ families they utilize as the Gag p11C-specific CD8+ T-lymphocyte populations. These results suggest that the minimal expansion of primed Env p41A-specific CD8+ T-lymphocyte populations following WT SHIV infection is not a consequence of a limited clonal repertoire of these cells.

FIG. 3.
Gag p11C- and Env p41A-specific CD8+ T-lymphocyte populations have diverse TCR Vβ repertoires. PBMCs isolated from two vaccinated rhesus monkeys at week 62 after challenge with WT SHIV were stimulated in vitro with Gag p11C or Env p41A ...

Consequences of abrogated Gag p11C-specific CD8+ T-lymphocyte responses on Env p41A-specific CD8+ T-lymphocyte responses.

We then sought to determine whether the primed Gag p11C-specific CD8+ T-lymphocyte response exerts a suppressive effect on the primed Env p41A-specific CD8+ T-lymphocyte response as these cell populations expand during acute infection (9). To assess this possibility, we constructed a Gag p11C mutant SHIV virus (Δp11C) by introducing mutations into a pathogenic molecular clone of SHIV-89.6P which have been shown to ablate Gag p11C-specific CD8+ T-lymphocyte responses in vivo (3, 34, 51). Infection of vaccinated Mamu-A*01+ rhesus monkeys with WT SHIV resulted in a significant secondary expansion of the Gag p11C-specific CD8+ T-lymphocyte response that was maximal at day 21. However, following infection of vaccinated Mamu-A*01+ rhesus monkeys (n = 4) with Δp11C SHIV, an attenuation of the peak secondary Gag p11C-specific CD8+ T-lymphocyte response was observed on day 14 postchallenge at the time of peak viremia (Fig. (Fig.4A)4A) (P = 0.02). Although the Gag p11C-specific responses were maximal on day 28 in the vaccinated animals infected with Δp11C SHIV (Fig. (Fig.5A),5A), the magnitude of these responses was negligible, constituting less than 0.5% of the total CD8+ T-cell population in PBMCs. This was expected since the Δp11C SHIV should not have elicited Gag p11C-specific CD8+ T-lymphocyte responses. Importantly, the incorporated mutations did not significantly change the kinetics (Fig. (Fig.4B)4B) or magnitude (Fig. (Fig.4C)4C) of peak viremia from that seen following infection with WT SHIV.

FIG. 4.
Mutations in Δp11C SHIV abrogate Gag p11C-specific CD8+ T-lymphocyte responses but do not affect the kinetics or magnitude of peak viremia. Mamu-A*01+ rhesus monkeys were DNA primed and rAd boosted with the SHIV immunogens ...
FIG. 5.
Significant increases in Env p41A-specific CD8+ T-lymphocyte responses in the absence of Gag p11C-specific CD8+ T-lymphocyte responses following infection by Δp11C SHIV. Time of peak (A) and increase (B) in epitope-specific CD8 ...

We then evaluated the kinetics of the peak Env p41A and Gag p11C tetramer responses in the WT and Δp11C SHIV-infected rhesus monkeys. Both Gag p11C- and Env p41A-specific responses emerged on day 10 in all animals (data not shown). In vaccinated animals that were infected with WT SHIV, the highest Env p41A-specific CD8+ T-lymphocyte responses were observed on day 10, while Gag p11C-specific CD8+ T-lymphocyte responses continued to expand and were maximal on approximately day 21 (P = 0.008) (Fig. (Fig.5A).5A). In contrast, in vaccinated rhesus monkeys challenged with Δp11C SHIV, the peak Env p41A-specific CD8+ T-lymphocyte responses were observed on average on day 19, soon after peak viremia. The difference in the day of peak Env p41A-specific responses between vaccinated animals that were infected with WT and Δp11C SHIV was significant (P = 0.02). These data suggest that during acute WT SHIV infection, Gag p11C-specific CD8+ T-lymphocyte responses may have exerted early suppressive effects on Env p41A-specific CD8+ T lymphocytes to prevent further expansion beyond day 10. The removal of the dominant T-cell response may have abrogated this suppressive effect, allowing Env p41A-specific CD8+ T lymphocytes to continue their expansion and eventually reach a maximal peak at a later time point.

To determine whether the elimination of the Gag p11C-specific CD8+ T-lymphocyte response facilitated any changes in the expansion of Env p41A-specific recall responses, we assessed the increase in Env p41A tetramer responses following Δp11C SHIV infection in vaccinated Mamu-A*01+ rhesus monkeys (Fig. (Fig.5B).5B). WT SHIV infection of vaccinated rhesus monkeys resulted in 3- to 46-fold increases (mean increase, 16.3-fold) in Gag p11C-specific responses in comparison with responses measured on the day of challenge, while the majority of Env p41A-specific responses increased less than 2-fold in the same monkeys (mean increase, 1.86-fold). The difference between the expansions of Gag p11C-specific responses and Env p41A-specific responses after infection with WT SHIV was significant (P = 0.02). However, in vaccinated rhesus monkeys infected with Δp11C SHIV, we observed 3- to 10-fold increases in the Env p41A-specific responses (mean increase, 7.23-fold). The difference in Env p41A-specific responses between animals infected with Δp11C SHIV and WT SHIV-infected animals was significant (P = 0.04). These data demonstrate that Gag p11C-specific CD8+ T-lymphocyte responses can significantly suppress the normal kinetics of primed Env p41A-specific CD8+ T-lymphocyte responses following SHIV infection.

DISCUSSION

The mechanisms by which immunodomination suppresses immune responses to subdominant epitopes are still poorly understood. In murine models, the abrogation of immunodominant epitope-specific CD8+ T-lymphocyte responses has led to the enhancement of subdominant epitope-specific CD8+ T-lymphocyte responses. Such enhanced responses have been shown by infection of knockout mice lacking the restricting MHC class I allele that presents the immunodominant epitope, deletion of immunodominant epitope-specific CD8+ T lymphocytes in the thymus, and infection of mice with a viral variant that cannot elicit the immunodominant CD8+ T-lymphocyte response (48-50). In the present study, we show an enhanced CD8+ T-lymphocyte response to a subdominant SHIV epitope following challenge of vaccinated rhesus monkeys with an SHIV variant harboring mutations which abrogate the dominant Gag p11C response.

Previous studies from our laboratory have demonstrated altered kinetics of Mamu-A*02-restricted epitope-specific CD8+ T-lymphocyte responses in the presence of the dominant Mamu-A*01-restricted Gag p11C epitope-specific CD8+ T-lymphocyte response in Mamu-A*01+ and A*02+ rhesus monkeys after SIV infection (31). In the present study, we observed an early suppression of the Mamu-A*01-restricted Env p41A-specific CD8+ T-lymphocyte response in the presence of the dominant Mamu-A*01-restricted Gag p11C-specific CD8+ T-lymphocyte response following WT SHIV infection of vaccinated rhesus monkeys. This suppression was abrogated when the dominant CD8+ T-lymphocyte response was eliminated following infection of vaccinated rhesus monkeys with Δp11C SHIV. These findings suggest that the dominant Gag p11C-specific CD8+ T-lymphocyte response has the ability to suppress epitope-specific CD8+ T-lymphocyte responses that are restricted by the same or different MHC class I molecules (7, 14, 40). Moreover, despite efficient priming of this lymphocyte population, early suppression of Env p41A-epitope specific CD8+ T-lymphocyte responses following SHIV challenge suggests that boosting precursor frequencies of subdominant epitope-specific CD8+ T-lymphocyte populations through vaccination is not sufficient to overcome the immunodomination that arises after SHIV infection.

We were not able to assess the effects of immunodomination on viral replication or disease progression in the present study. The Δp11C SHIV used to infect animals in the present study exhibited a half-log lower set point plasma RNA level than the WT SHIV in unvaccinated animals (data not shown). These data suggest that Δp11C SHIV was less fit as a virus and likely intrinsically less pathogenic than the WT SHIV. Therefore, we could not attribute changes in viral load or CD4+ T-cell counts after peak viremia to the presence or absence of immunodominant T-cell responses.

It is interesting that the ability of the Gag p11C-specific CD8+ T-lymphocyte response to suppress the Env p41A-specific CD8+ T-lymphocyte response was observed following infection with WT SHIV but not following vaccination. A similar phenomenon has been observed in murine studies and was attributed to competition among responding CD8+ T lymphocytes for epitopes presented on the same antigen-presenting cell. This competition would presumably not occur when competing epitopes are presented at lower frequencies on different antigen-presenting cells or when antigen-presenting cells are present in large excess (12, 14, 15). Therefore, the comparable expansion of epitope-specific CD8+ T-lymphocyte populations following vaccination may be a consequence of low-level transient expression of SHIV gene products, an even distribution of antigen, and/or a slow turnover of antigen-presenting cells. This would result in limited competition among epitope-specific CD8+ T-lymphocyte populations. Increased levels of viral antigen during acute SHIV infection may increase competition between CD8+ T-lymphocyte populations for antigen-presenting cells, resulting in a dramatic suppression of subdominant CD8+ T-lymphocyte populations (50). It is unlikely that the limited secondary expansion of Env p41A-specific CD8+ lymphocyte populations following infection with WT SHIV is due to clonal exhaustion, since rhesus monkeys infected with the Δp11C SHIV developed a greater expansion of Env p41A-specific CD8+ T lymphocytes than was seen following infections with WT SHIV.

The studies in which the MHC class I-peptide binding affinities were characterized yielded unexpected results. While immunodominant epitope peptides usually bind MHC molecules with higher affinity than nondominant epitope peptides (8, 21, 45), the nonimmunodominant Env p41A epitope peptide had a higher binding affinity for Mamu-A*01 molecules than the immunodominant Gag p11C epitope peptide in our assay. Studies have shown that occasional nondominant epitope peptides can have a higher affinity for MHC class I molecules than dominant epitope peptides (28, 36). It is possible that the affinity of a TCR-peptide-MHC interaction (46) or the dissociation rate of the TCR from the peptide-MHC (16, 25) may contribute to the dominance of an epitope in cases where epitope affinity does not correlate with immunodominance. It is also important to note that the in vitro conditions employed in these peptide-MHC class I molecule binding assays may not reflect the in vivo biological conditions of the cellular compartments in which peptide loading occurs.

The major factors contributing to immunodomination are still largely unknown. In the present study, epitope peptide affinity for MHC class I and CD8+ T-lymphocyte clonality did not seem to contribute to immunodomination in the rhesus monkey model system. Elucidation of the mechanisms that determine the ability of dominant CD8+ T-lymphocyte populations to suppress other epitope-specific responses will advance our understanding of epitope dominance hierarchies and will provide avenues to explore for the development of effective HIV vaccine strategies.

Acknowledgments

We thank Angela Carville for technical assistance.

This work was supported by National Institutes of Health grant AI20729.

Footnotes

[down-pointing small open triangle]Published ahead of print on 29 July 2009.

REFERENCES

1. Allen, T. M., D. H. O'Connor, P. Jing, J. L. Dzuris, B. R. Mothe, T. U. Vogel, E. Dunphy, M. E. Liebl, C. Emerson, N. Wilson, K. J. Kunstman, X. Wang, D. B. Allison, A. L. Hughes, R. C. Desrosiers, J. D. Altman, S. M. Wolinsky, A. Sette, and D. I. Watkins. 2000. Tat-specific cytotoxic T lymphocytes select for SIV escape variants during resolution of primary viraemia. Nature 407:386-390. [PubMed]
2. Allen, T. M., J. Sidney, M. F. del Guercio, R. L. Glickman, G. L. Lensmeyer, D. A. Wiebe, R. DeMars, C. D. Pauza, R. P. Johnson, A. Sette, and D. I. Watkins. 1998. Characterization of the peptide binding motif of a rhesus MHC class I molecule (Mamu-A*01) that binds an immunodominant CTL epitope from simian immunodeficiency virus. J. Immunol. 160:6062-6071. [PubMed]
3. Barouch, D. H., J. Kunstman, J. Glowczwskie, K. J. Kunstman, M. A. Egan, F. W. Peyerl, S. Santra, M. J. Kuroda, J. E. Schmitz, K. Beaudry, G. R. Krivulka, M. A. Lifton, D. A. Gorgone, S. M. Wolinsky, and N. L. Letvin. 2003. Viral escape from dominant simian immunodeficiency virus epitope-specific cytotoxic T lymphocytes in DNA-vaccinated rhesus monkeys. J. Virol. 77:7367-7375. [PMC free article] [PubMed]
4. Belz, G. T., W. Xie, J. D. Altman, and P. C. Doherty. 2000. A previously unrecognized H-2D(b)-restricted peptide prominent in the primary influenza A virus-specific CD8+ T-cell response is much less apparent following secondary challenge. J. Virol. 74:3486-3493. [PMC free article] [PubMed]
5. Belz, G. T., W. Xie, and P. C. Doherty. 2001. Diversity of epitope and cytokine profiles for primary and secondary influenza a virus-specific CD8+ T cell responses. J. Immunol. 166:4627-4633. [PubMed]
6. Busch, D. H., and E. G. Pamer. 1998. MHC class I/peptide stability: implications for immunodominance, in vitro proliferation, and diversity of responding CTL. J. Immunol. 160:4441-4448. [PubMed]
7. Chen, W., L. C. Anton, J. R. Bennink, and J. W. Yewdell. 2000. Dissecting the multifactorial causes of immunodominance in class I-restricted T cell responses to viruses. Immunity 12:83-93. [PubMed]
8. Chen, W., S. Khilko, J. Fecondo, D. H. Margulies, and J. McCluskey. 1994. Determinant selection of major histocompatibility complex class I-restricted antigenic peptides is explained by class I-peptide affinity and is strongly influenced by nondominant anchor residues. J. Exp. Med. 180:1471-1483. [PMC free article] [PubMed]
9. Chen, W., and J. McCluskey. 2006. Immunodominance and immunodomination: critical factors in developing effective CD8+ T-cell-based cancer vaccines. Adv. Cancer Res. 95:203-247. [PubMed]
10. Daly, K., P. Nguyen, D. L. Woodland, and M. A. Blackman. 1995. Immunodominance of major histocompatibility complex class I-restricted influenza virus epitopes can be influenced by the T-cell receptor repertoire. J. Virol. 69:7416-7422. [PMC free article] [PubMed]
11. Egan, M. A., M. J. Kuroda, G. Voss, J. E. Schmitz, W. A. Charini, C. I. Lord, M. A. Forman, and N. L. Letvin. 1999. Use of major histocompatibility complex class I/peptide/beta2M tetramers to quantitate CD8+ cytotoxic T lymphocytes specific for dominant and nondominant viral epitopes in simian-human immunodeficiency virus-infected rhesus monkeys. J. Virol. 73:5466-5472. [PMC free article] [PubMed]
12. Grufman, P., E. Z. Wolpert, J. K. Sandberg, and K. Karre. 1999. T cell competition for the antigen-presenting cell as a model for immunodominance in the cytotoxic T lymphocyte response against minor histocompatibility antigens. Eur. J. Immunol. 29:2197-2204. [PubMed]
13. Karlsson, G. B., M. Halloran, J. Li, I. W. Park, R. Gomila, K. A. Reimann, M. K. Axthelm, S. A. Iliff, N. L. Letvin, and J. Sodroski. 1997. Characterization of molecularly cloned simian-human immunodeficiency viruses causing rapid CD4+ lymphocyte depletion in rhesus monkeys. J. Virol. 71:4218-4225. [PMC free article] [PubMed]
14. Kedl, R. M., W. A. Rees, D. A. Hildeman, B. Schaefer, T. Mitchell, J. Kappler, and P. Marrack. 2000. T cells compete for access to antigen-bearing antigen-presenting cells. J. Exp. Med. 192:1105-1113. [PMC free article] [PubMed]
15. Kedl, R. M., B. C. Schaefer, J. W. Kappler, and P. Marrack. 2002. T cells down-modulate peptide-MHC complexes on APCs in vivo. Nat. Immunol. 3:27-32. [PubMed]
16. Kersh, G. J., E. N. Kersh, D. H. Fremont, and P. M. Allen. 1998. High- and low-potency ligands with similar affinities for the TCR: the importance of kinetics in TCR signaling. Immunity 9:817-826. [PubMed]
17. Knapp, L. A., E. Lehmann, M. S. Piekarczyk, J. A. Urvater, and D. I. Watkins. 1997. A high frequency of Mamu-A*01 in the rhesus macaque detected by polymerase chain reaction with sequence-specific primers and direct sequencing. Tissue Antigens 50:657-661. [PubMed]
18. Koup, R. A., J. T. Safrit, Y. Cao, C. A. Andrews, G. McLeod, W. Borkowsky, C. Farthing, and D. D. Ho. 1994. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. J. Virol. 68:4650-4655. [PMC free article] [PubMed]
19. Kuroda, M. J., J. E. Schmitz, D. H. Barouch, A. Craiu, T. M. Allen, A. Sette, D. I. Watkins, M. A. Forman, and N. L. Letvin. 1998. Analysis of Gag-specific cytotoxic T lymphocytes in simian immunodeficiency virus-infected rhesus monkeys by cell staining with a tetrameric major histocompatibility complex class I-peptide complex. J. Exp. Med. 187:1373-1381. [PMC free article] [PubMed]
20. Kuroda, M. J., J. E. Schmitz, W. A. Charini, C. E. Nickerson, M. A. Lifton, C. I. Lord, M. A. Forman, and N. L. Letvin. 1999. Emergence of CTL coincides with clearance of virus during primary simian immunodeficiency virus infection in rhesus monkeys. J. Immunol. 162:5127-5133. [PubMed]
21. Lazarski, C. A., F. A. Chaves, S. A. Jenks, S. Wu, K. A. Richards, J. M. Weaver, and A. J. Sant. 2005. The kinetic stability of MHC class II:peptide complexes is a key parameter that dictates immunodominance. Immunity 23:29-40. [PubMed]
22. Loffredo, J. T., J. Sidney, S. Piaskowski, A. Szymanski, J. Furlott, R. Rudersdorf, J. Reed, B. Peters, H. D. Hickman-Miller, W. Bardet, W. M. Rehrauer, D. H. O'Connor, N. A. Wilson, W. H. Hildebrand, A. Sette, and D. I. Watkins. 2005. The high frequency Indian rhesus macaque MHC class I molecule, Mamu-B*01, does not appear to be involved in CD8+ T lymphocyte responses to SIVmac239. J. Immunol. 175:5986-5997. [PubMed]
23. Loffredo, J. T., J. Sidney, C. Wojewoda, E. Dodds, M. R. Reynolds, G. Napoe, B. R. Mothe, D. H. O'Connor, N. A. Wilson, D. I. Watkins, and A. Sette. 2004. Identification of seventeen new simian immunodeficiency virus-derived CD8+ T cell epitopes restricted by the high frequency molecule, Mamu-A*02, and potential escape from CTL recognition. J. Immunol. 173:5064-5076. [PubMed]
24. Manuel, E. R., W. A. Charini, P. Sen, F. W. Peyerl, M. J. Kuroda, J. E. Schmitz, P. Autissier, D. A. Sheeter, B. E. Torbett, and N. L. Letvin. 2006. Contribution of T-cell receptor repertoire breadth to the dominance of epitope-specific CD8+ T-lymphocyte responses. J. Virol. 80:12032-12040. [PMC free article] [PubMed]
25. Matsui, K., J. J. Boniface, P. Steffner, P. A. Reay, and M. M. Davis. 1994. Kinetics of T-cell receptor binding to peptide/I-Ek complexes: correlation of the dissociation rate with T-cell responsiveness. Proc. Natl. Acad. Sci. USA 91:12862-12866. [PubMed]
26. Messaoudi, I., J. A. Guevara Patino, R. Dyall, J. LeMaoult, and J. Nikolich-Zugich. 2002. Direct link between mhc polymorphism, T cell avidity, and diversity in immune defense. Science 298:1797-1800. [PubMed]
27. Miller, M. D., H. Yamamoto, A. L. Hughes, D. I. Watkins, and N. L. Letvin. 1991. Definition of an epitope and MHC class I molecule recognized by gag-specific cytotoxic T lymphocytes in SIVmac-infected rhesus monkeys. J. Immunol. 147:320-329. [PubMed]
28. Mullbacher, A., M. Lobigs, J. W. Yewdell, J. R. Bennink, R. Tha Hla, and R. V. Blanden. 1999. High peptide affinity for MHC class I does not correlate with immunodominance. Scand. J. Immunol. 50:420-426. [PubMed]
29. Musey, L., J. Hughes, T. Schacker, T. Shea, L. Corey, and M. J. McElrath. 1997. Cytotoxic-T-cell responses, viral load, and disease progression in early human immunodeficiency virus type 1 infection. N. Engl. J. Med. 337:1267-1274. [PubMed]
30. Newberg, M. H., M. J. Kuroda, W. A. Charini, A. Miura, C. I. Lord, J. E. Schmitz, D. A. Gorgone, M. A. Lifton, K. Kuus-Reichel, and N. L. Letvin. 2002. A simian immunodeficiency virus nef peptide is a dominant cytotoxic T lymphocyte epitope in Indian-origin rhesus monkeys expressing the common MHC class I allele mamu-A*02. Virology 301:365-373. [PubMed]
31. Newberg, M. H., K. J. McEvers, D. A. Gorgone, M. A. Lifton, S. H. Baumeister, R. S. Veazey, J. E. Schmitz, and N. L. Letvin. 2006. Immunodomination in the evolution of dominant epitope-specific CD8+ T lymphocyte responses in simian immunodeficiency virus-infected rhesus monkeys. J. Immunol. 176:319-328. [PubMed]
32. Niedermann, G., S. Butz, H. G. Ihlenfeldt, R. Grimm, M. Lucchiari, H. Hoschutzky, G. Jung, B. Maier, and K. Eichmann. 1995. Contribution of proteasome-mediated proteolysis to the hierarchy of epitopes presented by major histocompatibility complex class I molecules. Immunity 2:289-299. [PubMed]
33. Nikolich-Zugich, J., M. K. Slifka, and I. Messaoudi. 2004. The many important facets of T-cell repertoire diversity. Nat. Rev. Immunol. 4:123-132. [PubMed]
34. Peyerl, F. W., D. H. Barouch, W. W. Yeh, H. S. Bazick, J. Kunstman, K. J. Kunstman, S. M. Wolinsky, and N. L. Letvin. 2003. Simian-human immunodeficiency virus escape from cytotoxic T-lymphocyte recognition at a structurally constrained epitope. J. Virol. 77:12572-12578. [PMC free article] [PubMed]
35. Prilliman, K. R., K. W. Jackson, M. Lindsey, J. Wang, D. Crawford, and W. H. Hildebrand. 1999. HLA-B15 peptide ligands are preferentially anchored at their C termini. J. Immunol. 162:7277-7284. [PubMed]
36. Regner, M., A. Mullbacher, R. V. Blanden, and M. Lobigs. 2001. Immunogenicity of two peptide determinants in the cytolytic T-cell response to flavivirus infection: inverse correlation between peptide affinity for MHC class I and T-cell precursor frequency. Viral Immunol. 14:135-149. [PubMed]
37. Reimann, K. A., J. T. Li, R. Veazey, M. Halloran, I. W. Park, G. B. Karlsson, J. Sodroski, and N. L. Letvin. 1996. A chimeric simian/human immunodeficiency virus expressing a primary patient human immunodeficiency virus type 1 isolate env causes an AIDS-like disease after in vivo passage in rhesus monkeys. J. Virol. 70:6922-6928. [PMC free article] [PubMed]
38. Reimann, K. A., J. T. Li, G. Voss, C. Lekutis, K. Tenner-Racz, P. Racz, W. Lin, D. C. Montefiori, D. E. Lee-Parritz, Y. Lu, R. G. Collman, J. Sodroski, and N. L. Letvin. 1996. An env gene derived from a primary human immunodeficiency virus type 1 isolate confers high in vivo replicative capacity to a chimeric simian/human immunodeficiency virus in rhesus monkeys. J. Virol. 70:3198-3206. [PMC free article] [PubMed]
39. Reimann, K. A., A. Watson, P. J. Dailey, W. Lin, C. I. Lord, T. D. Steenbeke, R. A. Parker, M. K. Axthelm, and G. B. Karlsson. 1999. Viral burden and disease progression in rhesus monkeys infected with chimeric simian-human immunodeficiency viruses. Virology 256:15-21. [PubMed]
40. Roy-Proulx, G., M. C. Meunier, A. M. Lanteigne, S. Brochu, and C. Perreault. 2001. Immunodomination results from functional differences between competing CTL. Eur. J. Immunol. 31:2284-2292. [PubMed]
41. Schmitz, J. E., M. J. Kuroda, S. Santra, V. G. Sasseville, M. A. Simon, M. A. Lifton, P. Racz, K. Tenner-Racz, M. Dalesandro, B. J. Scallon, J. Ghrayeb, M. A. Forman, D. C. Montefiori, E. P. Rieber, N. L. Letvin, and K. A. Reimann. 1999. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science 283:857-860. [PubMed]
42. Seaman, M. S., L. Xu, K. Beaudry, K. L. Martin, M. H. Beddall, A. Miura, A. Sambor, B. K. Chakrabarti, Y. Huang, R. Bailer, R. A. Koup, J. R. Mascola, G. J. Nabel, and N. L. Letvin. 2005. Multiclade human immunodeficiency virus type 1 envelope immunogens elicit broad cellular and humoral immunity in rhesus monkeys. J. Virol. 79:2956-2963. [PMC free article] [PubMed]
43. Selin, L. K., M. Y. Lin, K. A. Kraemer, D. M. Pardoll, J. P. Schneck, S. M. Varga, P. A. Santolucito, A. K. Pinto, and R. M. Welsh. 1999. Attrition of T cell memory: selective loss of LCMV epitope-specific memory CD8 T cells following infections with heterologous viruses. Immunity 11:733-742. [PubMed]
44. Sen, P., W. A. Charini, R. A. Subbramanian, E. R. Manuel, M. J. Kuroda, P. A. Autissier, and N. L. Letvin. 2008. Clonal focusing of epitope-specific CD8+ T lymphocytes in rhesus monkeys following vaccination and simian-human immunodeficiency virus challenge. J. Virol. 82:805-816. [PMC free article] [PubMed]
45. Sette, A., A. Vitiello, B. Reherman, P. Fowler, R. Nayersina, W. M. Kast, C. J. Melief, C. Oseroff, L. Yuan, J. Ruppert, J. Sidney, M. F. del Guercio, S. Southwood, R. T. Kubo, R. W. Chesnut, H. M. Grey, and F. V. Chisari. 1994. The relationship between class I binding affinity and immunogenicity of potential cytotoxic T cell epitopes. J. Immunol. 153:5586-5592. [PubMed]
46. Sykulev, Y., A. Brunmark, M. Jackson, R. J. Cohen, P. A. Peterson, and H. N. Eisen. 1994. Kinetics and affinity of reactions between an antigen-specific T cell receptor and peptide-MHC complexes. Immunity 1:15-22. [PubMed]
47. Urvater, J. A., N. Otting, J. H. Loehrke, R. Rudersdorf, I. I. Slukvin, M. S. Piekarczyk, T. G. Golos, A. L. Hughes, R. E. Bontrop, and D. I. Watkins. 2000. Mamu-I: a novel primate MHC class I B-related locus with unusually low variability. J. Immunol. 164:1386-1398. [PubMed]
48. van der Most, R. G., L. E. Harrington, V. Giuggio, P. L. Mahar, and R. Ahmed. 2002. Yellow fever virus 17D envelope and NS3 proteins are major targets of the antiviral T cell response in mice. Virology 296:117-124. [PubMed]
49. von Herrath, M. G., J. Dockter, M. Nerenberg, J. E. Gairin, and M. B. Oldstone. 1994. Thymic selection and adaptability of cytotoxic T lymphocyte responses in transgenic mice expressing a viral protein in the thymus. J. Exp. Med. 180:1901-1910. [PMC free article] [PubMed]
50. Weidt, G., O. Utermohlen, J. Heukeshoven, F. Lehmann-Grube, and W. Deppert. 1998. Relationship among immunodominance of single CD8+ T cell epitopes, virus load, and kinetics of primary antiviral CTL response. J. Immunol. 160:2923-2931. [PubMed]
51. Yeh, W. W., E. M. Cale, P. Jaru-Ampornpan, C. I. Lord, F. W. Peyerl, and N. L. Letvin. 2006. Compensatory substitutions restore normal core assembly in simian immunodeficiency virus isolates with Gag epitope cytotoxic T-lymphocyte escape mutations. J. Virol. 80:8168-8177. [PMC free article] [PubMed]
52. Yewdell, J. W., and J. R. Bennink. 1999. Immunodominance in major histocompatibility complex class I-restricted T lymphocyte responses. Annu. Rev. Immunol. 17:51-88. [PubMed]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)