PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of iaiPermissionsJournals.ASM.orgJournalIAI ArticleJournal InfoAuthorsReviewers
 
Infect Immun. Oct 2009; 77(10): 4529–4537.
Published online Jul 20, 2009. doi:  10.1128/IAI.00563-09
PMCID: PMC2747953
Nod1/Nod2-Mediated Recognition Plays a Critical Role in Induction of Adaptive Immunity to Anthrax after Aerosol Exposure[down-pointing small open triangle]
Crystal L. Loving,1 Manuel Osorio,2 Yun-Gi Kim,3 Gabriel Nuñez,3 Molly A. Hughes,4 and Tod J. Merkel1*
Laboratory of Respiratory and Special Pathogens,1 Laboratory of Enteric and Sexually Transmitted Diseases, Division of Bacterial, Parasitic and Allergenic Products, CBER, FDA, Bethesda, Maryland,2 Department of Pathology and Comprehensive Cancer Center, University of Michigan Medical School, Ann Arbor, Michigan,3 Division of Infectious Diseases, Department of Internal Medicine, University of Virginia Health Sciences System, Charlottesville, Virginia4
*Corresponding author. Mailing address: Building 29, Room 418, 29 Lincoln Drive, Bethesda, MD 20892. Phone: (301) 496-5564. Fax: (301) 402-2776. E-mail: tod.merkel/at/fda.hhs.gov
Present address: Respiratory Diseases of Livestock Research Unit, USDA/ARS/NADC, 2300 Dayton Avenue B13, Ames, IA 50010.
Received May 20, 2009; Revised June 10, 2009; Accepted July 10, 2009.
Toll-like receptors and Nod-like receptors (NLR) play an important role in sensing invading microorganisms for pathogen clearance and eliciting adaptive immunity for protection against rechallenge. Nod1 and Nod2, members of the NLR family, are capable of detecting bacterial peptidoglycan motifs in the host cytosol for triggering proinflammatory cytokine production. In the current study, we sought to determine if Nod1/Nod2 are involved in sensing Bacillus anthracis infection and eliciting protective immune responses. Using mice deficient in both Nod1 and Nod2 proteins, we showed that Nod1/Nod2 are involved in detecting B. anthracis for production of tumor necrosis factor alpha, interleukin-1α (IL-1α), IL-1β, CCL5, IL-6, and KC. Proinflammatory responses were higher when cells were exposed to viable spores than when they were exposed to irradiated spores, indicating that recognition of vegetative bacilli through Nod1/Nod2 is significant. We also identify a critical role for Nod1/Nod2 in priming responses after B. anthracis aerosol exposure, as mice deficient in Nod1/Nod2 were impaired in their ability to mount an anamnestic antibody response and were more susceptible to secondary lethal challenge than wild-type mice.
Mammalian innate immune receptors, such as Toll-like receptors (TLRs) and Nod-like receptors (NLRs), recognize pathogen-associated molecular patterns conserved among various pathogens. Sensing of microbial components by TLRs and NLRs initiates multiple proinflammatory pathways for controlling infection and initiating antigen-specific immune responses (14). TLRs are expressed on the host cell surface and endosomal compartment, whereas NLRs are expressed in the host cytosol. Two described NLRs, Nod1 and Nod2, initiate NF-κB and mitogen-activated protein kinase signaling upon sensing molecules produced during the synthesis and degradation of bacterial peptidoglycan. Nod1 recognizes a dipeptide, γ-d-glutamyl-meso-diaminopimelic acid, produced by most gram-negative bacteria (6, 16, 17) and some gram-positive bacteria, including several Bacillus species (22). Nod2 senses the peptidoglycan motif muramyl dipeptide (MDP), which is present in nearly all gram-negative and gram-positive bacteria (17, 26). Peptidoglycan is also recognized by cell surface-expressed TLR2 (20, 51). Recent studies, using mostly in vitro techniques, have implicated Nod1 and/or Nod2 as an innate receptor for a variety of bacterial species (13, 28). For example, Listeria monocytogenes, an intracellular bacterial pathogen, is sensed by both Nod1 and Nod2 (22, 29, 44).
The prominent role of Nod proteins in innate immunity has been known for some time, but recent work indicates a role for Nod proteins in polarizing adaptive immune responses as well. Thus, innate immune recognition by Nod proteins is important for controlling early pathogen replication and spread, in addition to eliciting and polarizing adaptive immunity (52). Recent work has shown that recognition of MDP via Nod2 or of peptidoglycan via Nod1 (bacterially derived constituents) results in a Th2 polarization of the adaptive immune response (15, 36). However, there are few studies investigating the involvement of Nod proteins in polarizing adaptive responses and subsequent protection in microbial infection (15).
Bacillus anthracis is a gram-positive, spore-forming bacterium and the etiologic agent of anthrax. Spores are the primary infectious agent, germinating into vegetative bacilli in favorable environments (39). The most deadly form of the disease, inhalational anthrax, occurs after spores are inhaled into the lungs (2). Spores in the alveolar space are taken up by pulmonary phagocytes, such as macrophages and dendritic cells (DC) (4, 8, 19, 50). Once inside the cell, spores germinate, and unless controlled by cell defenses, bacilli escape the endosome and bacterial replication occurs in the cytosol (9, 24, 27). Thus, cytosolic sensing of vegetative B. anthracis is likely the first point in the infection at which bacilli can be detected by the host. Bacilli eventually escape the host cell and replicate extracellularly, exposing bacterial motifs sensed by surface-expressed TLRs (25).
After the anthrax mail attacks in the fall of 2001, emphasis has been placed on understanding B. anthracis pathogenesis for development of therapeutics and vaccines. B. anthracis produces two toxins, lethal toxin, a combination of protective antigen (PA) with lethal factor (LF), and edema toxin, a combination of PA with edema factor (EF) (58). PA is named for its ability to elicit protective immunity to anthrax infection, and PA is the primary component of the current U.S. licensed vaccine (anthrax vaccine absorbed) (3). The toxin complex, a combination of PA and LF/EF, inserts into the host phagosome membrane, and LF or EF is translocated into the cytoplasm of the host cell (58). LF is a zinc-dependent metalloprotease capable of cleaving host cell mitogen-activated protein kinase kinases in the cell cytosol (10, 54). EF is an adenylate cyclase that increases intracellular concentrations of cyclic AMP, which also disrupts host cell responses (23, 31, 53).
The current study was aimed at understanding host immune activation after spore exposure and identifying the role of Nod1/Nod2 in sensing and responding to B. anthracis. Using in vitro techniques, we show that irradiated spores do not induce a strong proinflammatory response by macrophages or lung cells, but instead, viable spores are required for optimal production of various cytokines and chemokines. Likewise, Nod1/Nod2 was required for optimal production of interleukin-12 p70 (IL-12p70) after exposure to viable spores. Taking the results together, we identify Nod1/Nod2 as intracellular receptors of germinating spores for cytokine responses. In the context of in vivo spore exposure, our results indicate that Nod1/Nod2 are important in priming responses after aerosol B. anthracis spore exposure, as mice deficient in Nod1/Nod2 exhibited impaired expansion of T cells in the draining lymph nodes (LNs), impaired anamnestic antibody responses, and enhanced susceptibility to lethal rechallenge.
Mice.
C57BL/6 and A/J mice were purchased from The Jackson Laboratory. TLR2 knockout (KO) mice and Nod1/Nod2 KO mice in the C57BL6/J background have been described previously (25, 43). B. anthracis aerosol challenges and spore preparations were completed as previously described (34). Briefly, mice were exposed to aerosolized spores for 70 min using a nose-only exposure system (CH Technologies, Westwood, NJ), with fresh air supplied for 8 min before and after the spore challenge. The spore inoculum for each challenge contained 12 ml of 5 × 109 spores/ml in distilled water with 0.01% Tween 80. The 70-min challenge results in approximately 2 × 106 to 4 × 106 spores being retained in the lung, which is approximately 10 times the 50% lethal dose calculated for strain 7702 (34). Generation and purification of B. anthracis Sterne spores (strain 7702) were carried out as previously described (12, 48). For intraperitoneal (i.p.) challenge, mice were given 1 × 109 spores in 100 μl. All mice were housed at the Center for Biologics Evaluation and Research under the approval of the Institutional Animal Care and Use Committee.
In vitro studies.
J774A.1 macrophage stimulation with B. anthracis was performed as previously described with minor modifications (47). Briefly, J774A.1 macrophages were seeded into 96-well flat-bottom plates and left untreated or treated with 3 μg cytochalasin D (CytD) for 45 min. Cells were subsequently infected with Sterne spores at a multiplicity of infection of 50 in antibiotic-free medium for 1 h. The medium was removed, and cells were incubated for 1 h with 200 μl of medium containing 30 μg/ml of gentamicin to kill any extracellular bacteria. Gentamicin-containing medium was removed and replaced with antibiotic-free medium, and this was considered time zero. At 0, 2.5, 5, 7.5, and 10 h, supernatant was removed and stored at −80°C. Cells were washed once and lysed, and the lysate was serially diluted and plated to determine intracellular bacteria levels.
Total adherent pulmonary cells were collected from healthy mice for in vitro stimulation as follows. Total lung cells were isolated using previously published methods (30). Briefly, mice were humanely euthanized using avertin and subsequently exsanguinated. The descending aorta was severed, and the pulmonary vasculature was flushed with sterile phosphate-buffered saline (PBS) with 0.5 mM EDTA to remove peripheral blood from the lungs. The lungs were removed from the body and the lobes detached from the bronchi and trachea. The lungs were cut into small pieces and incubated with liberase blenzyme 3 (0.3 U/ml) (Roche, Indianapolis, IN) and DNase I (50 μg/ml) (Sigma, St. Louis, MO) in 6 ml of PBS for 1 h at 37°C in an orbital shaker. Released cells were collected by running the homogenate solution over a 45-μm filter. Fetal bovine serum (FBS) was added to a final concentration of 20%, and the cells were centrifuged at 400 × g for 15 min. Cells were washed once with RPMI 1640 (Invitrogen, Carlsbad, CA) with 10% FBS. Cells were subsequently counted and plated at 2 × 106 cells per well in a 48-well flat-bottom plate. Cells were plated for 1 h at 37°C. For in vitro stimulation, nonadherent cells were washed away and 2 × 106 Sterne strain spores (irradiated or viable) were added in medium without antibiotics. After 45 min, the medium was removed, cells were washed once, and cell culture medium with 10 μg/ml of gentamicin was added; this was considered time zero. For flow cytometric analysis, cells were collected after the 1-h adherence step described above or cultured for 24 h before being collected as follows. Cell culture plates were put on ice for 10 min to aid in cell release from the plate. A pipette tip was used to gently scrape any remaining adherent cells from the bottom of the plate. Cells were collected, washed once with PBS plus 10% FBS, and subsequently stained with antibodies for phenotyping.
BMDMs.
Bone marrow-derived macrophages (BMDMs) were prepared as previously described (5). Briefly, bone marrow cells were cultured for 5 days with Dulbecco's modified Eagle medium supplemented with 30% L929 supernatant containing macrophage-stimulating factor, nonessential amino acids, 10% heat-inactivated FBS (Invitrogen Life Technologies), and antibiotics. The cells were stimulated with 10 ng/ml lipopolysaccharide (LPS) in the presence or absence of 10 μg/ml MDP for 24 h. Ultrapure LPS was from Escherichia coli O55:B5 (Invivogen), and synthetic MDP was from Bachem.
Flow cytometric analysis.
The following antibodies were used for phenotypic analysis: anti-CD11b-allophycocyanin (clone M1/70), anti-CD11c-phycoerythrin (clone HL3), anti-CD8-Alexa 647 (clone 53-6.7), and anti-CD4-biotin (clone GK1.5) (BD Biosciences). Streptavidin-fluorescein isothiocyanate was used in conjunction with biotinylated antibody. Data were acquired using FACS Diva software (BD Biosciences) on an LSR II flow cytometer (Becton Dickinson) and analyzed using FlowJo software (TreeStar, Ashland, OR).
Real-time PCR.
SYBR green-based real-time PCR was carried out for various mRNA targets according to the manufacturer's recommendations (SYBR green master mix; Applied Biosystems, Foster City, CA). The amount of mRNA was calculated using the 2−ΔΔCT method as previously described (33). The sequences of the PCR primers (5′ to 3′) were as follows: IL-1α-Forward, GCCATTGACCATCTCTCTCTGAATC; IL-1α-Reverse, GGTGAAGTTGGACATCTTTGACG; KC-Forward, GGCTGGGATTCACCTCAAGAAC; KC-Reverse, TGGCTATGACTTCGGTTTGGG; CCL5-Forward, GTGCCAACCCAGAGAAGAAGTG; and CCL5-Reverse, AGAGCAAGCGATGACAGGGAAG. Primers for IL-1β, IL-6, and β-actin were previously described (40, 41).
Cytokine measurement.
Levels of tumor necrosis factor alpha (TNF-α) (Biosource), IL-6, IL-10, and IL-12p70 (R&D Systems) in cell culture supernatants were measured by enzyme-linked immunosorbent assay (ELISA) run according to the recommendations of the kit manufacturers.
Serum antibody titers.
Titers of anti-PA immunoglobulin G (IgG) were determined by ELISA as previously described (35). Samples were assayed in triplicate, and the end point antibody titers were expressed as the maximum dilution giving an absorbance (at 405 nm) of greater than 0.2. The results are presented as the reciprocal of the dilution multiplied by the absorbance value.
Statistical analysis.
GraphPad Prism software (version 4.00; GraphPad Software, San Diego, CA) was used for all statistical analysis. A log rank test was used to analyze differences in survival after aerosol and i.p. challenge. A Student t test was used for analysis of real-time PCR, cytokine ELISA, and cell population data. A one-way analysis of variance and Tukey's multiple-comparison test were used for analyzing antibody titer data.
Cytokine secretion by J774A.1 macrophages after exposure to Sterne strain B. anthracis spores.
In order to determine if spore uptake and germination are required for stimulation of early cytokine production by phagocytic cells, an assay utilizing J774A.1 macrophages was used. Cells were exposed to viable spores for 1 h to allow for phagocytic uptake before washing away extracellular spores. Cells were harvested for enumeration of intracellular bacteria to identify the time during which the number of intracellular bacteria increased. Supernatant collected from cells was assayed for TNF-α levels. The results indicate that intracellular levels of bacteria increased between 5 and 7.5 h (Fig. (Fig.1A),1A), indicating germination and an increase of intracellular vegetative cells. However, by 10 h, the number of intracellular bacteria decreased, indicating that bacteria had released from the cells. At 7.5 h after spore exposure, TNF-α levels were elevated in the supernatant, indicating that intracellular recognition of germinating spores likely occurred (Fig. (Fig.1B).1B). If irradiated spores were used, TNF-α levels remained low, indicating that germination was important for pathogen recognition and TNF-α production (Fig. (Fig.1B).1B). Cells were also exposed to CytD, an inhibitor of phagocytosis, to determine if spore uptake was required for TNF-α production. In cells treated with CytD, TNF-α production following exposure to both viable and irradiated spores was low, indicating that phagocytic uptake of spores was required for increased production of TNF-α (Fig. (Fig.1B1B).
FIG. 1.
FIG. 1.
TNF-α secretion by J774A.1 macrophages after exposure to B. anthracis spores. (A) J774A.1 macrophages were untreated (circles) or treated with 3 μg CytD (squares) for 45 min and subsequently exposed to Sterne spores as described in Materials (more ...)
Nod proteins are involved in recognition of live B. anthracis for induction of proinflammatory mediators.
Nod1 and Nod2 proteins are expressed in the cell cytosol and serve as host pattern recognition receptors for peptidoglycan substructures of bacteria, including B. anthracis (17). B. anthracis has been shown to replicate in the host cytosol, where Nod1 and Nod2 are expressed (9). The data in Fig. Fig.11 provided evidence that intracellular recognition of bacilli resulted in increased TNF-α production, indicating involvement of an intracellular pattern recognition receptor in sensing B. anthracis infection. To determine if host Nod1/Nod2 are involved in recognition of B. anthracis after spore infection, pulmonary cells from wild-type (WT) and Nod1/Nod2 KO mice were exposed to viable and irradiated Sterne strain spores. The response of pulmonary cells was examined because they are likely to be one of the first cell types to engulf B. anthracis spores during inhalational infection. The pulmonary cells used for this study are described as a mixture of interstitial macrophages, alveolar macrophages (AMac), and DC based on CD11c and CD11b expression, as previously described (7). The phenotype of the adherent population of pulmonary cells changed between 1 h and 24 h of culture (Fig. (Fig.2).2). Thus, we decided to use the total adherent population for these studies instead of sorting a single antigen-presenting cell from the mixture.
FIG. 2.
FIG. 2.
Characterization of pulmonary adherent cells. Pulmonary adherent cells were collected from BL/6 and Nod1/Nod 2 KO mice as described in Materials and Methods and subsequently stained for CD11b and CD11c markers. Three lung cell populations, i.e., interstitial (more ...)
After stimulation of pulmonary cells with viable spores, TNF-α levels, measured by ELISA, were significantly higher in WT pulmonary cells than in Nod1/Nod2 KO cells (Fig. (Fig.3A).3A). In addition to enhanced TNF-α cytokine production, levels of IL-1α, IL-1β, CCL5, IL-6, and KC mRNAs were significantly higher in WT cells than in cells from Nod1/Nod2 KO mice 8 h after spore stimulation (Fig. (Fig.3B).3B). IL-6 and KC mRNA levels did not increase as much as IL-1α, IL-1β, and CCL5 levels, though all cytokines tested were affected by the lack of Nod1/Nod2 (Fig. (Fig.3B).3B). IL-6 and KC mRNA levels in WT cells stimulated with viable spores were only about twofold higher than levels in Nod1/Nod2 cells. However, mRNA levels of CCL5 were approximately threefold greater and those of IL-1α and IL-1β were nearly fourfold greater in WT than in Nod1/Nod2 KO cells. Spores that were able to germinate induced significantly higher levels of proinflammatory mediators compared to after stimulation with irradiated spores, indicating that vegetative bacilli contribute significantly to stimulation through Nod1/Nod2. In order to eliminate the possibility that Nod1/Nod2 KO cells were generally deficient in their ability to produce cytokines, BMDMs were tested for their ability to respond to LPS. Recognition of LPS is mediated by TLR4 and is independent of Nod1 or Nod2. The response of BMDMs to LPS from Nod1/Nod2 KO mice was indistinguishable from the response of BL/6 BMDMs as measured by IL-6 and TNF-α production (Fig. (Fig.4).4). As expected, MDP-induced cytokine responses in BMDMs costimulated with LPS were abrogated in Nod1/Nod2-deficient cells (Fig. (Fig.4),4), which was used an internal control.
FIG. 3.
FIG. 3.
Nod1/Nod2 proteins are involved in recognition of live B. anthracis for induction of proinflammatory mediators. Pulmonary cells from WT BL/6 and Nod1/Nod2 KO mice were collected and exposed to medium alone (C), irradiated Sterne strain spores (I-Ba), (more ...)
FIG. 4.
FIG. 4.
BMDMs from WT and Nod1/Nod2 KO mice were stimulated with 10 ng/ml LPS in the presence or absence of 10 μg/ml MDP for 24 h. Cell-free supernatants were analyzed by ELISA for production of IL-6 (A) and TNF-α (B). ** and *** (more ...)
Nod1/Nod2 plays a significant role in induction of protective immunity after primary aerosol exposure to B. anthracis.
Our laboratory utilizes a murine aerosol challenge model to investigate B. anthracis pathogenesis (34). Previous work utilizing this model has shown an important role for MyD88-mediated events in survival after aerosol challenge, though TLR2, which recognizes extracellular peptidoglycan, was not required (25). To determine if Nod1/Nod2 is essential for survival after aerosol challenge, groups of Nod1/Nod2 KO mice were exposed to aerosols of Sterne strain B. anthracis spores. Nod1/Nod2 KO mice survived primary aerosol challenge, as did WT BL/6 mice (Fig. (Fig.5A).5A). A/J mice, which are susceptible to aerosol challenge due to a C5 deficiency, were used as a control of the challenge (21, 55, 56). As all of the Nod1/Nod2 KO mice survived primary challenge, we were able to investigate the contribution of these pathogen recognition receptors to induction of protective immunity. Thirty days after primary aerosol challenge, mice were rechallenged with a lethal dose of Sterne strain spores by the i.p. route. Figure Figure5B5B indicates that 83% of convalescent BL/6 KO mice survived rechallenge but only 47% of convalescent Nod1/Nod2 KO mice survived. Thus, even with the expression of all TLRs in Nod1/Nod2 KO mice, recognition through Nod1/Nod2 was required for optimal induction of adaptive immunity for subsequent protection. There was no significant difference in the susceptibilities of naïve BL/6 and naïve Nod1/Nod2 KO mice to the i.p. challenge (Fig. (Fig.5B5B).
FIG. 5.
FIG. 5.
Nod1/Nod2 plays a significant role in induction of protective immunity after primary aerosol exposure to B. anthracis. (A) BL/6, TLR2 KO, Nod1/Nod2 KO, and A/J mice were exposed to aerosolized spores and survival followed for 10 days. (B) BL/6, TLR2 KO, (more ...)
Antibody titers to PA have been described as a correlate of protection after anthrax vaccination (32, 49). To determine if anti-PA IgG titers correlated to susceptibility exhibited by Nod1/Nod2 KO mice after rechallenge, serum antibody titers were measured at 14 and 28 days after primary aerosol challenge. Figure Figure5C5C indicates that anti-PA IgG titers differed significantly between BL/6 and Nod1/Nod2 KO mice at 14 days after exposure. At 28 days after primary exposure there was a wide range in anti-PA IgG titers among mice of the same strain, and individual mice deficient in Nod1/Nod2 had titers as high as those in WT BL/6 mice, even 14 days after aerosol challenge (Fig. (Fig.5C).5C). In order to assess the ability of Nod1/Nod2 mice to mount an anamnestic response following reexposure to anthrax, an additional experiment was performed to measure anti-PA IgG titers in BL/6 and Nod1/Nod2 KO mice after primary and secondary exposure to B. anthracis. First, mice were exposed to aerosols of Sterne strain B. anthracis spores and anti-PA IgG titers measured 28 days later. Thirty days after primary aerosol challenge, mice were rechallenged with a lethal dose of Sterne strain spores by the i.p. route. Serum antibody titers were measured on days 2 and 4 after secondary challenge (Fig. (Fig.6).6). Following secondary challenge, antibody titers rose significantly relative to prechallenge (day 28) titers in BL/6 mice but did not appear to rise in Nod1/Nod2 KO mice (Fig. (Fig.6).6). Although the antibody titers in the Nod1/Nod2 mice surviving at day 4 postchallenge were not higher than the titers seen in the same mice at day 28, there were not enough survivors to make a statistically significant comparison.
FIG. 6.
FIG. 6.
Nod1/Nod2 plays a significant role in induction of anamnestic immunity after primary aerosol exposure to B. anthracis. BL/6 and Nod1/Nod2 KO mice were exposed to aerosolized spores. Mice that survived aerosol challenge were rechallenged with a lethal (more ...)
Impaired expansion of lymphocytes in draining LNs of Nod1/Nod2 KO mice after aerosol anthrax challenge.
We examined changes in lymphocyte numbers in draining cervical LNs of WT BL/6 and Nod1/Nod2 KO mice to begin identifying a potential mechanism for the deficient adaptive immune response in Nod1/Nod2 KO mice. WT BL/6 and Nod1/Nod2 KO mice were exposed to aerosols of B. anthracis Sterne strain and cervical LNs collected 7 days later for examining total LN numbers as well as CD4+ and CD8+ T-cell numbers. The percentage of CD4+ cells was not significantly different between mouse strains, whereas Nod1/Nod2 KO mice had a higher percentage of CD8+ T cells than WT BL/6 mice (Fig. (Fig.7).7). This difference was also observed in noninfected mice, indicating a baseline difference in the percentage of CD8+ cells in the cervical LNs of Nod1/Nod2 KO mice. Overall, following aerosol challenge Nod1/Nod2 KO mice had significantly fewer LN cells than WT BL/6 mice, indicating an aberrant activation of the immune response. This could be due to decreased proliferation of antigen-specific cells in the draining LNs, as well as decreased infiltration of other immune cells.
FIG. 7.
FIG. 7.
Impaired expansion of lymphocytes in draining LNs of Nod1/Nod2 KO mice after aerosol challenge with Sterne strain B. anthracis. Seven days after primary aerosol challenge, cervical LNs were collected from mice and assessed for total LN cell numbers. Values (more ...)
Impaired IL-12p70 production by pulmonary cells following exposure to B. anthracis spores.
Antigen-presenting cell activation, through recognition of pathogen-associated molecular patterns, is involved in initiation of the adaptive immune response. IL-12p70 and IL-10 play roles in the adaptive immune response, promoting either a Th1 or a Th2 response, respectively. To further investigate the role of Nod1/Nod2 recognition of B. anthracis and its subsequent role in the adaptive immune response, we examined the production of IL-12p70 and IL-10 from pulmonary cells after spore exposure. The data presented in Fig. Fig.88 indicate that cells from Nod1/Nod2 KO mice produced less IL-12p70 following spore exposure than cells from WT BL/6 mice. The lack of IL-12p70 produced by pulmonary antigen-presenting cells following spore exposure may be involved in the decreased expansion of T-cell populations in the draining LNs observed after in vivo spore challenge (Fig. (Fig.77).
FIG. 8.
FIG. 8.
Nod1/Nod2 recognition of spores by pulmonary cells is required for optimal IL-12p70 production. Pulmonary cells from WT BL/6 and Nod1/2 KO mice were collected and exposed to medium alone (C), irradiated Sterne strain spores (I-Ba), or viable Sterne strain (more ...)
The current study demonstrates an important role for Nod1/Nod2 recognition of B. anthracis for induction of both innate and adaptive immune responses. We show that Nod1/Nod2 was involved in detection of B. anthracis after spore infection for the production of proinflammatory mediators, such as IL-1 and CCL5 (Fig. (Fig.3),3), as well as IL-12p70 (Fig. (Fig.8).8). In addition, Nod1/Nod2 was required for optimal induction of protective immunity after aerosol exposure (Fig. (Fig.5).5). Overall, our results illustrate the involvement of Nod1/Nod2 in activation of the immune responses to anthrax infection.
Nod1 and Nod2 are cytosolic host proteins involved in recognition of peptidoglycan substructures of bacteria, including Bacillus (17). B. anthracis has been shown to replicate in the host cytosol, where Nod1 and Nod2 proteins are expressed (9). After aerosol exposure, B. anthracis spores are taken up by phagocytes in the lung, which become the first defenders against anthrax infection (4, 8, 19, 50). The results obtained in the current study show that macrophages and pulmonary cells responded to spore exposure with the production of proinflammatory cytokines, and responses were significantly reduced in Nod1/Nod2-deficient cells (Fig. (Fig.3).3). The percentage of AMac in Nod1/Nod2 KO mice is lower in 1-h pulmonary adherent cells than in BL/6 mice; however, the total percentage of phagocytes (interstitial macrophages, DC, and AMac) is not significantly different between WT and KO mice. As phagocytic cells other than AMac have been shown to phagocytose spores, it is likely that all cultured phagocytes produced cytokines in response to spore infection. Thus, the difference in the percentage of AMac between WT and Nod1/Nod2 KO mice was unlikely to affect the observed cellular responses. In addition, after 24 h of culture, there was no significant difference in the phenotype of the pulmonary adherent cells (Fig. (Fig.2B).2B). The differences between the phenotypes observed at 1 h and 24 h is likely due to the proteolytic cleavage of surface proteins during the lung dissociation step.
Spores that were able to germinate induced significantly higher levels of proinflammatory mediators than after stimulation with irradiated spores, indicating that vegetative bacilli contribute significantly to stimulation through Nod1/Nod2. This was also observed with the production of IL-12p70, a cytokine involved in adaptive immune responses (Fig. (Fig.8).8). Using a different system, it was previously shown that inactivated spores induce NF-κB activation dependent on Nod1/Nod2, although the relevance of these findings was not explored (18). Though spore antigens may be able to induce activation through Nod1/Nod2, our results indicate that intracellular vegetative bacilli induce much higher levels of proinflammatory mediators than inactivated spores (Fig. (Fig.11 and and3).3). The studies presented here were performed using a nonencapsulated, toxigenic strain, though it is unlikely that the spore coat differs significantly from that of the fully virulent strains of B. anthracis. As Nod1/Nod2 recognize peptidoglycan motifs on the surface of B. anthracis, it is possible that the capsule shields these motifs from recognition by host innate receptors. Future work using an encapsulated strain with in vitro assays is aimed at addressing this issue.
Previous work has implicated anthrax toxins in subverting host immune responses. The majority of these studies have been done using purified toxins with in vitro assays (1, 11, 42, 45, 46). In the current study, in vivo challenges were performed with a toxigenic strain of B. anthracis. In these experiments WT BL/6 mice were able to mount a protective immune response, but Nod1/Nod2 KO mice were not. This indicates the important contribution of Nod1/Nod2 signaling during the course of infection to the induction of protective immune responses, even in the face of toxin expression. TLR2 expression was not required during priming responses, as TLR2 KO mice were not susceptible to secondary lethal challenge.
It has previously been shown that murine macrophages produce CCL5 in response to Nod1/Nod2 agonists (57), and in our studies, CCL5 was one of several cytokines affected by the loss of Nod1/Nod2 in response to B. anthracis spore exposure (Fig. (Fig.3).3). CCL5 is involved in recruitment of immune cells, aside from neutrophils, to sites of infection (37, 57). Although we examined responses of lung antigen-presenting cells to spore exposure, during inhalational anthrax infection it is likely that proinflammatory cytokine secretion occurs primarily in draining LNs, as phagocytes migrate to the draining LNs after uptake and recognition of B. anthracis spores (4, 8). Vegetative bacilli are found in the draining LNs, but not the lungs, early after aerosol spore exposure, and TNF-α levels in draining LNs of infected mice are significantly higher than lung TNF-α levels (34). Further evidence supporting the unlikelihood of chemokine secretion in the lungs is provided by the lack of inflammation and cell infiltration into the lungs of moribund animals suffering from inhalational anthrax (34).
To date, few data are available on the mechanistic involvement of Nod1/Nod2 in induction of adaptive immunity. Previous work by Fritz et al. has shown altered levels of antigen-specific Ig production in Nod1 KO mice after ovalbumin immunization as well as Helicobacter pylori infection (15). Our results indicate an impaired induction of antibody responses following pulmonary infection with B. anthracis in Nod1/Nod2 KO mice. The susceptibility of Nod1/Nod2 KO mice to secondary challenge was likely due to a failure to mount a rapid anamnestic antibody response (Fig. (Fig.55 and and6).6). Cellular expansion in the draining LNs of Nod1/Nod2 KO mice was severely decreased after primary aerosol challenge (Fig. (Fig.7).7). This could be due to decreased proliferation of antigen-specific cells in the draining LN, as well as decreased infiltration of other immune cells. Proinflammatory cytokine levels after spore infection were significantly decreased in cells from Nod1/Nod2 KO mice, including the chemokines KC and CCL5 (Fig. (Fig.1,1, ,3,3, and and8).8). CCL5 expression, which can recruit macrophages, T cells, and immature DC to sites of infection, occurs after Nod1/Nod2 signaling (37, 57), and KC is involved in neutrophil recruitment. IL-12p70 induces the differentiation of CD4+ T cells into Th1 cells, and the deficiency of Nod1/Nod2 KO cells in producing IL-12p70 may be involved in the enhanced susceptibility of these mice to secondary challenge. Thus, the decrease in cell numbers in the draining LNs of Nod1/Nod2 KO mice may be attributed to decreased chemokine production and subsequent cell infiltration after aerosol exposure or to the decreased expansion of T cells during the primary stage of infection. Further work is warranted to determine if either of these defective responses is involved in the enhanced susceptibility of Nod1/Nod2 KO mice to secondary anthrax exposure. Additional approaches, such as adoptive transfer of cells, are required due to possible congenital defects in Nod1/Nod2 KO mice, namely, differences in the percentage of basal CD8+ T cells in the cervical LNs.
There is mounting evidence that innate immune recognition of invading pathogens instructs antigen-specific immunity, though the precise mechanisms by which this occurs have not been completely defined (38). Our results indicate that the susceptibility of Nod1/Nod2 KO mice to rechallenge appears to be due to inadequate activation of adaptive immune defenses after primary aerosol exposure. This is likely due to the impaired activation of the innate response, which typically triggers proper activation of the adaptive response. Future and ongoing work is directed toward identifying and characterizing the mechanisms by which Nod1/Nod2 recognition leads to induction of adaptive immune responses.
Acknowledgments
We thank Vanessa K. Kelly and Gloria M. Lee for technical assistance.
This work was supported by CBER/FDA-NIAID/NIH Interagency Agreement Y1-AI-6153-01, NIH RO1 grant DK61707, NIH R21 grant R21AI072469-01, and NIAID-NIH Middle Atlantic Regional Centers for Excellence grant U54 AI57168.
Notes
Editor: J. B. Bliska
Footnotes
[down-pointing small open triangle]Published ahead of print on 20 July 2009.
1. Agrawal, A., J. Lingappa, S. H. Leppla, S. Agrawal, A. Jabbar, C. Quinn, and B. Pulendran. 2003. Impairment of dendritic cells and adaptive immunity by anthrax lethal toxin. Nature 424:329-334. [PubMed]
2. Barnes, J. M. 1947. The development of anthrax following administration of spores by inhalation. Br. J. Exp. Pathol. 28:385-394.
3. Brachman, M. 1999. Winning the bug war. Occup. Health Safety 68:224-225. [PubMed]
4. Brittingham, K. C., G. Ruthel, R. G. Panchal, C. L. Fuller, W. J. Ribot, T. A. Hoover, H. A. Young, A. O. Anderson, and S. Bavari. 2005. Dendritic cells endocytose Bacillus anthracis spores: implications for anthrax pathogenesis. J. Immunol. 174:5545-5552. [PubMed]
5. Celada, A., P. W. Gray, E. Rinderknecht, and R. D. Schreiber. 1984. Evidence for a gamma-interferon receptor that regulates macrophage tumoricidal activity. J. Exp. Med. 160:55-74. [PMC free article] [PubMed]
6. Chamaillard, M., M. Hashimoto, Y. Horie, J. Masumoto, S. Qiu, L. Saab, Y. Ogura, A. Kawasaki, K. Fukase, S. Kusumoto, M. A. Valvano, S. J. Foster, T. W. Mak, G. Nunez, and N. Inohara. 2003. An essential role for NOD1 in host recognition of bacterial peptidoglycan containing diaminopimelic acid. Nat. Immunol. 4:702-707. [PubMed]
7. Cleret, A., A. Quesnel-Hellmann, J. Mathieu, D. Vidal, and J. N. Tournier. 2006. Resident CD11c+ lung cells are impaired by anthrax toxins after spore infection. J. Infect. Dis. 194:86-94. [PubMed]
8. Cleret, A., A. Quesnel-Hellmann, A. Vallon-Eberhard, B. Verrier, S. Jung, D. Vidal, J. Mathieu, and J. N. Tournier. 2007. Lung dendritic cells rapidly mediate anthrax spore entry through the pulmonary route. J. Immunol. 178:7994-8001. [PubMed]
9. Dixon, T. C., A. A. Fadl, T. M. Koehler, J. A. Swanson, and P. C. Hanna. 2000. Early Bacillus anthracis-macrophage interactions: intracellular survival survival and escape. Cell. Microbiol. 2:453-463. [PubMed]
10. Duesbery, N. S., C. P. Webb, S. Leppla, V. M. Gordon, K. R. Klimpel, T. D. Copeland, N. G. Ahn, M. K. Oskarsson, K. Fukasawa, K. D. Paull, and G. F. Vande Woude. 1998. Proteolytic inactivation of MAP-kinase-kinase by anthrax lethal factor. Science 280:734-737. [PubMed]
11. Fang, H., L. Xu, T. Y. Chen, J. M. Cyr, and D. M. Frucht. 2006. Anthrax lethal toxin has direct and potent inhibitory effects on B cell proliferation and immunoglobulin production. J. Immunol. 176:6155-6161. [PubMed]
12. Finlay, W. J. J., N. A. Logan, and A. D. Sutherland. 2002. Bacillus cereus emetic toxin production in cooked rice. Food Microbiol. 19:431-439.
13. Franchi, L., J. H. Park, M. H. Shaw, N. Marina-Garcia, G. Chen, Y. G. Kim, and G. Nunez. 2008. Intracellular NOD-like receptors in innate immunity, infection and disease. Cell Microbiol. 10:1-8. [PubMed]
14. Fritz, J. H., R. L. Ferrero, D. J. Philpott, and S. E. Girardin. 2006. Nod-like proteins in immunity, inflammation and disease. Nat. Immunol. 7:1250-1257. [PubMed]
15. Fritz, J. H., L. Le Bourhis, G. Sellge, J. G. Magalhaes, H. Fsihi, T. A. Kufer, C. Collins, J. Viala, R. L. Ferrero, S. E. Girardin, and D. J. Philpott. 2007. Nod1-mediated innate immune recognition of peptidoglycan contributes to the onset of adaptive immunity. Immunity 26:445-459. [PubMed]
16. Girardin, S. E., I. G. Boneca, L. A. M. Carneiro, A. Antignac, M. Jehanno, J. Viala, K. Tedin, M. K. Taha, A. Labigne, U. Zahringer, A. J. Coyle, J. Bertin, P. J. Sansonetti, and D. J. Philpott. 2003. Nod1 detects a unique muropeptide from Gram-negative bacterial peptidoglycan. Science 300:1584-1587. [PubMed]
17. Girardin, S. E., L. H. Travassos, M. Herve, D. Blanot, I. G. Boneca, D. J. Philpott, P. J. Sansonetti, and D. Mengin-Lecreulx. 2003. Peptidoglycan molecular requirements allowing detection by Nod1 and Nod2. J. Biol. Chem. 278:41702-41708. [PubMed]
18. Glomski, I. J., J. H. Fritz, S. J. Keppler, V. Balloy, M. Chignard, M. Mock, and P. L. Goossens. 2007. Murine splenocytes produce inflammatory cytokines in a MyD88-dependent response to Bacillus anthracis spores. Cell. Microbiol. 9:502-513. [PubMed]
19. Guidi-Rontani, C., M. Levy, H. Ohayon, and M. Mock. 2001. Fate of germinated Bacillus anthracis spores in primary murine macrophages. Mol. Microbiol. 42:931-938. [PubMed]
20. Gupta, D., T. N. Kirkland, S. Viriyakosol, and R. Dziarski. 1996. CD14 is a cell-activating receptor for bacterial peptidoglycan. J. Biol. Chem. 271:23310-23316. [PubMed]
21. Harvill, E. T., G. Lee, V. K. Grippe, and T. J. Merkel. 2005. Complement depletion renders C57BL/6 mice sensitive to the Bacillus anthracis Sterne strain. Infect. Immun. 73:4420-4422. [PMC free article] [PubMed]
22. Hasegawa, M., K. Yang, M. Hashimoto, J. H. Park, Y. G. Kim, Y. Fujimoto, G. Nunez, K. Fukase, and N. Inohara. 2006. Differential release and distribution of Nod1 and Nod2 immunostimulatory molecules among bacterial species and environments. J. Biol. Chem. 281:29054-29063. [PubMed]
23. Hoover, D. L., A. Friedlander, L. C. Rogers, I. K. Yoon, R. L. Warren, and A. S. Cross. 1994. Anthrax edema toxin differentially regulates lipopolysaccharide-induced monocyte production of tumor necrosis factor alpha and interleukin-6 by increasing intracellular cyclic AMP. Infect. Immun. 62:4432-4439. [PMC free article] [PubMed]
24. Hu, H., Q. Sa, T. M. Koehler, A. I. Aronson, and D. Zhou. 2006. Inactivation of Bacillus anthracis spores in murine primary macrophages. Cell. Microbiol. 8:1634-1642. [PubMed]
25. Hughes, M. A., C. S. Green, L. Lowchi, G. M. Lee, V. K. Grippe, M. F. Smith, L. Y. Huang, E. T. Harvill, and T. J. Merkel. 2005. MyD88-dependent signaling confers protection to Bacillus anthracis spore challenge in mice: implications for Toll-like receptor signaling. Infect. Immun. 73:7535-7540. [PMC free article] [PubMed]
26. Inohara, N., and G. Nunez. 2003. NODs: intracellular proteins involved in inflammation and apoptosis. Nat. Rev. Immunol. 3:371-382. [PubMed]
27. Kang, T. J., M. J. Fenton, M. A. Weiner, S. Hibbs, S. Basu, L. Baillie, and A. S. Cross. 2005. Murine macrophages kill the vegetative form of Bacillus anthracis. Infect. Immun. 73:7495-7501. [PMC free article] [PubMed]
28. Kanneganti, T. D., M. Lamkanfi, and G. Nunez. 2007. Intracellular NOD-like receptors in host defense and disease. Immunity 27:549-559. [PubMed]
29. Kobayashi, K. S., M. Chamaillard, Y. Ogura, O. Henegariu, N. Inohara, G. Nunez, and R. A. Flavell. 2005. Nod2-dependent regulation of innate and adaptive immunity in the intestinal tract. Science 307:731-734. [PubMed]
30. Legge, K. L., and T. J. Braciale. 2003. Accelerated migration of respiratory dendritic cells to the regional lymph nodes is limited to the early phase of pulmonary infection. Immunity 18:265-277. [PubMed]
31. Leppla, S. H. 1982. Anthrax toxin edema factor: a bacterial adenylate cyclase that increases cyclic AMP concentrations of eukaryotic cells. Proc. Natl. Acad. Sci. USA 79:3162-3166. [PubMed]
32. Little, S. F., B. E. Ivins, P. F. Fellows, M. L. M. Pitt, S. L. W. Norris, and G. P. Andrews. 2004. Defining a serological correlate of protection in rabbits for a recombinant anthrax vaccine. Vaccine 22:422-430. [PubMed]
33. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−delta delta C(T)) method. Methods 25:402-408. [PubMed]
34. Loving, C. L., M. Kennett, G. M. Lee, V. K. Grippe, and T. J. Merkel. 2007. Murine aerosol challenge model of anthrax. Infect. Immun. 75:2689-2698. [PMC free article] [PubMed]
35. Loving, C. L., T. Khurana, M. Osorio, G. M. Lee, V. K. Kelly, S. Stibitz, and T. J. Merkel. 2009. Role of anthrax toxins in dissemination, disease progression, and induction of protective adaptive immunity in the mouse aerosol challenge model. Infect. Immun. 77:255-265. [PMC free article] [PubMed]
36. Magalhaes, J. G., J. H. Fritz, L. Le Bourhis, G. Sellge, L. H. Travassos, T. Selvanantham, S. E. Girardin, J. L. Gommerman, and D. J. Philpott. 2008. Nod2-dependent Th2 polarization of antigen-specific immunity. J. Immunol. 181:7925-7935. [PubMed]
37. Mantovani, A., A. Sica, S. Sozzani, P. Allavena, A. Vecchi, and M. Locati. 2004. The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol. 25:677-686. [PubMed]
38. Medzhitov, R. 2007. Recognition of microorganisms and activation of the immune response. Nature 449:819-826. [PubMed]
39. Mock, M., and A. Fouet. 2001. Anthrax. Annu. Rev. Microbiol. 55:647-671. [PubMed]
40. O'Connor, J. C., A. Satpathy, M. E. Hartman, E. M. Horvath, K. W. Kelley, R. Dantzer, R. W. Johnson, and G. G. Freund. 2005. IL-1beta-mediated innate immunity is amplified in the db/db mouse model of type 2 diabetes. J. Immunol. 174:4991-4997. [PubMed]
41. Overbergh, L., A. Giulietti, D. Valckx, R. Decallonne, R. Bouillon, and C. Mathieu. 2003. The use of real-time reverse transcriptase PCR for the quantification of cytokine gene expression. J. Biomol. Tech. 14:33-43. [PMC free article] [PubMed]
42. Paccani, S. R., F. Tonello, R. Ghittoni, M. Natale, L. Muraro, M. M. D'Elios, W. J. Tang, C. Montecucco, and C. T. Baldari. 2005. Anthrax toxins suppress T lymphocyte activation by disrupting antigen receptor signaling. J. Exp. Med. 201:325-331. [PMC free article] [PubMed]
43. Park, J. H., Y. G. Kim, C. McDonald, T. D. Kanneganti, M. Hasegawa, M. Body-Malapel, N. Inohara, and G. Nunez. 2007. RICK/RIP2 mediates innate immune responses induced through Nod1 and Nod2 but not TLRs. J. Immunol. 178:2380-2386. [PubMed]
44. Park, J. H., Y. G. Kim, M. Shaw, T. D. Kanneganti, Y. Fujimoto, K. Fukase, N. Inohara, and G. Nunez. 2007. Nod1/RICK and TLR signaling regulate chemokine and antimicrobial innate immune responses in mesothelial cells. J. Immunol. 179:514-521. [PubMed]
45. Park, J. M., F. R. Greten, Z. W. Li, and M. Karin. 2002. Macrophage apoptosis by anthrax lethal factor through p38 MAP kinase inhibition. Science 297:2048-2051. [PubMed]
46. Pellizzari, R., C. Guidi-Rontani, G. Vitale, M. Mock, and C. Montecucco. 1999. Anthrax lethal factor cleaves MKK3 in macrophages and inhibits the LPS/IFNgamma-induced release of NO and TNFalpha. FEBS Lett. 462:199-204. [PubMed]
47. Pickering, A. K., and T. J. Merkel. 2004. Macrophages release tumor necrosis factor alpha and interleukin-12 in response to intracellular Bacillus anthracis spores. Infect. Immun. 72:3069-3072. [PMC free article] [PubMed]
48. Pickering, A. K., M. Osorio, V. K. Grippe, G. M. Lee, M. Bray, and T. J. Merkel. 2004. The cytokine response to infection with Bacillus anthracis spores. Infect. Immun. 72:6382-6389. [PMC free article] [PubMed]
49. Pitt, M. L. M., S. F. Little, B. E. Ivins, P. Fellows, J. Barth, J. Hewetson, P. Gibbs, M. Dertzbaugh, and A. M. Friedlander. 2001. In vitro correlate of immunity in a rabbit model of inhalational anthrax. Vaccine 19:4768-4773. [PubMed]
50. Ross, J. M. 1957. The pathogenesis of anthrax following the administration of spores by the respiratory route. J. Pathol. Bacteriol. 73:485-494.
51. Schwandner, R., R. Dziarski, H. Wesche, M. Rothe, and C. J. Kirschning. 1999. Peptidoglycan and lipoteichoic acid-induced cell activation is mediated by Toll-like receptor 2. J. Biol. Chem. 274:17406-17409. [PubMed]
52. Sirard, J. C., C. Vignal, R. Dessein, and M. Chamaillard. 2007. Nod-like receptors: cytosolic watchdogs for immunity against pathogens. PLoS Pathog. 3:e152. [PMC free article] [PubMed]
53. Tournier, J. N., A. Quesnel-Hellmann, J. Mathieu, C. Montecucco, W. J. Tang, M. Mock, D. R. Vidal, and P. L. Goossens. 2005. Anthrax edema toxin cooperates with lethal toxin to impair cytokine secretion during infection of dendritic cells. J. Immunol. 174:4934-4941. [PubMed]
54. Vitale, G., R. Pellizzari, C. Recchi, G. Napolitani, M. Mock, and C. Montecucco. 1998. Anthrax lethal factor cleaves the N-terminus of MAPKKs and induces tyrosine/threonine phosphorylation of MAPKs in cultured macrophages. Biochem. Biophys. Res. Commun. 248:706-711. [PubMed]
55. Welkos, S. L., T. J. Keener, and P. H. Gibbs. 1986. Differences in susceptibility of inbred mice to Bacillus anthracis. Infect. Immun. 51:795-800. [PMC free article] [PubMed]
56. Welkos, S. L., N. J. Vietri, and P. H. Gibbs. 1993. Nontoxigenic derivatives of the Ames strain of Bacillus anthracis are fully virulent for mice—role of plasmid pXO2 and chromosome in strain-dependent virulence. Microb. Pathog. 14:381-388. [PubMed]
57. Werts, C., L. le Bourhis, J. Liu, J. G. Magalhaes, L. A. Carneiro, J. H. Fritz, S. Stockinger, V. Balloy, M. Chignard, T. Decker, D. J. Philpott, X. Ma, and S. E. Girardin. 2007. Nod1 and Nod2 induce CCL5/RANTES through the NF-kappaB pathway. Eur. J. Immunol. 37:2499-2508. [PubMed]
58. Young, J. A., and R. J. Collier. 2007. Anthrax toxin: receptor binding, internalization, pore formation, and translocation. Annu. Rev. Biochem. 76:243-265. [PubMed]
Articles from Infection and Immunity are provided here courtesy of
American Society for Microbiology (ASM)