PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jbacterPermissionsJournals.ASM.orgJournalJB ArticleJournal InfoAuthorsReviewers
 
J Bacteriol. 2009 October; 191(19): 6003–6011.
Published online 2009 July 31. doi:  10.1128/JB.00687-09
PMCID: PMC2747901

Identification of the Site-Specific DNA Invertase Responsible for the Phase Variation of SusC/SusD Family Outer Membrane Proteins in Bacteroides fragilis[down-pointing small open triangle]

Abstract

The human gut microbe Bacteroides fragilis can alter the expression of its surface molecules, such as capsular polysaccharides and SusC/SusD family outer membrane proteins, through reversible DNA inversions. We demonstrate here that DNA inversions at 12 invertible regions, including three gene clusters for SusC/SusD family proteins, were controlled by a single tyrosine site-specific recombinase (Tsr0667) encoded by BF0667 in B. fragilis strain YCH46. Genetic disruption of BF0667 diminished or attenuated shufflon-type DNA inversions at all three susC/susD genes clusters, as well as simple DNA inversions at nine other loci, most of which colocalized with susC/susD family genes. The inverted repeat sequences found within the Tsr0667-regulated invertible regions shared the consensus motif sequence AGTYYYN4GDACT. Tsr0667 specifically mediated the DNA inversions of 10 of the 12 regions, even under an Escherichia coli background when the invertible regions were exposed to BF0667 in E. coli cells. Thus, Tsr0667 is an additional globally acting DNA invertase in B. fragilis, which probably involves the selective expression of SusC/SusD family outer membrane proteins.

The human gut harbors an abundant and diverse microbiota. Bacteroides is one of the most abundant genera of human gut microflora (10, 17, 20), and the biological activities of Bacteroides species are deeply integrated into human physiology through nutrient degradation, the production of short-chain fatty acids, or immunomodulatory molecules (11-14, 24). Recent genomic analyses of Bacteroides have revealed that the bacteria possess redundant abilities not only to bind and degrade otherwise indigestible dietary polysaccharides but also to produce vast arrays of capsular polysaccharide (5, 19, 38, 39). These functional redundancies have been established by the extensive duplication of various genes that encode molecules such as glycosylhydrolases, glycosyltransferases, and outer membrane proteins of the SusC/SusD family (starch utilization system) known to be involved in polysaccharide recognition and transport (7, 27, 28, 30). It has been assumed that these functional redundancies of Bacteroides contribute to the stability of the gut ecosystem (3, 21, 23, 32, 39).

Another characteristic feature common in Bacteroides species is that the expression of some of the genes is altered in an on-off manner by reversible DNA inversions at gene promoters or within the protein-coding regions (5, 9, 19, 38, 39). These phase-variable phenotypes are associated with surface architectures such as capsular polysaccharides and SusC/SusD family proteins (5, 6, 16, 19). Our previous genomic analyses of Bacteroides fragilis strain YCH46 revealed that it contained as many as 31 invertible regions in its chromosome (19). These invertible regions can be grouped into six classes according to the internal motif sequences within inverted repeat sequences (IRs) (Table (Table1).1). The DNA inversions within these regions are thought to be controlled by site-specific DNA invertases specific to each class. B. fragilis strain YCH46 contains 33 tyrosine site-specific recombinases (Tsr) genes and four serine site-specific recombinases (Ssr) genes. Generally, DNA invertases mediate DNA inversions at adjacent regions, such as FimB and FimE, that flip their immediate downstream promoters to generate a phase-variable phenotype of type I pili in Escherichia coli (15). B. fragilis is unique in that this anaerobe possesses not only locally acting DNA invertases but also globally acting DNA invertases that mediate DNA inversions at distant loci (8, 29). It has been reported that B. fragilis possesses at least two types of master DNA invertase that regulate DNA inversions at multiple loci simultaneously (8, 29). One is Mpi, an Ssr that mediates the on-off switching of 13 promoter regions (corresponding to class I regions in B. fragilis strain YCH46), including seven promoter regions for capsular polysaccharide biosynthesis in B. fragilis strain NCTC9343 (8). The other master DNA invertase is Tsr19, a Tsr that regulates DNA inversions at two distantly located promoter regions (corresponding to class IV regions in B. fragilis strain YCH46) associated with the large encapsulation phenotype (6, 26, 29). The invertible regions contain specific consensus motifs within the IRs corresponding to each DNA invertase and constitute a regulatory unit. We designated this type of regulatory unit as an “inverlon,” which consists of at least two invertible regions controlled by a single master DNA invertase.

TABLE 1.
Classification of the invertible regions in B. fragilis strain YCH46 based on internal motif sequences within IRs

Our previous studies indicated that an additional inverlon other than the Mpi- and Tsr19-regulated inverlons is present in B. fragilis, based on the finding that at least 10 invertible regions (corresponding to class II regions in B. fragilis strain YCH46) contain a particular consensus motif sequence (AAGTTCN5GAACTT) within their IRs (19) but do not appear to colocalize with a DNA invertase gene. The majority of the class II regions were associated with the selective switching of a particular set of susC/susD family genes. Since the SusC/SusD family of outer membrane proteins play an important role in polysaccharide utilization by Bacteroides (3, 23, 32), the inverlon associated with the phase variation of SusC/SusD family proteins would likely be involved in the survival of this anaerobe in the distal gut.

In the present study, we sought to identify the DNA invertase regulating the additional inverlon in B. fragilis. Our results indicated that the Tsr encoded by BF0667 is a master DNA invertase for this inverlon (designated the Tsr0667-inverlon) in B. fragilis.

MATERIALS AND METHODS

Bacterial strains, plasmids, and culture conditions.

The bacterial strains and plasmids used in the present study are listed in Table S1 in the supplemental material. B. fragilis strains were grown anaerobically at 37°C in Gifu anaerobic medium (GAM; Nissui Pharmaceutical Co., Tokyo, Japan) or on GAM agar plates using the AnaeroPack system (Mitsubishi Gas Chemical Co., Inc., Tokyo, Japan). B. fragilis strain YCH46 (18) was used as a parental strain for all genetic disruption experiments. E. coli strains were grown aerobically at 37°C in Luria-Bertani (LB) broth or on LB agar plates. If necessary, antibiotics were added to the media at the following concentrations: ampicillin, 50 μg/ml; erythromycin (Em), 10 μg/ml; and tetracycline (Tc), 10 μg/ml.

Clustering of Tsr proteins.

We identified all Tsr genes from B. fragilis strains YCH46 and NCTC9343 and B. thetaiotaomicron strain VPI-5482 by screening the proteomes with the pfam00589 motif. Total of 33, 25, and 55 Tsr-encoding genes were identified in the genomes of B. fragilis strains YCH46 and NCTC9343 and B. thetaiotaomicron strain VPI-5482, respectively. These Tsr protein sequences were aligned, and distance matrices were calculated based on amino acid sequence similarities by the CLUSTAL W program (34). A phylogenetic tree was drawn by using MEGA-4 software (33). Similarly, Ssr genes were identified by screening with the pfam00239 motif.

Plasmid and strain construction.

Deletion mutants for 19 Tsr- and two Ssr-encoding genes were constructed in the B. fragilis strain YCH46 by removing the internal segment of each target gene. Briefly, DNA fragments upstream and downstream of the region being deleted were separately PCR amplified and fused by a second PCR amplification via an overlapping regions incorporated into the primer sequences. The resultant PCR products were digested with restriction endonucleases that corresponded to restriction sites added to the primer ends, ligated into pKK100, and introduced into E. coli strain JM109. The plasmid pKK100 is a suicide vector for Bacteroides, which was constructed by subcloning the 3.8-kb Em/Tc resistance element from pE5-2 (31) into the XmnI site of the pBluescript II KS vector (Stratagene). The purified knockout vectors were then electroporated into B. fragilis strain YCH46 as described below. Em-resistant transformants, in which the knockout vector had integrated into the chromosome through a single crossover, were selected. The single-crossover mutants were then grown in GAM broth, spread onto nonselective GAM agar plates, and replica plated onto GAM agar plates containing Em to screen for mutants that had lost the vector sequence through a second crossover event. Em-sensitive colonies were selected, and the genetic disruption was confirmed by PCR amplification using primers that flanked the deletion sites (see Table S2 in the supplemental material). BF0667 complementation studies were performed by cloning BF0667 into the modified E. coli-Bacteroides shuttle plasmid pVAL-Exp, derived from plasmid pVAL-1 (35). Synthetic oligonucleotide primers were purchased from Sigma-Aldrich Japan Co., Ltd. (Tokyo, Japan). DNA sequencing was performed on an ABI Prism 3100 genetic analyzer (Applied Biosystems) by using a ABI Prism BigDye terminator cycle sequencing ready reaction kit (version 1.1; Applied Biosystems).

Electrotransformation.

B. fragilis strain YCH46 was grown anaerobically in 10 ml of GAM broth at 37°C overnight, and then 0.1 ml of the overnight culture was inoculated into 10 ml of freshly prepared GAM broth, followed by incubation anaerobically at 37°C until mid-exponential phase. Then, 1 ml of the fresh bacterial culture was inoculated into 100 ml of GAM broth, followed by incubation anaerobically at 37°C, and grown to early exponential phase (i.e., an optical density at 660 nm of 0.4 to 0.5). After harvesting by centrifugation at 4°C, the bacterial cells were washed twice with 100 ml of ice-cold 10% glycerol and resuspended in 1.0 ml of ice-cold 10% glycerol. For electroporation, 0.1 ml of the cell suspension was mixed with 10 μg of the plasmid DNA in a 0.2-cm cuvette. The sample was immediately subjected to an electric pulse (12.5 kV/cm, 200 Ω, 25 μF) by using a GenePulser II (Bio-Rad). Prewarmed GAM broth (0.9 ml) was immediately added to the sample, and the cells were incubated anaerobically at 37°C for 12 h before being spread on a GAM agar plate containing Em. The plates were incubated at 37°C for 48 h under anaerobic conditions.

PCR assay to detect DNA inversions.

To assess the DNA inversions at each region, we examined genomic DNA from each site-specific recombinase gene deletion mutant by PCR using a set of orientation-specific primers (see Table S2 in the supplemental material). PCR amplification was performed on 100 ng of genomic DNA using GoTaq polymerase (Promega) under the following conditions: preheating at 95°C for 1 min; 25, 30, or 35 cycles of 30 s at 95°C; 30 s at 55°C; and 1 min at 72°C, with a final extension step of 5 min of 72°C. DNA fragments over 5 kb were amplified by using TaKaRa LA Taq DNA polymerase (Takara Shuzo Co., Ltd., Otsu, Japan) with amplification conditions of 1 min at 94°C; followed by 25, 30, or 35 cycles of 30 s at 94°C; and 10 min at 68°C, with a final extension step of 10 min of 68°C.

Reconstruction of the Tsr0667-inverlon in E. coli.

To test the specificity of Tsr0667, each invertible region of the Tsr0667-inverlon was exposed to BF0667 in an E. coli background. BF0667 was PCR amplified using the primers BF0667-PCR2 and BF0667-PCR3 and cloned into the SmaI site of the pBluescript II KS vector in both orientations. In the plasmid construct pKS0667(+), BF0667 was cloned in same orientation as the lac promoter, while in pKS0667(−), BF0667 was in the opposite orientation to the lac promoter. All of the Tsr0667-inverlon invertible regions except for class V were amplified from the genomic DNA of wild-type strain. The PCR amplification of the class V invertible region was performed by using the BF0667 deletion mutant (TSRM0667) genomic DNA. The resultant PCR products were cloned individually into the EcoRV site of pACYC184 (Nippon Gene Co., Ltd., Tokyo, Japan), producing the reporter plasmids pRep1 to pRep12. The gene for Mpi was also PCR amplified by using the primers int4 and mpi-PCR5 and cloned into the SmaI site of pBluescript II KS vector in both orientations, producing the plasmids pKSmpi(+) and pKSmpi(−). The reporter plasmid for Mpi-mediated inversion, pRep13, that harbored the invertible promoter from capsular polysaccharide biosynthesis locus PS-3 (corresponding to PS A locus in B. fragilis strain NCTC9343) was also constructed. E. coli DH5α cells harboring each of the reporter plasmids were then transformed with pKS0667(+), pKS0667(−), pKSmpi(+), or pKSmpi(−), and the extent of DNA inversion on each reporter plasmid was assessed by PCR with orientation-specific primer sets.

RESULTS

Invertible regions and site-specific recombinase genes in B. fragilis strain YCH46.

The B. fragilis strain YCH46 chromosome contains at least 31 invertible regions (19). As shown in Fig. Fig.1,1, 10 of these invertible regions (class II regions) appeared to constitute an inverlon controlled by a DNA invertase other than Mpi and Tsr19. This was based on the observation that these 10 regions contained IRs with a distinct type of consensus motif sequence (AAGTTCN5GAACTT) and that none of the regions colocalized with DNA invertase genes. Eight of these regions contain promoter-like sequences (1) that may affect the on-off expression of the corresponding SusC/SusD regions, which indicated that the inverlon may be involved in the utilization of various dietary- or host-derived polysaccharides. The mode of DNA inversion in these regions was not merely simple promoter switching (class II-4, -7, -8, -9, and -10) but may also involve the formation of hybrid proteins (class II-1, -2, and -6) or shufflon-type multiple DNA inversions (class II-3).

FIG. 1.
Genetic structures of invertible regions previously classified as class II regions in B. fragilis strain YCH46 (19). The open reading frames present in each locus are indicated by arrows that are differentiated according to function. IRs are indicated ...

The B. fragilis strain YCH46 possesses 33 Tsr-encoding genes (Fig. (Fig.2),2), as well as four Ssr-encoding genes (BF0513, BF2906, BF2765, and BF3012). Of the 37 site-specific recombinase-encoding genes, 19 Tsr- and 2 Ssr-encoding genes (BF0513 and BF2765) are conserved between B. fragilis strains YCH46 and NCTC9343, and six Tsr genes are conserved between the B. fragilis strains and the B. thetaiotaomicron strain VPI-5482. Amino acid sequence comparisons showed that the Tsr proteins from B. fragilis strains YCH46 and NCTC9343, and B. thetaiotaomicron strain VPI-5482 fell into three clusters. The Tsr-encoding genes that have been demonstrated experimentally to mediate DNA inversions to date (BF2766, BF3038, BF4033, and BF4283 corresponding to Tsr19, -25, -15, and -26 in strain NCTC9343, respectively) belong to the same cluster (cluster 3b). These Tsr proteins control local promoter inversions immediately downstream (29, 36). We found putative invertible regions at loci immediately downstream for other members of the 3b cluster in B. fragilis strain YCH46 (BF1781, BF3522, and BF4438), each containing a unique IR (data not shown). Likewise, in the B. thetaiotaomicron strain VPI-5482 all of the 3b cluster Tsr-encoding genes were associated with putative invertible regions located immediately downstream (data not shown). The members of cluster 3b are thought to have expanded from a locally acting DNA invertase in Bacteroides.

FIG. 2.
Clustering analysis of Tsr amino acid sequences from B. fragilis strains YCH46 (red) and NCTC9343 (blue) and B. thetaiotaomicron strain VPI-5482 (green). The deduced amino acid sequences of Tsr were aligned and compared by using the CLUSTAL W program ...

Identification of the DNA invertase regulating the additional inverlon.

Of the 37 site-specific recombinase-encoding genes in B. fragilis strain YCH46, we selected six genes (BF0667, BF1168, BF1340, BF3036, BF4201, and BF4484) that were conserved between B. fragilis strain NCTC9343 and B. thetaiotaomicron strain VPI-5482 (Fig. (Fig.2)2) as candidate genes for a master DNA invertase of the additional inverlon. This selection was based on the observation that the class II invertible regions contain IRs with consensus motif sequence AAGTTCN5GAACTT which was also conserved between the strains. We constructed deletion mutants for each of these candidate genes and performed PCR screening using orientation-specific primer sets (Fig. (Fig.3A)3A) to identify mutants in which the DNA inversions in the class II invertible regions were diminished. Of the mutants screened, the DNA inversions were affected only when BF0667 was disrupted (Fig. 3B and D). Although amplicons were still produced from both orientation-specific primer sets from the class II-5 region of this mutant (TSRM0667), the disruption of BF0667 significantly reduced the DNA inversion in this region (Fig. (Fig.3B).3B). In TSRM0667, shufflon-type multiple DNA inversions in the susC/susD gene cluster (class II-3 in Fig. Fig.1)1) were also abrogated (Fig. (Fig.3D).3D). Complementation with plasmid-encoded BF0667 restored the DNA inversions to wild-type levels in all of the regions tested. Thus, the Tsr encoded by BF0667 (designated Tsr0667) is considered to be the third globally acting DNA invertase in B. fragilis and the master DNA invertase of the inverlon responsible for the variable expression of the SusC/SusD outer membrane protein family.

FIG. 3.
PCR assay for DNA inversions in class II regions of wild-type (WT) and BF0667-deletion mutant (TSRM0667) strains. TSRM0667 strain complemented with plasmid-borne BF0667 in trans, TSRM0667(pVAL0667), was also analyzed. The results of a 25-cycle amplification ...

Role of Tsr0667 in shufflon-type multiple DNA inversions in susC/susD gene clusters.

The B. fragilis genome possesses three susC/susD gene clusters (class II-3, class V, and class VI regions) localized distantly from each other, where shufflon-type multiple DNA inversions have been reported to occur (19). Interestingly, as shown in Fig. Fig.4A,4A, BF0667 is localized within one of these susC/susD gene clusters (class V region) distant from the class II-3 region. This characteristic localization suggested that Tsr0667 may also mediate shufflon-type multiple DNA inversions in this cluster despite the different IRs (TCTGCAAAGTCTTTGCAGAACTTG) compared to class II regions. As predicted, PCR screening demonstrated that BF0667 disruption also diminished genetic shuffling in the class V region (Fig. (Fig.4B4B).

FIG. 4.
Involvement of Tsr0667 in shufflon-type multiple DNA inversions in the two distantly located susC/susD clusters in B. fragilis. Genetic structures of the class V susC/susD cluster (A) and the class VI susC/susD cluster (C) are shown. The results of 25-cycle ...

Unexpectedly, DNA inversions in the remaining susC/susD gene cluster (class VI region) that contained the IRs ACTAAGTTCTATCGGTACTTG, distinct from the other susC/susD gene clusters, were also abrogated in TSRM0667 (Fig. (Fig.4D).4D). DNA inversions at other invertible regions (class I, III, and IV regions) were not affected (data not shown). We constructed deletion mutants of all 21 site-specific recombinase genes (19 tsr and 2 ssr genes) conserved between the two B. fragilis genomes. However, we failed to disrupt the Ssr gene BF0513 despite the repeated trials. Except for BF0667, none of the site-specific recombinase genes tested affected genetic shuffling in the three susC/susD gene clusters or DNA inversions at the other nine loci of the Tsr0667-inverlon. In addition, DNA inversions occurred in the recA-negative B. fragilis mutant (data not shown). Together, our results indicated that the Tsr0667-inverlon consisted of at least 12 invertible regions including three susC/susD gene clusters and that Tsr0667 is necessary for these inversions.

Possible recognition sequence of Tsr0667.

Site-specific DNA invertases generally recognize and bind to a specific sequence within IRs. Based on our findings, it would be expected that all of the invertible regions in the Tsr0667-inverlon contain a consensus motif sequence recognized by Tsr0667. To extract a consensus motif sequence, the Tsr0667-inverlon invertible region IRs were aligned and compared. As shown in Fig. Fig.5,5, we identified the consensus motif AGTYYYN4GDACT as a possible recognition sequence of Tsr0667.

FIG. 5.
Alignment of IRs within the invertible regions of the Tsr0667-inverlon. IR sequences are underlined. Conserved nucleotides are shadowed and indicated by boldface letters. The consensus motif sequence is shown below the alignments (Y = C or T; ...

Reconstruction of the Tsr0667-inverlon in E. coli.

To determine the specificity and direct association of Tsr0667 with the Tsr0667-inverlon invertible regions, we reconstructed the components of the inverlon in E. coli strain DH5α. As shown in Fig. Fig.6A,6A, BF0667 was cloned into pBluescript II KS in the same or the opposite orientation with respect to the lac promoter, generating pKS0667(+) and pKS0667(−), respectively. The gene encoding Mpi was also cloned into pBluescript II KS to give pKSmpi(+) and pKSmpi(−), respectively. The invertible regions that constitute the Tsr0667-inverlon or the invertible PS-3 promoter region (corresponding to PS A promoter regions in B. fragilis strain NCTC9343) were individually cloned into pACYC184, and these constructs were used as reporter plasmids for DNA inversions (pRep-1 to -13). Each reporter plasmid coexisted with a plasmid harboring either BF0667 or mpi in E. coli cells. As shown in Fig. Fig.6A,6A, DNA inversions within the cloned fragment on the reporter plasmids were assessed by colony PCR using orientation-specific primer sets. Of the invertible regions tested, all regions except for class II-5 and class VI underwent DNA inversion when pKS0667(+) but not pKS0667(−) was also present (columns I and II in Fig. Fig.6B).6B). For the class II-5 and class VI regions, DNA inversions occurred in the E. coli background regardless of whether BF0667 was present or not. Expression of mpi did not promote DNA inversions other than in the PS-3 promoter (column IV in Fig. Fig.6B).6B). Interestingly, spontaneous DNA inversions within the class II-5 and class VI regions in E. coli cells were diminished when mpi was expressed. These findings suggested that Tsr0667 directly regulates the DNA inversions for at least 10 of the 12 invertible regions of the Tsr0667-inverlon.

FIG. 6.
Reconstruction of the B. fragilis Tsr0667-inverlon in an E. coli background. (A) Schematic representation of E. coli strains containing BF0667- or mpi-bearing plasmids and reporter plasmid harboring the substrate region for Tsr0667 (pRep 1 to 12, class ...

DISCUSSION

Numerous microbes inhabit the human digestive tract and constitute a complex microbial ecosystem (10, 17, 20). The precise roles of gut microbes on human health and disease remain largely unknown due to their diversity (~1,000 species) and population levels (1014 microorganisms in all). Recent studies on the human gut commensal B. fragilis have given insights into the molecular basis of human-microbe mutualism. For instance, a particular polysaccharide (PS A) produced by B. fragilis can modulate the host immune response and prevent tissue damage due to an excessive inflammatory response (24, 25). Bacteroides species tend to produce multiple types of capsular polysaccharide and a large number of outer membrane proteins (especially those of the SusC/SusD family) and can alter the expression levels of these surface molecules through reversible DNA inversions. Of the Bacteroides species sequenced thus far, B. fragilis is unique in that the most of the invertible regions are controlled by single DNA invertases such as Mpi specific for PS promoters (8) and Tsr19 specific for two distant invertible promoters associated with the large encapsulation phenotype (6, 26, 29). This mode of regulation is similar to that of a regulon, in that a transcriptional regulator simultaneously controls the expression of a number of genes. Therefore, we defined a regulatory unit consisting of at least two invertible regions and a single master DNA invertase as an “inverlon” by combining the terms “inversion” and “regulon.” In the present study, we identified Tsr0667 in B. fragilis strain YCH46 as a master DNA invertase for an additional B. fragilis inverlon due to its apparent role in conferring the phase-variable phenotype on the SusC/SusD family of outer membrane proteins.

The SusC/SusD protein complex was firstly characterized in B. thetaiotaomicron as a part of the starch utilization locus (7, 27, 28, 30). The SusC family of outer membrane proteins constitutes the largest paralogous family in the sequenced Bacteroides species (39), which suggests that this family may play a crucial role in the stable colonization of Bacteroides in the lower digestive tract. The SusC/SusD family proteins in Bacteroides proteomes confer the ability to bind and utilize a wide range of otherwise indigestible dietary polysaccharides (3, 23). In Bacteroides genomes, there are many loci where susC/susD pairs tightly clustered. The B. fragilis susC/susD cluster containing BF0667 (class V region) is conserved between the sequenced Bacteroides species, suggesting that the clusters evolved from a common ancestor. Since the class V susC/susD cluster in B. thetaiotaomicron and B. vulgatus also contains IRs similar to that observed in B. fragilis, the BF0667 homologue within this cluster in B. thetaiotaomicron and B. vulgatus is also likely to be involved in shufflon-type multiple DNA inversions of the susC/susD cluster. Recent comparative transcriptome analysis of B. thetaiotaomicron in the ceca of suckling and weaned gnotobiotic mice have demonstrated that the expression of particular sets of susC/susD homologues (BT2259, BT2260, BT2268, and BT2269) within the class V susC/susD cluster were elevated two- to sevenfold in suckling mice compared to weaned mice (3). Thus, the class V SusC/SusD complexes may be involved in the recognition or utilization of host-derived polysaccharides.

In our previous analysis of the B. thetaiotaomicron genome, we identified five class II regions that contain the same consensus motif sequence as the Tsr0667-inverlon in B. fragilis (19). In addition to the susC/susD paralogs in the class V region, expression of susC/susD paralogs (BT0866/BT0867, BT4038/BT4039, and BT4246/BT4247) in three of the five class II regions of B. thetaiotaomicron was also elevated in suckling mice (3) and mice consuming dietary polysaccharide-deficient diets (32). Furthermore, expression of these susC/susD paralogs was also elevated during growth on host glycan fractions enriched for mucin O-glycans (23). These findings indicated that this B. thetaiotaomicron inverlon (corresponding to the Tsr0667-inverlon in B. fragilis) is associated with the utilization of host-derived glycan. Phase variation within the class II and class V susC/susD clusters in B. fragilis and B. thetaiotaomicron might enable these species to access areas closer to the mucosal surface by producing a population adapted to that particular niche.

As shown in the reconstruction experiment of the B. fragilis Tsr0667-inverlon in an E. coli background, there appears to be a direct association of Tsr0667 with the DNA inversions of this inverlon (Fig. (Fig.6).6). However, some DNA inversions occurred at several regions even under BF0667-negative backgrounds in both B. fragilis (Fig. (Fig.33 and and4)4) and E. coli (Fig. (Fig.6).6). These regions tended to have long homologous stretches around the IRs. Nucleotide sequencing of these “leaky” amplification products revealed that the DNA inversions occurred at breakpoints other than those associated with Tsr0667 (data not shown). Thus, it is possible that a common RecA-independent recombination system in prokaryotes (2, 22) involves in these leaky DNA inversions under a BF0667-negative background. It might also be possible that E. coli FimBE cross-react with these regions. It has been reported that when the all-OFF mutant of flippable PS promoters was constructed in B. fragilis with the PS C locus also disrupted, the PS B promoter reverted to the ON orientation even under an Mpi-negative background (21), which indicated that PS promoter DNA inversions in B. fragilis may be controlled by several mechanisms. Indeed, PS promoter inversions in the B. fragilis strain NCTC9343 have been reported to be mediated not only by mpi but also by a plasmid-encoded mpi homologue when present in a heterologous strain (21). Also, it is well known that the flippable promoter (fimS) involved in the synthesis of type I pili in E. coli is controlled by a number of DNA invertases, such as FimB, FimE, IpuA, IpuB, and IpbA (HbiF) (4, 15, 37). Since the PCR assay for the Tsr0667-inverlon in TSRM0667 over 30 cycles amplification produced amplicons from both orientation-specific primer sets from several regions (data not shown), it is possible that certain DNA invertases cross-react with Tsr0667 recognition sequences. To answer this question, it will be necessary to construct and screen multiple Tsr mutants under a BF0667-negative background.

Another important point raised from the Tsr0667-inverlon reconstruction experiments in E. coli is that leaky DNA inversions observed in the class II-5 and class VI regions were diminished in the presence of Mpi (Fig. (Fig.6B).6B). Although it is possible that Mpi is sequestering a necessary accessory factor that is needed for the inversion, this finding indicated the possibility of some cross talk between the Tsr0667-regulated and Mpi-regulated inverlons. Cross talk and coordination between inverlons may offer the advantage of rapid and effective tuning of surface adaptations in response to environmental changes.

In summary, the present study revealed that BF0667-encoded Tsr (Tsr0667) globally regulated DNA inversions in as many as 12 distantly located regions, including three susC/susD clusters. Recent whole-genome sequence analyses have revealed that marked expansion of polysaccharide utilization (SusC/SusD family proteins, ABC transporters, and glycosylhydrolases) and biosynthesis (capsular polysaccharides) genes is a significant characteristic of the genus Bacteroides. Another characteristic feature is the number of phase-variable phenotypes for large arrays of surface molecules. To establish these phase-variable phenotypes, B. fragilis has evolved at least three types of DNA invertases that are unique in that they regulate DNA inversions at distant loci. These DNA invertases clearly share functional roles in surface adaptation: Mpi is associated with capsular polysaccharide biosynthesis (8), Tsr19 with large encapsulation phenotypes (6, 26), and now Tsr0667 with selective expression of SusC/SusD family outer membrane proteins. It would be interesting to explore in future studies how these three inverlon types interact to more deeply understand the processes of commensalism in human gut microbes.

Supplementary Material

[Supplemental material]

Acknowledgments

This study was supported by Grants-in Aid for Encouragement of Young Scientists (B) and Scientific Research on the Priority Area “Applied Genomics” from the Ministry of Education, Science, Sports, Culture, and Technology of Japan.

Footnotes

[down-pointing small open triangle]Published ahead of print on 31 July 2009.

Supplemental material for this article may be found at http://jb.asm.org/.

REFERENCES

1. Bayley, D. P., E. R. Rocha, and C. J. Smith. 2000. Analysis of cepA and other Bacteroides fragilis genes reveals a unique promoter structure. FEMS Microbiol. Lett. 193:149-154. [PubMed]
2. Bi, X., and L. F. Liu. 1996. DNA rearrangement mediated by inverted repeats. Proc. Natl. Acad. Sci. USA 93:819-823. [PubMed]
3. Bjursell, M. K., E. C. Martens, and J. I. Gordon. 2006. Functional genomic and metabolic studies of the adaptations of a prominent adult human gut symbiont, Bacteroides thetaiotaomicron, to the suckling period. J. Biol. Chem. 281:36269-36279. [PubMed]
4. Bryan, A., P. Roesch, L. Davis, R. Moritz, S. Pellett, and R. A. Welch. 2006. Regulation of type 1 fimbriae by unlinked FimB- and FimE-like recombinases in uropathogenic Escherichia coli strain CFT073. Infect. Immun. 74:1072-1083. [PMC free article] [PubMed]
5. Cerdeño-Tárraga, A. M., S. Patrick, L. C. Crossman, G. Blakely, V. Abratt, N. Lennard, I. Poxton, B. Duerden, B. Harris, M. A. Quail, A. Barron, L. Clark, C. Corton, J. Doggett, M. T. Holden, N. Larke, A. Line, A. Lord, H. Norbertczak, D. Ormond, C. Price, E. Rabbinowitsch, J. Woodward, B. Barrell, and J. Parkhill. 2005. Extensive DNA inversions in the Bacteroides fragilis genome control variable gene expression. Science 307:1463-1465. [PubMed]
6. Chatzidaki-Livanis, M., M. J. Coyne, H. Roche-Hakansson, and L. E. Comstock. 2008. Expression of a uniquely regulated extracellular polysaccharide confers a large-capsule phenotype to Bacteroides fragilis. J. Bacteriol. 190:1020-1026. [PMC free article] [PubMed]
7. Cho, K. H., and A. A. Salyers. 2001. Biochemical analysis of interactions between outer membrane proteins that contribute to starch utilization by Bacteroides thetaiotaomicron. J. Bacteriol. 183:7224-7230. [PMC free article] [PubMed]
8. Coyne, M. J., K. G. Weinacht, C. M. Krinos, and L. E. Comstock. 2003. Mpi recombinase globally modulates the surface architecture of a human commensal bacterium. Proc. Natl. Acad. Sci. USA 100:10446-10451. [PubMed]
9. Coyne, M. J., and L. E. Comstock. 2008. Niche-specific features of the intestinal Bacteroidales. J. Bacteriol. 190:736-742. [PMC free article] [PubMed]
10. Eckburg, P. B., E. M. Bik, C. N. Bernstein, E. Purdom, L. Dethlefsen, M. Sargent, S. R. Gill, K. E. Nelson, and D. A. Relman. 2005. Diversity of the human intestinal microbial flora. Science 308:1635-1638. [PMC free article] [PubMed]
11. Flint, H. J., E. A. Bayer, M. T. Rincon, R. Lamed, and B. A. White. 2008. Polysaccharide utilization by gut bacteria: potential for new insights from genomic analysis. Nat. Rev. Microbiol. 6:121-131. [PubMed]
12. Hooper, L. V., M. H. Wong, A. Thelin, L. Hansson, P. G. Falk, and J. I. Gordon. 2001. Molecular analysis of commensal host-microbial relationships in the intestine. Science 291:881-884. [PubMed]
13. Hooper, L. V., T. Midtvedt, and J. I. Gordon. 2002. How host-microbial interactions shape the nutrient environment of the mammalian intestine. Annu. Rev. Nutr. 22:283-307. [PubMed]
14. Hooper, L. V., T. S. Stappenbeck, C. V. Hong, and J. I. Gordon. 2003. Angiogenins: a new class of microbicidal proteins involved in innate immunity. Nat. Immunol. 4:269-273. [PubMed]
15. Johnson, R. C. 2002. Bacterial site-specific DNA inversion systems, p. 230-271. In N. L. Craig, R. Craigie, M. Gellert, and A. M. Lambowitz (ed.), Mobile DNA II. ASM Press, Washington, DC.
16. Krinos, C. M., M. J. Coyne, K. G. Weinacht, A. O. Tzianabos, D. L. Kasper, and L. E. Comstock. 2001. Extensive surface diversity of a commensal microorganism by multiple DNA inversions. Nature 414:555-558. [PubMed]
17. Kurokawa, K., T. Itoh, T. Kuwahara, K. Oshima, H. Toh, A. Toyoda, H. Takami, H. Morita, V. K. Sharma, T. P. Srivastava, T. D. Taylor, H. Noguchi, H. Mori, Y. Ogura, D. S. Ehrlich, K. Itoh, T. Takagi, Y. Sakaki, T. Hayashi, and M. Hattori. 2007. Comparative metagenomics revealed commonly enriched gene sets in human gut microbiomes. DNA Res. 14:169-181. [PMC free article] [PubMed]
18. Kuwahara, T., M. R. Sarker, H. Ugai, S. Akimoto, S. M. Shaheduzzaman, H. Nakayama, T. Miki, and Y. Ohnishi. 2002. Physical and genetic map of the Bacteroides fragilis YCH46 chromosome. FEMS Microbiol. Lett. 207:193-197. [PubMed]
19. Kuwahara, T., A. Yamashita, H. Hirakawa, H. Nakayama, H. Toh, N. Okada, S. Kuhara, M. Hattori, T. Hayashi, and Y. Ohnishi. 2004. Genomic analysis of Bacteroides fragilis reveals extensive DNA inversions regulating cell surface adaptation. Proc. Natl. Acad. Sci. USA 101:14919-14924. [PubMed]
20. Ley, R. E., M. Hamady, C. Lozupone, P. J. Turnbaugh, R. R. Ramey, J. S. Bircher, M. L. Schlegel, T. A. Tucker, M. D. Schrenzel, R. Knight, and J. I. Gordon. 2008. Evolution of mammals and their gut microbes. Science 320:1647-1651. [PMC free article] [PubMed]
21. Liu, C. H., S. M. Lee, J. M. Vanlare, D. L. Kasper, and S. K. Mazmanian. 2008. Regulation of surface architecture by symbiotic bacteria mediates host colonization. Proc. Natl. Acad. Sci. USA 105:3951-3956. [PubMed]
22. Lyu, Y. L., C. T. Lin, and L. F. Liu. 1999. Inversion/dimerization of plasmids mediated by inverted repeats. J. Mol. Biol. 285:1485-1501. [PubMed]
23. Martens, E. C., H. C. Chiang, and J. I. Gordon. 2008. Mucosal glycan foraging enhances fitness and transmission of a saccharolytic human gut bacterial symbiont. Cell Host Microbe 4:447-457. [PMC free article] [PubMed]
24. Mazmanian, S. K., C. H. Liu, A. O. Tzianabos, and D. L. Kasper. 2005. An immunomodulatory molecule of symbiotic bacteria directs maturation of the host immune system. Cell 122:107-118. [PubMed]
25. Mazmanian, S. K., J. L. Round, and D. L. Kasper. 2008. A microbial symbiosis factor prevents intestinal inflammatory disease. Nature 453:620-625. [PubMed]
26. Patrick, S., S. Houston, Z. Thacker, and G. W. Blakely. 2009. Mutational analysis of genes implicated in LPS and capsular polysaccharide biosynthesis in the opportunistic pathogen Bacteroides fragilis. Microbiology 155:1039-1049. [PubMed]
27. Reeves, A. R., J. N. D'Elia, J. Frias, and A. A. Salyers. 1996. A Bacteroides thetaiotaomicron outer membrane protein that is essential for utilization of maltooligosaccharides and starch. J. Bacteriol. 178:823-830. [PMC free article] [PubMed]
28. Reeves, A. R., G. R. Wang, and A. A. Salyers. 1997. Characterization of four outer membrane proteins that play a role in utilization of starch by Bacteroides thetaiotaomicron. J. Bacteriol. 179:643-649. [PMC free article] [PubMed]
29. Roche-Hakansson, H., M. Chatzidaki-Livanis, M. J. Coyne, and L. E. Comstock. 2007. Bacteroides fragilis synthesizes a DNA invertase affecting both a local and a distant region. J. Bacteriol. 189:2119-2124. [PMC free article] [PubMed]
30. Shipman, J. A., J. E. Berleman, and A. A. Salyers. 2000. Characterization of four outer membrane proteins involved in binding starch to the cell surface of Bacteroides thetaiotaomicron. J. Bacteriol. 182:5365-5372. [PMC free article] [PubMed]
31. Shoemaker, N. B., E. P. Guthrie, A. A. Salyers, and J. F. Gardner. 1985. Evidence that the clindamycin-erythromycin resistance gene of Bacteroides plasmid pBF4 is on a transposable element. J. Bacteriol. 162:626-632. [PMC free article] [PubMed]
32. Sonnenburg, J. L., J. Xu, D. D. Leip, C. H. Chen, B. P. Westover, J. Weatherford, J. D. Buhler, and J. I. Gordon. 2005. Glycan foraging in vivo by an intestine-adapted bacterial symbiont. Science 307:1955-1959. [PubMed]
33. Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24:1596-1599. [PubMed]
34. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680. [PMC free article] [PubMed]
35. Valentine, P. J., N. B. Shoemaker, and A. A. Salyers. 1988. Mobilization of Bacteroides plasmids by Bacteroides conjugal elements. J. Bacteriol. 170:1319-1324. [PMC free article] [PubMed]
36. Weinacht, K. G., H. Roche, C. M. Krinos, M. J. Coyne, J. Parkhill, and L. E. Comstock. 2004. Tyrosine site-specific recombinases mediate DNA inversions affecting the expression of outer surface proteins of Bacteroides fragilis. Mol. Microbiol. 53:1319-1330. [PubMed]
37. Xie, Y., Y. Yao, V. Kolisnychenko, C. H. Teng, and K. S. Kim. 2006. HbiF regulates type 1 fimbriation independently of FimB and FimE. Infect. Immun. 74:4039-4047. [PMC free article] [PubMed]
38. Xu, J., M. K. Bjursell, J. Himrod, S. Deng, L. K. Carmichael, H. C. Chiang, L. V. Hooper, and J. I. Gordon. 2003. A genomic view of the human-Bacteroides thetaiotaomicron symbiosis. Science 299:2074-2076. [PubMed]
39. Xu, J., M. A. Mahowald, R. E. Ley, C. A. Lozupone, M. Hamady, E. C. Martens, B. Henrissat, P. M. Coutinho, P. Minx, P. Latreille, H. Cordum, A. Van Brunt, K. Kim, R. S. Fulton, L. A. Fulton, S. W. Clifton, R. K. Wilson, R. D. Knight, and J. I. Gordon. 2007. Evolution of symbiotic bacteria in the distal human intestine. PLoS Biol. 5:1574-1586. [PMC free article] [PubMed]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)