PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Cancer Res. Author manuscript; available in PMC 2010 September 1.
Published in final edited form as:
PMCID: PMC2747800
NIHMSID: NIHMS128802

Proteolytic Cleavage of PTPmu Regulates Glioblastoma Cell Migration

Abstract

Glioblastoma multiforme (GBM), the most common malignant primary brain tumor, represents a significant disease burden. GBM tumor cells disperse extensively throughout the brain parenchyma, and the need for tumor-specific drug targets and pharmacological agents to inhibit cell migration and dispersal is great. The receptor protein tyrosine phosphatase mu (PTPmu) is a homophilic cell adhesion molecule. The full-length form of PTPmu is downregulated in human glioblastoma. In this manuscript, overexpression of full-length PTPmu is demonstrated to suppress migration and survival of glioblastoma cells. Additionally, proteolytic cleavage is shown to be the mechanism of PTPmu downregulation in glioblastoma cells. Proteolysis of PTPmu generates a series of proteolytic fragments including a soluble catalytic intracellular domain (ICD) fragment that translocates to the nucleus. Only proteolyzed PTPmu fragments are detected in human glioblastomas. shRNA-mediated downregulation of PTPmu fragments decreases glioblastoma cell migration and survival. A peptide inhibitor of PTPmu function blocks fragment-induced glioblastoma cell migration, which may prove to be of therapeutic value in GBM treatment. These data suggest that loss of cell surface PTPmu by proteolysis generates catalytically active PTPmu fragments that contribute to migration and survival of glioblastoma cells.

Keywords: protein tyrosine phosphatase, PTPμ, glioblastoma, cell migration, proteolysis

INTRODUCTION

Gliomas are malignancies of glial supporting cells of the central nervous system, including astrocytes and oligodendrocytes (1, 2). These neoplasms are categorized by their putative cell of origin based upon morphological similarities to various types of normal glia (2, 3). They are graded histologically between I and IV according to the World Health Organization (WHO) classification system of tumor cellularity, proliferation, angiogenesis, and invasiveness (4). Glioblastoma multiforme (GBM), a WHO grade IV glioma, has a poor prognosis with a mean survival time less than one year (5). The lethality of GBM can be attributed to the dispersive phenotype where cells migrate and develop foci throughout the brain (3, 6, 7). We recently demonstrated the receptor protein tyrosine phosphatase mu (PTPμ) negatively regulates GBM cell migration, and full-length PTPμ protein is lost in human GBM tumors in comparison to low-grade astrocytomas (8).

PTPμ is the prototype of the type IIb subfamily of receptor protein tyrosine phosphatases (RPTPs). PTPμ has been demonstrated to participate in homophilic binding. PTPμ on the extracellular surface of one cell binds to PTPμ on the surface of an adjacent cell (911). As a transmembrane adhesion receptor, PTPμ has the ability to sense an extracellular signal via its extracellular segment and transduce this signal intracellularly via its phosphatase activity (1214). The PTPμ extracellular domain is composed of a MAM (Meprin/A5-protein/PTPMu) domain, an immunoglobulin-like (Ig) domain, and four fibronectin type III (FNIII) repeats (12, 15, 16). The intracellular domain of PTPμ contains a juxtamembrane sequence with homology to cadherins and two phosphatase domains of which only the most membrane proximal is catalytically active (17, 18). The juxtamembrane portion contains a helix-loop-helix wedge-shaped motif (14) that was targeted in the design of a peptide inhibitor of PTPμ function. This wedge peptide inhibitor specifically blocks PTPμ function in migration assays (19, 20).

PTPμ is expressed as a 200 kDa protein that is proteolytically cleaved in the fourth FNIII repeat, resulting in a 100 kDa extracellular fragment (E-subunit) that remains associated with the 100 kDa transmembrane and intracellular portion (P-subunit) through a non-covalent interaction (11, 21, 22). This cleavage is mediated by a furin-like protease in the endoplasmic reticulum during intracellular trafficking (21). Another type IIb RPTP, PTPκ, is also cleaved by a furin-like protease and further processed by an α-secretase of the A Disintegrin And Metalloproteinase domain (ADAM) family and a γ-secretase (23). The extracellular ADAM cleaves the P-subunit adjacent to the membrane to generate PΔE and shed the ectodomain (23). This cleavage primes PTPκ PΔE to be cleaved by γ-secretase, which releases the intracellular portion of PTPκ containing the active phosphatase domain from the membrane (23). The intracellular fragment of PTPκ translocates to the nucleus and controls β-catenin transcription (23). We previously observed a similar fragment of PTPμ containing the catalytically active intracellular domain (ICD) in the nucleus of a lung cell line (24).

We have previously shown that PTPμ protein is downregulated in glioblastoma (8). Here we show that overexpression of full-length PTPμ in glioblastoma cells suppresses cell migration and growth factor-independent cell survival. In addition, we propose that PTPμ downregulation in glioblastoma is the result of sequential cleavage of full-length PTPμ protein to generate the intracellular fragments PΔE and ICD. In support of this hypothesis, the intracellular fragments of PTPμ are present in human glioblastoma samples and glioblastoma xenograft flank tumors. Surprisingly, shRNA-mediated downregulation of PTPμ fragments decreases cell migration and growth factor-independent survival in glioblastoma cells. Furthermore, peptide inhibition of the function of PTPμ fragments inhibits cell migration. These data suggest that proteolytic cleavage of full-length PTPμ generates PTPμ fragments that regulate cell migration and growth factor-independent survival in glioblastoma. These PTPμ fragments can be targeted to develop novel therapeutic agents for glioblastoma patients.

MATERIALS AND METHODS

Cell lines

The human GBM cell lines U-87 MG and LN-229 were obtained from the American Type Culture Collection (ATCC, Manassas, VA). Human Gli36Δ5 glioblastoma cells have been described (25).

Lentiviral transduction

A human full-length PTPμ cDNA construct in pMT2 has been described (26). Full-length PTPμ was ligated into the lentiviral expression vector pCDH-MCS2 (System Biosciences, Mountain View, CA). A full-length PTPμ-green fluorescent protein (GFP) fusion construct has been described (27). The PTPμ-GFP cassette was subcloned into pCDH-MCS2. An intracellular PTPμ-GFP fusion construct corresponding to PTPμ ICD has been described (24). Lentiviral shRNA constructs and the production of VSV-G-pseudotyped lentiviral particles have been described (8).

Immunoblotting

Cell lysates were prepared and immunoblotted as described (8) using normalized samples of ~20 μg protein detected with monoclonal antibodies recognizing the intracellular segment of PTPμ (SK-7 or SK-18) (28). An antibody against vinculin was from Sigma-Aldrich (St. Louis, MO). The GFP antibody JL-8 was from Clontech (Mountain View, CA).

RT-PCR

RT-PCR was performed as described (8). The PCR primers were as follows: extracellular forward (CGCGAATTCTAGAGACGTTCTCAGGTGGC), extracellular reverse (CCCGCAAGCTTACTTCTTCTCGCACTTG), intracellular forward (CGCGGATCCAAAGAGACCATGAGCAGCACCCGA), and intracellular reverse (CCGGAATTCTCATCTGTTCTCATCTTTCTTAGCCGA).

Scratch wound assay

Scratch wound assays were performed as described (8). Confluent monolayers of cells were scratched to induce a wound and analyzed by microscopy for the distance migrated by the leading edge of the wound at 0 and 24 hrs.

Colony formation assays

Growth factor-independent clonogenic colony assays were performed as described (29). Crystal violet-stained colonies were imaged with the Quantity One imaging software of the Gel Doc imaging system (Bio-Rad, Hercules, CA). Images were quantitated using MetaMorph software (Molecular Devices) by measuring the thresholded area of each well to include only colonies. For the soft agarose assay, cells were seeded at a concentration of 75,000 cells/ml in 0.4% agarose and plated on an underlay of 0.8% agarose in a 6-well plate. Colonies were analyzed after four weeks by imaging Z-stacks of 20 random 10X fields using a Leica DMI6000B automated inverted microscope (Leica Microsystems GmbH, Wetzlar, Germany) attached to a Retiga EXi camera (QImaging, Surrey, BC, Canada). The number of colonies in minimized Z-stacks from each microscope field was recorded.

Biotinylation of cell surface proteins

Cell surface biotinylation was performed using a Sulfo-NHS-SS-Biotin Kit (Pierce). Biotinylated proteins were isolated and resolved by SDS-PAGE on 6% gels followed by immunoblotting with an antibody to PTPμ (SK-18) as described (30).

Inhibitors

The Furin Inhibitor I (Dec-RVKR-CMK, Calbiochem, Gibbstown, NJ) was used at 50 μM for 17–20 hours. The γ-secretase inhibitors DAPT (Sigma-Aldrich) and L-685,458 (Sigma-Aldrich) were used at 2 μM and 5 μM, respectively, for 17–20 hours. The proteasome was inhibited with MG132 (Sigma-Aldrich) at 20 μM or epoxomicin (Calbiochem) at 5 μM for 4 hours. GM6001 (Calbiochem) was used at 50 μM as an MMP/ADAM inhibitor for 17–20 hours. Inhibitors were reconstituted in DMSO, which was used as a vehicle control. An inhibitor of PTPμ function targeting the helix-loop-helix wedge domain has been demonstrated to inhibit PTPμ function (19, 20). The PTPμ wedge peptide and a scrambled control peptide were synthesized to include a membrane-penetrant Tat-derived sequence at the C-terminus to promote cellular uptake. Peptides synthesized by Genemed Synthesis (San Antonio, TX) or GenScript (Piscataway, NJ) were reconstituted in water and added to cells at a final concentration of 5 μM.

Immunoprecipitations

Cells were grown to confluence, treated with inhibitors, and lysed in 20mM Tris-HCL, pH 7.5, 1% Triton X-100, 150mM NaCl, 2mM EDTA, 1mM benzamidine, aprotinin (5 μg/ml), leupeptin (5 μg/ml) and pepstatin (1 μg/ml). Samples were sonicated and centrifuged at 10,000 rpm for 5 minutes. Immunoprecipitations from ~400 μg total protein were performed as described (27) using a PTPμ antibody (SK-18) and resolved by SDS-PAGE on 8% gels followed by immunoblotting with an antibody to PTPμ (SK-7).

Immunocytochemistry

Immunofluorescent cell staining was performed as described (24). Fixed cells were probed with SK-7 or SK-18, which recognize intracellular PTPμ, and detected with goat anti-mouse-Alexa 488 secondary antibody (Molecular Probes, Invitrogen). Slides were mounted with Citifluor Antifadent mounting medium (Electron Microscopy Sciences, Hatfield, PA) and imaged using the Leica system described above.

Tumor specimens

Fresh human brain and tumor tissue were obtained from surgical resections in accordance with an approved protocol from the University Hospitals Case Medical Center Institutional Review Board. GBM specimens of approximately 100mg each were obtained for protein extraction. Noncancerous, non-eloquent, cortical brain was also collected.

GBM xenograft tumors were grown in NIH athymic nude female mice in accordance with an approved protocol from the Case Western Reserve University Institutional Animal Care and Use Committee. LN-229 or Gli36Δ5 cells (2 × 106 cells) were resuspended in a 1:1 dilution of Matrigel (BD Biosciences; Franklin Lakes, New Jersey) in PBS and were injected subcutaneously in the right flank region of the mouse. Tumors were harvested between 9–28 days after injection. Lysates of human and xenograft tumor specimens were prepared as described (8). Tumor samples were homogenized using a tissue tearor homogenizer or a 2ml dounce homogenizer. Cleared lysates (~20 μg from human samples and ~50 μg from xenograft samples) were analyzed by immunoblot on 8% gels with an antibody to PTPμ (SK-18).

Statistics

Data presented represent at least three independent experiments. Replicates were normalized as a percent of the control, and the means were plotted using Microsoft Excel. Error bars indicate standard error. Data were analyzed for statistical significance using an unpaired student’s t-test.

RESULTS

PTPμ protein is downregulated in the human glioblastoma cell line LN-229

We recently demonstrated that PTPμ is endogenously expressed in the human GBM cell line U-87 MG and that shRNA-mediated downregulation of PTPμ in U-87 MG cells promotes cell migration and dispersal (8). Furthermore, PTPμ protein is downregulated in human GBM tumors and the migratory human GBM cell line LN-229. In the current study, PTPμ was overexpressed in LN-229 cells via a lentiviral construct, and both the full-length and normally produced P-subunit were detected by immunoblotting with an intracellular antibody to PTPμ (Fig. 1A). Lentiviral overexpression of PTPμ generated doublets at molecular weights corresponding to both full-length and P-subunit PTPμ (Fig. 1A). These doublets likely are due to post-translational modifications. mRNA expression of PTPμ was examined by RT-PCR in both U-87 MG and LN-229 cells. U-87 MG cells expressed PTPμ transcript as expected. Surprisingly, PTPμ transcript was also detected in LN-229 cells despite their lack of PTPμ protein expression (Fig. 1B). PTPμ shRNA downregulated PTPμ transcript but did not affect control GAPDH (Fig. 1C). These data suggest that the downregulation of PTPμ in glioblastoma is due to a post-transcriptional mechanism.

Figure 1
PTPμ expression is post-transcriptionally regulated. (A) Lysates from U-87 MG cells, parental LN-229 cells, and LN-229 cells overexpressing PTPμ were analyzed by immunoblotting. PTPμ was detected using an antibody to the intracellular ...

Overexpression of PTPμ suppresses cell migration and growth factor-independent cell survival

We demonstrated recently that shRNA-mediated downregulation of endogenous PTPμ in U-87 MG cells promotes cell migration (8). Based on this data, we hypothesized that overexpression of PTPμ in LN-229 cells would suppress cell migration. We evaluated this hypothesis using a scratch wound assay. Confluent monolayers of LN-229 cells overexpressing either vector or PTPμ were scratched to form a wound. After 24 hours, control LN-229 cells at the leading edge of the wound migrated an average of 150 μm (Fig. 2A). However, LN-229 cells overexpressing PTPμ had impaired migration with a 3-fold reduction in the distance migrated (Fig. 2A). Additionally, overexpression of PTPμ induced a morphological change in LN-229 cells and made the cells noticeably elongated (Fig. 2A). Because this assay occurred over 24 hours, it was possible that changes in cell proliferation could account for the difference in wound size. To rule out this possibility, LN-229 cells infected with vector or PTPμ were labeled with propidium iodide and analyzed by flow cytometry. Flow cytometry revealed no significant changes in cell proliferation between the vector- and PTPμ-infected cells (data not shown). Therefore, we concluded that the difference in wound size was due to a decrease in migration resulting from PTPμ overexpression, indicating PTPμ suppresses migration of LN-229 glioblastoma cells.

Figure 2
Overexpression of PTPμ suppresses glioblastoma cell migration and growth factor-independent survival. (A) Confluent monolayers of LN-229 cells expressing vector or PTPμ were scratched and imaged at 0 and 24 hours. Dashed lines indicate ...

Growth factor-independent survival is a hallmark of tumorigenesis. To assess the effect of PTPμ overexpression on growth factor-independent survival, a colony formation assay was used. After two weeks of growth factor deprivation, control LN-229 cells formed abundant colonies (Fig. 2B). In contrast, overexpression of PTPμ reduced colony formation by 2-fold (Fig. 2B). Therefore, PTPμ overexpression suppresses migration in two-dimensional culture and reduces growth factor-independent survival in three-dimensional culture of glioblastoma cells.

Proteolysis of PTPμ contributes to its downregulation in glioblastoma

Other receptor tyrosine phosphatases are sequentially cleaved by a furin-like protease, an ADAM-type matrix metalloproteinase (MMP), and a γ-secretase to release a soluble intracellular fragment (23, 31, 32). Since GBMs are known to have upregulated proteases (33), we hypothesized that constitutive proteolysis of PTPμ may be the mechanism of PTPμ downregulation in GBM. We first determined whether full-length PTPμ could be detected in parental LN-229 cells. Since we cannot detect PTPμ in a total cell lysate of parental LN-229 cells, we biotinylated cell surface proteins and used avidin resin to enrich the pool of biotinylated cell surface proteins. Despite the lack of PTPμ in the total cell lysate, the biotinylated cell surface fraction contained trace amounts of PTPμ (Fig. 3A). PTPμ is known to be cleaved by a furin-like protease to generate the E- and P- subunits of PTPμ (11, 21, 22). As expected, treatment of cells with an inhibitor of furin activity resulted in an accumulation of full-length PTPμ (200 kDa) at the cell surface. These data imply there is a trace amount of endogenous PTPμ in LN-229 cells that is processed by proteolysis. Biotinylation of cell surface proteins from LN-229 cells overexpressing PTPμ showed a similar pattern of full-length PTPμ accumulation at the cell surface upon furin inhibition (Fig. 3A).

Figure 3
PTPμ is proteolytically processed to release a catalytically active intracellular fragment from the membrane. (A) Lysates from parental LN-229 cells and LN-229 cells overexpressing PTPμ were biotinylated and immunoblotted for PTPμ ...

After furin cleavage, PTPκ, another PTPμ-subfamily member, is subsequently cleaved by α- and γ-secretases (23). We hypothesized that PTPμ is cleaved similarly. To test this hypothesis, LN-229 cells were treated with inhibitors of α- and γ-secretases. Proteasome inhibitors were used for biochemical detection to prevent rapid degradation of these fragments (23). Since we cannot detect PTPμ in whole cell lysates, the PTPμ fragments were immunoprecipitated from LN-229 cells treated with inhibitors using antibody to the intracellular domain of PTPμ. The γ-secretase inhibitor DAPT stabilized a fragment that corresponds by molecular weight to a membrane-tethered truncated P-subunit termed PΔE (Fig. 3B). Treatment with the proteasome inhibitor MG132 led to the accumulation of both PΔE and a soluble fragment termed PTPμ intracellular domain (ICD) (Fig. 3B). The MMP inhibitor GM6001 limited the formation of PTPμ PΔE and ICD fragments, indicating cleavage by an MMP is required for subsequent processing (Fig. 3B). MG132 has been reported to inhibit γ-secretase activity in addition to proteasome activity, leading to the accumulation of α- and γ-secretase products (23, 34). Subsequent experiments included a more specific proteasome inhibitor, epoxomicin, to distinguish these events. Overall, these data support our hypothesis that the endogenous PTPμ expressed in LN-229 cells is constitutively cleaved to generate PTPμ PΔE and ICD. As a result, little full-length PTPμ is present to function at the cell surface in LN-229 cells.

Total cell lysates from LN-229 cells overexpressing PTPμ showed a similar pattern of cleavage products upon inhibitor treatment (Fig. 3C). Stabilization of PTPμ ICD with treatment of epoxomicin confirmed that this fragment is labile and can only be seen when stabilized by the addition of a proteasome inhibitor. Treatment with MG132 and γ-secretase inhibitors (DAPT and L685,458) showed accumulation of PTPμ PΔE and ICD (Fig. 3C). To verify the cleavage products include the C-terminus of the intracellular domain of PTPμ, we overexpressed a PTPμ construct with a C-terminal GFP-tag (PTPμ-GFP) in LN-229 cells. Cells expressing PTPμ-GFP were treated with inhibitors as above, and total cell lysates were immunoblotted with GFP to detect the PTPμ-GFP fragments. A GFP antibody detected a similar pattern of fragments, suggesting PTPμ PΔE and ICD fragments include the C-terminus of PTPμ (Figure 3C). These data support the model depicted in Figure 3D. Full-length PTPμ is cleaved by a furin-like protease to generate the E- and P-subunits in “normal” proteolytic processing. Cleavage by an ADAM-type MMP (α-secretase) in GBM cells generates PTPμ PΔE. Subsequently, PΔE is cleaved by γ-secretase to generate PTPμ ICD.

PTPμ ICD is a soluble fragment that translocates to the nucleus in another cell type (24). To determine the subcellular localization of PTPμ ICD in glioblastoma cells, we performed immunocytochemistry on LN-229 cells. Antibodies recognizing the juxtamembrane (SK-7) and first phosphatase (SK-18) domains of PTPμ detected an endogenous PTPμ species with a nuclear pattern of localization similar to DAPI-stained nuclei (Fig. 4A). The epitopes of these antibodies suggest that this species is PTPμ ICD. Overexpression of GFP-tagged PTPμ ICD also localized to the nucleus and confirmed these findings. In contrast, overexpression of GFP-tagged full-length PTPμ resulted in a cell-cell contact and filopodial staining pattern as reported previously (35). Full-length PTPμ likely senses extracellular adhesive cues to suppress migration by contact inhibition, whereas PTPμ ICD distributes to the cytoplasm and nucleus. These data suggest that full-length PTPμ and PTPμ ICD have distinct localization patterns, potentially leading to differences in their downstream signaling.

Figure 4
PTPμ ICD localizes to the nucleus, and PΔE and ICD are expressed in human glioblastoma tumors and glioblastoma xenografts. (A) LN-229 cells expressing endogenous ICD were analyzed by immunocytochemistry using intracellular antibodies to ...

Intracellular fragments of PTPμ are expressed in human glioblastoma tumors and glioblastoma xenograft tumors

We previously demonstrated that PTPμ protein expression is downregulated in human GBM tumor samples (8). However, immunoblotting fresh GBM tumor tissue lysates on higher percentage gels indicated that fragments of PTPμ corresponding to PTPμ PΔE and ICD are expressed in human GBM tumor samples in comparison to normal brain tissue from the same patient (Fig. 4B). Full-length PTPμ was undetectable in these GBM tumor samples (Fig. 4B). PTPμ PΔE and ICD were identified in normal tissue samples that retain significant expression of full-length PTPμ (Fig. 4B). Therefore, it is the expression of full-length PTPμ that differs between normal brain and GBM tumor tissue. Normal brain tissue expresses full-length PTPμ, whereas GBM tumor tissue does not express full-length PTPμ but retains PTPμ PΔE and ICD.

Neither full-length PTPμ nor PTPμ PΔE and ICD are detectable in LN-229 total cell lysates by immunoblot. We assessed human GBM cell line tumor xenografts grown in mouse flanks to determine if the three-dimensional architecture of the tumor would stabilize PTPμ fragments in the GBM cells. Flank tumor lysates from LN-229 xenografts expressed little detectable full-length PTPμ but expressed abundant PTPμ PΔE and ICD (Fig. 4C). Similar results were obtained using xenografts prepared with another glioma cell line, Gli36Δ5 (Fig. 4C). These data suggest that three-dimensional human glioblastoma tumors and in vivo glioblastoma tumor models favor PTPμ proteolysis and stabilize PTPμ ICD and its precursor, PΔE, in vivo.

PTPμ fragments contribute to glioblastoma cell migration and both growth factor-independent and anchorage-independent cell survival

PTPμ ICD is a soluble fragment generated from PΔE that translocates to the nucleus (Fig. 4A). PTPμ ICD contains the catalytic domain of PTPμ and has the potential to signal differently than that of membrane-bound, cell surface-associated PTPμ due to changes in substrate availability in different cellular compartments. Overexpression of membrane-bound, cell surface-associated PTPμ suppressed GBM cell migration and growth factor-independent survival (Fig. 2). We hypothesized that PTPμ ICD and its precursor, PΔE, may signal differently and affect the migration and growth factor-independent survival of GBM cells. First, the effect of PTPμ fragments on cell migration was analyzed using a scratch wound assay.

PTPμ mRNA is expressed in LN-229 cells, but the only detectable proteins are PTPμ fragments (Fig. 4). Therefore, we were able to use shRNA to downregulate PTPμ fragments. Confluent monolayers of LN-229 cells expressing either control or two different PTPμ shRNA constructs were scratched and allowed to migrate (Fig. 5A). Downregulation of PTPμ fragments by both shRNA constructs suppressed cell migration by 2-fold (Fig. 5A). To rule out changes in cell proliferation, LN-229 cells infected with control or PTPμ shRNA were labeled with propidium iodide and analyzed by flow cytometry. No significant changes in cell proliferation were detected (data not shown).

Figure 5
PTPμ fragments contribute to glioblastoma cell migration and both growth factor- and anchorage-independent cell survival. (A) Confluent monolayers of LN-229 cells expressing control or PTPμ shRNA constructs were scratched and imaged at ...

Both PTPμ PΔE and ICD are partially stabilized by the γ-secretase inhibitor DAPT and are not formed when ADAMs are inhibited (Fig. 3B). These inhibitors were used in a scratch wound assay to analyze their effects on PTPμ fragment-mediated cell migration. Stabilization of PTPμ fragments with DAPT increased migration, and prevention of PTPμ fragment formation by GM6001 decreased migration (Supplemental Fig. 1). These data suggest that proteolysis of PTPμ promotes LN-229 cell migration.

Because PTPμ overexpression affected growth factor-independent cell survival, we hypothesized that PTPμ fragments may also affect cell survival. To test this hypothesis, LN-229 cells expressing control or PTPμ shRNA were seeded at low density and allowed to form colonies over two weeks (Fig. 5B). Downregulation of PTPμ fragments via shRNA reduced the number of colonies in comparison to control cells by 3-fold (Fig. 5B). These findings were confirmed in a soft agarose assay for anchorage-independent survival. PTPμ shRNA reduced the number of colonies in this assay by 5-fold (Fig. 5C). These data suggest PTPμ fragments promote both cell migration and growth factor-independent survival of glioblastoma cells.

Catalytic activity of PTPμ fragments is required for glioblastoma cell migration

Soluble intracellular PTPμ has been demonstrated to retain catalytic activity (24, 28). To examine whether the catalytic activity of PTPμ fragments is important in the regulation of cell migration, PTPμ function was inhibited using a PTPμ-specific peptide inhibitor (19). Confluent monolayers of LN-229 cells were treated with a membrane-penetrant PTPμ wedge peptide or a control scrambled peptide prior to scratching to induce a wound (Fig. 6). The PTPμ wedge peptide significantly reduced migration of LN-229 cells (Fig. 6). This suppression is likely due to inhibition of the signaling of the PTPμ fragments as they are the only detectable PTPμ protein stabilized in LN-229 cells (Fig. 4). These data suggest that PTPμ fragments must be catalytically active to induce GBM cell migration. Therefore, the wedge peptide inhibitor of PTPμ may have therapeutic value in the treatment of human glioblastoma.

Figure 6
PTPμ fragment-induced migration of glioblastoma cells is abrogated by a peptide inhibitor of PTPμ function. Confluent monolayers of LN-229 cells were treated with the PTPμ wedge inhibitor peptide or a scrambled control, scratched ...

DISCUSSION

Downregulation of PTPμ in a human glioblastoma cell line that expresses PTPμ was reported to induce cell migration and dispersal (8). In this study, we demonstrate that overexpression of PTPμ suppresses migration and growth factor-independent survival of glioblastoma cells. Furthermore, downregulation of PTPμ in GBM is due to proteolytic processing into a series of fragments. Human glioblastoma tumor samples selectively retain PTPμ fragments, both ICD and its precursor, PΔE, in comparison to patient matched normal brain tissue. In the absence of full-length PTPμ, this PTPμ fragment signal promotes cell migration and growth factor-independent survival. The balance of full-length PTPμ and PTPμ fragment signaling is likely important in regulating the contact inhibition switch between cell adhesion and cell migration.

The receptor tyrosine phosphatases PTPκ, PTP ζ/β, and LAR are regulated by sequential proteolysis (23, 31, 32). Furthermore, other transmembrane receptors such as Notch are similarly cleaved. Notch signaling is regulated by sequential cleavage by furin, ADAMs, and γ-secretase that ultimately generates an intracellular fragment (36). This fragment translocates to the nucleus and regulates the CBF1 transcription complex to control cellular processes such as differentiation and tumorigenesis (37). This regulation of cell surface receptors by proteolysis during development might be recapitulated during tumorigenesis as GBM cells have de-differentiated, stem cell-like characteristics (3).

Differences in full-length PTPμ and PTPμ fragment signaling likely depend upon the availability of PTPμ binding partners and downstream effectors. Furthermore, as a homophilic cell adhesion molecule, it may be that cell surface PTPμ and PTPμ fragment signaling pathways regulate the adhesive versus migratory switch of contact inhibited or dispersive cells, respectively. Cell surface PTPμ binds and regulates cadherins and catenins (12), key components of classical adherens junctions. Four classical cadherin subtypes, E-, N-, R-, and VE-cadherin, associate with PTPμ (35, 3840). The cadherin binding partner p120-catenin (p120) has been implicated as a PTPμ binding partner and substrate (41) and contributes to tumorigenesis by regulating cell migration (42). p120 can translocate to the nucleus and associate with the transcription factor Kaiso (43). Interestingly, a proteolytically cleaved intracellular fragment of E-cadherin requires p120 for its nuclear translocation (44). The cytoplasmic domain of N-cadherin can also be proteolytically processed and translocate to the nucleus (45). p120 is involved in the recruitment of γ-secretase to N-cadherin for its cleavage (46). It is interesting to speculate that PTPμ fragments generated from the proteolytic cleavage of PTPμ may regulate a nuclear complex of N-cadherin and p120 given that PTPμ interacts with cadherins and p120 via its intracellular domain (35, 41). Computer-based searches for a canonical nuclear localization sequence (NLS) in PTPμ were unsuccessful. However, both p120 and another PTPμ-interacting protein, BCCIP (24), contain NLS motifs (47, 48). The yeast homologue of BCCIP has been demonstrated to regulate nuclear export (49). Therefore, p120 and BCCIP may aid in the shuttling of PTPμ ICD in and out of the nucleus.

Migration and dispersal of glioblastoma cells remains a clinical problem due to the lack of effective specific therapies (13). Individual glioblastoma cells migrate and disperse throughout the brain parenchyma to form new foci. These cells must have elevated growth factor-independent survival signaling to evade anoikis-mediated cell death and to clonally expand. Therefore, it is interesting that both migration and growth factor-independent survival pathways are regulated by PTPμ fragments. Furthermore, a peptide inhibitor targeting PTPμ fragment function reduces cell migration. A small molecule inhibitor that mimics this peptide will be developed to target PTPμ fragments and suppress glioblastoma cell migration and dispersal in vivo. Such an advance in the field of targeted therapeutics would fulfill a vast need for specific therapy in glioblastoma treatment.

Supplementary Material

Acknowledgments

This research was supported by the National Institutes of Health Grant R01-NS051520 (S.M.B.-K., S.R., and R.H.M.). Additional support was obtained from the Visual Sciences Research Center Core Grant P30-EY11373 and the Case Comprehensive Cancer Center Core Grant P30-CA043703 from the National Institutes of Health. A.E.S. was supported by funding from National Cancer Institute Grants K08-CA101954 and R01-CA116257, the Ivy Brain Tumor Foundation, and the Cancer Genome Atlas (TCGA) Project. A.M.B. was supported in part by National Institutes of Health Grants T32-GM007250 (MSTP) and T32-CA059366.

We thank Dr. Moonkyung Caprara, Carol Luckey, and Theresa Gates for technical support. We thank Sara Lou and Scott Howell for help with figures and graphs, as well as members of the Brady-Kalnay lab for insightful discussions. This manuscript is dedicated to Tabitha Yee-May Lou who recently lost her battle with glioblastoma.

References

1. Louis DN. Molecular pathology of malignant gliomas. Annu Rev Pathol. 2006;1:97–117. [PubMed]
2. Wen PY, Kesari S. Malignant gliomas in adults. N Engl J Med. 2008;359:492–507. [PubMed]
3. Furnari FB, Fenton T, Bachoo RM, et al. Malignant astrocytic glioma: genetics, biology, and paths to treatment. Genes Dev. 2007;21:2683–710. [PubMed]
4. Louis DN, Ohgaki H, Wiestler OD, Cavenee WK. World Health Organization Classification of Tumours of the Nervous System. 4. Lyon: IARC; 2007.
5. Ohgaki H, Kleihues P. Genetic pathways to primary and secondary glioblastoma. Am J Pathol. 2007;170:1445–53. [PubMed]
6. Nakada M, Nakada S, Demuth T, Tran NL, Hoelzinger DB, Berens ME. Molecular targets of glioma invasion. Cell Mol Life Sci. 2007;64:458–78. [PubMed]
7. Sathornsumetee S, Rich JN. Designer therapies for glioblastoma multiforme. Ann N Y Acad Sci. 2008;1142:108–32. [PubMed]
8. Burgoyne AM, Palomo JM, Phillips-Mason PJ, et al. PTPmu suppresses glioma cell migration and dispersal. Neuro Oncol. 2009 [PMC free article] [PubMed]
9. Gebbink MF, Zondag GC, Wubbolts RW, Beijersbergen RL, van Etten I, Moolenaar WH. Cell-cell adhesion mediated by a receptor-like protein tyrosine phosphatase. J Biol Chem. 1993;268:16101–4. [PubMed]
10. Brady-Kalnay SM, Flint AJ, Tonks NK. Homophilic binding of PTPμ, a receptor-type protein tyrosine phosphatase, can mediate cell-cell aggregation. J Cell Biol. 1993;122:961–72. [PMC free article] [PubMed]
11. Brady-Kalnay SM, Tonks NK. Identification of the homophilic binding site of the receptor protein tyrosine phosphatase PTPμ J Biol Chem. 1994;269:28472–7. [PubMed]
12. Ensslen-Craig SE, Brady-Kalnay SM. Receptor protein tyrosine phosphatases regulate neural development and axon guidance. Dev Biol. 2004;275:12–22. [PubMed]
13. Sallee JL, Wittchen ES, Burridge K. Regulation of cell adhesion by protein-tyrosine phosphatases: II. Cell-cell adhesion J Biol Chem. 2006;281:16189–92. [PubMed]
14. Tonks NK. Protein tyrosine phosphatases: from genes, to function, to disease. Nat Rev Mol Cell Biol. 2006;7:833–46. [PubMed]
15. Ostman A, Hellberg C, Bohmer FD. Protein-tyrosine phosphatases and cancer. Nat Rev Cancer. 2006;6:307–20. [PubMed]
16. Aricescu AR, Siebold C, Jones EY. Receptor protein tyrosine phosphatase μ: measuring where to stick. Biochem Soc Trans. 2008;36:167–72. [PubMed]
17. Alonso A, Sasin J, Bottini N, et al. Protein tyrosine phosphatases in the human genome. Cell. 2004;117:699–711. [PubMed]
18. Tiganis T, Bennett AM. Protein tyrosine phosphatase function: the substrate perspective. Biochem J. 2007;402:1–15. [PubMed]
19. Xie Y, Massa SM, Ensslen-Craig SE, et al. Protein-tyrosine phosphatase (PTP) wedge domain peptides: a novel approach for inhibition of PTP function and augmentation of protein-tyrosine kinase function. J Biol Chem. 2006;281:16482–92. [PubMed]
20. Oblander SA, Ensslen-Craig SE, Longo FM, Brady-Kalnay SM. E-cadherin promotes retinal ganglion cell neurite outgrowth in a protein tyrosine phosphatase-mu-dependent manner. Mol Cell Neurosci. 2007;34:481–92. [PMC free article] [PubMed]
21. Campan M, Yoshizumi M, Seidah NG, Lee ME, Bianchi C, Haber E. Increased proteolytic processing of protein tyrosine phosphatase μ in confluent vascular endothelial cells: the role of PC5, a member of the subtilisin family. Biochemistry (Mosc) 1996;35:3797–802. [PubMed]
22. Gebbink MF, Zondag GC, Koningstein GM, Feiken E, Wubbolts RW, Moolenaar WH. Cell surface expression of receptor protein tyrosine phosphatase RPTPμ is regulated by cell-cell contact. J Cell Biol. 1995;131:251–60. [PMC free article] [PubMed]
23. Anders L, Mertins P, Lammich S, et al. Furin-, ADAM 10-, and γ-secretase-mediated cleavage of a receptor tyrosine phosphatase and regulation of β-catenin’s transcriptional activity. Mol Cell Biol. 2006;26:3917–34. [PMC free article] [PubMed]
24. Phillips-Mason PJ, Mourton T, Major DL, Brady-Kalnay SM. BCCIP associates with the receptor protein tyrosine phosphatase PTPμ J Cell Biochem. 2008;105:1059–72. [PMC free article] [PubMed]
25. Tyminski E, Leroy S, Terada K, et al. Brain tumor oncolysis with replication-conditional herpes simplex virus type 1 expressing the prodrug-activating genes, CYP2B1 and secreted human intestinal carboxylesterase, in combination with cyclophosphamide and irinotecan. Cancer Res. 2005;65:6850–7. [PubMed]
26. Gebbink MF, van Etten I, Hateboer G, et al. Cloning, expression and chromosomal localization of a new putative receptor-like protein tyrosine phosphatase. FEBS Lett. 1991;290:123–30. [PubMed]
27. Hellberg CB, Burden-Gulley SM, Pietz GE, Brady-Kalnay SM. Expression of the receptor protein-tyrosine phosphatase, PTPμ, restores E-cadherin-dependent adhesion in human prostate carcinoma cells. J Biol Chem. 2002;277:11165–73. [PubMed]
28. Brady-Kalnay SM, Tonks NK. Purification and characterization of the human protein tyrosine phosphatase, PTPμ, from a baculovirus expression system. Mol Cell Biochem. 1993;127–128:131–41. [PubMed]
29. Franken NA, Rodermond HM, Stap J, Haveman J, van Bree C. Clonogenic assay of cells in vitro. Nat Protoc. 2006;1:2315–9. [PubMed]
30. Yu J, Becka S, Zhang P, Zhang X, Brady-Kalnay SM, Wang Z. Tumor-derived extracellular mutations of PTPRT/PTPρ are defective in cell adhesion. Mol Cancer Res. 2008;6:1106–13. [PMC free article] [PubMed]
31. Chow JP, Fujikawa A, Shimizu H, Suzuki R, Noda M. Metalloproteinase- and gamma-secretase-mediated cleavage of protein-tyrosine phosphatase receptor type Z. J Biol Chem. 2008;283:30879–89. [PMC free article] [PubMed]
32. Haapasalo A, Kim DY, Carey BW, Turunen MK, Pettingell WH, Kovacs DM. Presenilin/γ-secretase-mediated cleavage regulates association of leukocyte-common antigen-related (LAR) receptor tyrosine phosphatase with β-catenin. J Biol Chem. 2007;282:9063–72. [PubMed]
33. Rao JS. Molecular mechanisms of glioma invasiveness: the role of proteases. Nat Rev Cancer. 2003;3:489–501. [PubMed]
34. Kopan R, Schroeter EH, Weintraub H, Nye JS. Signal transduction by activated mNotch: importance of proteolytic processing and its regulation by the extracellular domain. Proc Natl Acad Sci U S A. 1996;93:1683–8. [PubMed]
35. Brady-Kalnay SM, Rimm DL, Tonks NK. Receptor protein tyrosine phosphatase PTPμ associates with cadherins and catenins in vivo. J Cell Biol. 1995;130:977–86. [PMC free article] [PubMed]
36. Roy M, Pear WS, Aster JC. The multifaceted role of Notch in cancer. Curr Opin Genet Dev. 2007;17:52–9. [PubMed]
37. Shih Ie M, Wang TL. Notch signaling, γ-secretase inhibitors, and cancer therapy. Cancer Res. 2007;67:1879–82. [PubMed]
38. Brady-Kalnay SM, Mourton T, Nixon JP, et al. Dynamic interaction of PTPμ with multiple cadherins in vivo. J Cell Biol. 1998;141:287–96. [PMC free article] [PubMed]
39. Sui XF, Kiser TD, Hyun SW, et al. Receptor protein tyrosine phosphatase μ regulates the paracellular pathway in human lung microvascular endothelia. Am J Pathol. 2005;166:1247–58. [PubMed]
40. Hiscox S, Jiang WG. Association of PTPmu with catenins in cancer cells: a possible role for E-cadherin. Int J Oncol. 1998;13:1077–80. [PubMed]
41. Zondag GC, Reynolds AB, Moolenaar WH. Receptor protein-tyrosine phosphatase RPTPμ binds to and dephosphorylates the catenin p120(ctn) J Biol Chem. 2000;275:11264–9. [PubMed]
42. van Hengel J, van Roy F. Diverse functions of p120ctn in tumors. Biochim Biophys Acta. 2007;1773:78–88. [PubMed]
43. Daniel JM, Reynolds AB. The catenin p120(ctn) interacts with Kaiso, a novel BTB/POZ domain zinc finger transcription factor. Mol Cell Biol. 1999;19:3614–23. [PMC free article] [PubMed]
44. Ferber EC, Kajita M, Wadlow A, et al. A role for the cleaved cytoplasmic domain of E-cadherin in the nucleus. J Biol Chem. 2008 [PMC free article] [PubMed]
45. Uemura K, Kihara T, Kuzuya A, et al. Characterization of sequential N-cadherin cleavage by ADAM10 and PS1. Neurosci Lett. 2006;402:278–83. [PubMed]
46. Kouchi Z, Barthet G, Serban G, Georgakopoulos A, Shioi J, Robakis NK. p120 Catenin Recruits Cadherins to γ-Secretase and Inhibits Production of Aβ Peptide. J Biol Chem. 2009;284:1954–61. [PMC free article] [PubMed]
47. Kelly KF, Spring CM, Otchere AA, Daniel JM. NLS-dependent nuclear localization of p120ctn is necessary to relieve Kaiso-mediated transcriptional repression. J Cell Sci. 2004;117:2675–86. [PubMed]
48. Ono T, Kitaura H, Ugai H, et al. TOK-1, a novel p21Cip1-binding protein that cooperatively enhances p21- dependent inhibitory activity toward CDK2 kinase. J Biol Chem. 2000;275:31145–54. [PubMed]
49. Audhya A, Emr SD. Regulation of PI4,5P2 synthesis by nuclear-cytoplasmic shuttling of the Mss4 lipid kinase. EMBO J. 2003;22:4223–36. [PubMed]