PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Neuropsychopharmacology. Author manuscript; available in PMC 2009 November 1.
Published in final edited form as:
PMCID: PMC2746694
NIHMSID: NIHMS92054

Drug-induced activation of dopamine D1 receptor signaling and inhibition of class I/II histone deacetylase induces chromatin remodeling in reward circuitry and modulates cocaine-related behaviors

Abstract

Chromatin remodeling, including histone modification, is involved in stimulant-induced gene expression and addiction behavior. To further explore the role of dopamine D1 receptor signaling, we measured cocaine-related locomotor activity and place preference in mice pre-treated for up to 10 days with the D1-agonist SKF82958 and/or the histone deacetylase inhibitor (HDACi), sodium butyrate. Co-treatment with D1-agonist and HDACi significantly enhanced cocaine-induced locomotor activity and place preference, in comparison to single drug regimens. However, butyrate-mediated reward effects were transient and only apparent within 2 days after the last HDACi treatment. These behavioral changes were associated with histone modification changes in striatum and ventral midbrain: (1) a generalized increase in H3 phospho-acetylation in striatal neurons was dependent on activation of D1 receptors; (2) H3 de-acetylation at promoter sequences of tyrosine hydroxylase (Th) and brain-derived neurotrophic factor (Bdnf) in ventral midbrain, together with up-regulation of the corresponding gene transcripts after co-treatment with D1-agonist and HDACi. Collectively, these findings imply that D1-receptor-regulated histone (phospho)acetylation and gene expression in reward circuitry is differentially regulated in a region-specific manner. Given that the combination of D1-agonist and HDACi enhances cocaine-related sensitization and reward, the therapeutic benefits of D1-receptor antagonists and histone acetyl-transferase inhibitors (HATi) warrants further investigation in experimental models of stimulant abuse.

Keywords: epigenetic, addiction, catecholamine, sensitization, chromatin immunoprecipitation, basal ganglia

INTRODUCTION

To date, the molecular mechanisms that underlie cocaine and other stimulant addiction become increasingly clear but current pharmacological treatment options remain surprisingly limited. Therefore, it will be important to further elucidate the molecular pharmacology of cocaine addiction in pre-clinical models. Among the various drug-based interventions that modulate the animal's response to cocaine are two radically different classes of compounds – dopamine D1 receptor agonists and histone protein deacetylase inhibitors (HDACi). Notably, D1 agonist drugs elicit reward functions, including reinstatement of cocaine-related addiction behavior (Self and Stein, 1992; Graham et al., 2007) and the importance of D1-mediated signaling for the neurobiology of stimulant abuse is established by various genetic and pharmacological approaches (Hummel and Unterwald, 2002). Importantly, the neurochemical and behavioral adaptations in response to stimulant or D1 agonist exposure are thought to result, at least in part, from changes in gene expression affecting dopaminergic circuitry, including ventral midbrain and the striatum and other major target zones within the forebrain. Recently, it was recognized that among these cocaine-sensitive transcriptional mechanisms, histone acetylation and other chromatin remodeling events are of particular importance; for example, pharmacological inhibition, or genetic ablation of class I/II histone deacetylases enhances cocaine-related behavioral sensitization and reward (Kumar et al., 2005; Renthal et al., 2007). Conversely, striatal overexpression of histone deacetylase (HDAC) or genetic ablation of histone acetyl-transferases, including Cbp, attenuates the animal's response to cocaine (Kumar et al., 2005; Levine et al., 2005).

However, it is not known whether or not these two reward-enhancing drug types – D1 receptor agonists and HDAC inhibitors operate synergistically or independently. Therefore, it was the goal of this study to understand how drug-induced changes in D1-receptor signaling and histone deacetylase activity modulate the animal's behavioral and molecular responses to cocaine. We applied, in C57Bl6/J mice, two cocaine-related behavioral assays – locomotor sensitization and place preference. The molecular studies were conducted on ventral midbrain at the level of the substantia nigra/ventral tegmental area (SN/VTA) and striatum (including but not limited to the nucleus accumbens)(Winder et al., 2002; Kalivas and Volkow, 2005) – two key regions of the brain's reward circuitry. Specifically, we examined drug-induced changes in nucleosome core histone H3 and H4 acetylation and phospho-acetylation, two types of modifications previously linked to changes in dopaminergic signaling(Li et al., 2004; Brami-Cherrier et al., 2005; Kumar et al., 2005; Levine et al., 2005; Santini et al., 2007).

Our results indicate that combined D1 receptor activation and HDAC inhibition was associated with a heterogeneous set of region-specific chromatin remodeling mechanisms, including a generalized histone phospho-acetylation response in striatal neurons and histone deacetylation in SN/VTA chromatin at promoters of tyrosine hydroxylase (Th) and brain-derived neurotrophic factor (Bdnf) – two genes with a key role for drug-induced plasticity(Self et al., 2004; Corominas et al., 2007). However, changes in cocaine-related behaviors after previous exposure to D1 agonist with or without HDACi co-treatment were complex, because the two different types of drugs exerted a synergistic effect in some but not all behavioral assays. These differences were, at least in part, explained by the observation that butyrate-mediated reward effects were transient and only apparent within 2 days after the last HDACi treatment.

Methods and Materials

Drugs

SB, or N-Butyric Acid sodium salt, and SKF, or Chloro-APB Hydrobromide (±)-SKF-82958 hydrobromide, or cocaine (Sigma-Aldrich) were dissolved in saline and prepared fresh each day. For this study, SKF was chosen as a full D1-like agonist and SB was chosen as a class I/II HDAC inhibitor. Other drugs included in this study were the PKA inhibitor N-[2-(p-bromocinnamylamino)ethyl]-5-isoquinolinesulfonamide dihydrochloride, (H89) and the NMDA receptor antagonist [(+)MK 801 hydrogen maleate] (MK-801), both dissolved in DMSO.

Animals

All experimental procedures were approved by the Institutional Animal Care and Use Committee of the University of Massachusetts. For all experiments with the D1 receptor agonist SKF82958, male C57BL/6J mice, age 9−15 weeks, were used. Animals were purchased directly from the Jackson Laboratory, Bar Harbor (Maine), and housed in groups of 2−4 per cage with food and water ad libitum under 12-hour light/dark cycle. For behavioral experiments, mice received i.p. injections with SB (100mg/kg or 25 mg/kg) or saline followed 15 min later by SKF (0.25mg/kg) or saline once daily for 10 days. For the remaining experiments, mice received i.p. injections with SKF (1 mg/kg) or saline as vehicle, with or without concomitant SB (200mg/kg or 25 mg/kg), as single dose or once daily for 2−10 days.

For tissue extraction, animals were sacrificed by cervical dislocation/decapitation and whole brain was removed and processed immediately or snap-frozen on dry ice. Striatum was dissected unilaterally from coronal slices positioned between Bregma 1.18mm and − 0.46mm; Ventral midbrain was dissected from coronal slices positioned between Bregma −2.80mm and −3.80mm and ventral to the dorsal 3rd ventricle; the dissected blocks of tissue thus included the full rostro-caudal and dorso-ventral extent of the substantia nigra and the ventral tegmental area (SN/VTA) (Paxinos and Franklin, 2001).

Behavioral Testing

Tests were conducted during the light cycle between 7:30am and 2:30pm. Depending on the drug and test, 8−10 animals per experiment were used, with a matched number of saline-treated control subjects.

Locomotor activity

Animals were placed in clean, 19.1×29.2×12.7cm shoebox-style cages (Allentown, Inc., Allentown, NJ) and locomotor activity measured continuously for 190 min (from t = 0 min to t = 190 min) using a photobeam activity system (San Diego Instruments, San Diego, CA). All mice were placed in activity cages and allowed to habituate for 75 minutes prior to any injection. To assay the effects of SB and SKF pretreatment on cocaine-induced locomotion, mice were first introduced to the test and injected with saline at t = 90 min to record basal activity (day zero). The next day, a 10-day pretreatment period was initiated with daily i.p. injections of: i, Sal+SKF; ii, SB+SKF; iii, SB+Sal; or iv, Sal+Sal, each at t = 75 min and t = 90 min, respectively. During pretreatment, activity was measured on days 1, 2, 5, 7 and 10. On day 11, animals were placed in activity cages, saline injected at t = 75 min followed by cocaine (15mg/kg) at t = 90 min, and activity measured for 190 min total.

Conditioned Place Preference

The conditioned place preference (CPP) test apparatus consisted of a rectangular cage with overall inside dimensions of 46.5 × 12.7 × 12.7cm (med-associates, St. Albans, VT). This included a center neutral gray compartment, 7.2cm long, and a hinged clear polycarbonate lid for loading the test animal. The adjacent conditioning compartments measured 16.8 cm long. One compartment was black with a stainless steel grid rod floor and the other white with a square stainless steel mesh floor. Chambers were equipped with photobeams to measure activity and time spent in each chamber. Guillotine doors separated the chambers and could be fixed in the closed or opened position. The apparatus was placed in a sound attenuation cubicle.

Two cocaine-related CPP paradigms were used in the present study, with the main difference being the timeline of SKF and SB treatments:

  • Paradigm 1: Preceding CPP testing, all animals were treated for 10 days with daily injections of: Sal+SKF or SB+SKF or Sal+Sal as described above. Then, CPP was tested in three stages over a 6-day period. In the first stage, each mouse was placed in the central compartment and allowed free access to all chambers. The time spent in each chamber was then recorded over a 20 min period. During the second stage, i.p. injections of cocaine (5mg/kg) were paired with one of the conditioning chambers and saline injections paired with the other. Each mouse received cocaine injections and was placed in the isolated cocaine-conditioning chamber on day 3 and 5; each mouse received saline injections and was placed in the saline chamber on day 2 and 4. Each training trial lasted 20 min. During stage 3, the testing phase, each mouse was once again given free access to all chambers for 20 min. The time spent in each chamber during stage 1 (baseline) was subtracted from the time spent in each chamber during stage 3. A preference toward the cocaine-associated chamber compared to baseline is a measure of the reward behavior associated with cocaine. Control mice received saline in both chambers. Mice that exhibited an initial bias for the white or black chamber received cocaine in the least-preferred chamber.
  • Paradigm 2: In contrast to paradigm 1, no pre-treatment were administered and animals were subjected to the first (baseline, day 1) and second stage (saline, days 2 and 4; cocaine, days 3 and 5) of CPP training as described above. In addition, on days 1, 2 and 4, animals received within one hour after the training session SKF ± SB at the same doses described above.

Cell culture studies

Primary striatal cultures were prepared as described previously, with minor modifications (Konradi et al., 1996; Rajadhyaksha et al., 1998). Striata from 18-d-old Sprague Dawley rat fetuses were dissected and resuspended in defined medium [50% F12/DMEM and 50% DMEM (Gibco-Invitrogen, Grand Island, NY) with the following supplements per liter of medium: 4 gm of dextrose, 1× B27, 10 ml of penicillin-streptomycin liquid (Gibco-Invitrogen), and 25 mM HEPES]. Cells were resuspended in defined medium to 1.2× 106 cells/ml and plated in 12-well plates (Costar, Cambridge, MA) at 2 ×106 cells/well. Plates were pretreated with 1 ml of a 1:500-diluted sterile solution of polyethylenimine in water for 18 hr, washed twice with sterile water, coated with 2.5% serum-containing PBS solution for at least 4 hr, and aspirated just before plating. All experiments were performed in triplicate with cells 6 d in culture and repeated at least once in an independent dissection. As determined by HPLC analysis, glutamate levels in the medium on the day of the experiments ranged from 1 to 5 μM. The neuron to astroglia ratio was below 25:1, as established by immunocytochemical staining with the glial fibrillary acid protein (Dako, Carpinteria, CA) and counterstaining with 1% cresyl violet. All drugs used for the in vitro experiments were purchased from Sigma. At two different time points prior to harvest – 3 hours and 30 minutes – cells were treated with one of the following drugs (treatment #1): (1.1) vehicle (10 uL DMSO); (1.2) the PKA inhibitor N-[2-(p-bromocinnamylamino)ethyl]-5-isoquinolinesulfonamide dihydrochloride, (H89), 20 uM; (1.3) the NMDA receptor antagonist [(+)MK 801 hydrogen maleate] (MK-801), 2 uM. Three hours before harvest, cells were treated with one of the following drugs (treatment #2): (2.1) vehicle (10 uL water); (2.2) Sodium butyrate (10uM to 10mM); (2.3) SKF82958 (50 uM).

Western blotting

Striatal tissue was homogenized in Laemmli buffer, then incubated at 37°C for 10min, centrifuged at 13,500g at 4°C; the supernatant was denatured at 95°C for 5min, then electrophoresed on a 10−20% linear gradient Tris-HCl gel (Bio-Rad) and transferred to PVDF membrane (0.2uM pore size, Bio-Rad). Immunolabelings were performed with anti-phospho (Ser10)-acetyl (Lys14)-histone H3 antibody (#07−081), anti-phospho (Ser10)-histone H3 antibody (#05−598); anti-acetyl-histone H3 antibody (#06−599), and as loading control, a modification-independent anti-histone H4 antibody (#07−108), all from Upstate, Lake Placid, NY. Additional blots were probed with anti-tyrosine hydroxylase (#T-2928), Sigma-Aldrich, St. Louis, MO and anti-phospho (Ser31)-tyrosine hydroxylase (#36−9900), Zymed Laboratories-Invitrogen. Immunoreactivity was detected using peroxidase-conjugated secondary antibody (donkey anti-rabbit IgG or sheep anti-mouse, Amersham) in conjunction with chemiluminesence-based film autoradiography (Super Signal West Dura Extend Reagent, Pierce). For quantification, Quantity One software was used (Biorad).

Immunohistochemistry

Coronal sections (14 um) were cut from blocks containing striatum and collected in ice-cold PBS for free-floating immunohistochemistry. Sections were blocked in 0.3% Triton X-100/± 2% goat serum/0.1M sodium phosphate (pH 7.4). Sections were next incubated in 0.3% Triton X-100 / 0.1 M sodium phosphate buffer and the anti-phospho (ser10) - acetyl (Lys9)-histone H3 antibody (1:500, #ab4272, Abcam, Cambridge, MA) together with the monoclonal anti-NeuN antibody (1:300, #MAB377, Chemicon, Temecula, CA) overnight at 4°C, washed, then incubated with Texas-Red-conjugated horse anti-mouse antiserum and FITC-conjugated goat anti-rabbit antiserum (1:200, Vector) for 60 min at RT, washed, slide-mounted, dried, counterstained with 4,6,-diamidino-2-phenylindole dihydrochloride (DAPI) and coverslipped with Vectashield (Vector). Sections were examined with a Zeiss Axiovert microscope and digitized images were obtained with OpenLab software (Improvision, Lexington, MA).

Quantitative RT-PCR

From each animal, total RNA from striatum or ventral midbrain was extracted using the trizol-based RNeasy Lipid Tissue mini kit (QIAGEN). Amplification reactions were performed in triplicate, using the ABI PRISM 7500 Real Time PCR System (Applied Biosystems) in conjunction with the One-Step RT-PCR kit (Applied Biosystems), SYBR green as a reference dye and the following cycling protocol: 48°C, 30min; 95°C, 10min; followed by 45 cycles of 95°C 15s, 60°C 1min. Primer sequences were designed to amplify 90−150bp fragments from respective gene coding regions: Tyrosine Hydroxylase (Th) primer sequences (94bp product): forward, attggaggctgtggtattcg; reverse, cgagacagtgaggagggttt. Bdnf primer sequences (118bp product), forward gcgcccatgaaagaagtaaa, reverse tcgtcagacctctcgaacct. C-fos primer sequences (147bp product), forward, atccttggagccagtcaaga; reverse, gcatagaaggaaccggacag. β2 microglobulin (B2m) primer sequences (98bp product), forward, tggtgcttgtctcactgacc; reverse, tatgttcggcttcccattct. A 133bp fragment from mouse 18S rRNA was amplified in parallel reactions for normalization. 18S rRNA primer sequences: forward, catggccgttcttagttggt; reverse, gaacgccacttgtccctcta. For additional information on PCR primers and products, see Supplemental Table. Quantification and normalization procedures were previously described (Stadler et al., 2005).

Chromatin Immunoprecipitation and Quantitative PCR

Ventral midbrain tissue (30mg, pooled from 2−3mice) was homogenized and digested with micrococcal nuclease for further application to native chromatin immunoprecipitation (ChIP) with anti-acetyl-histone H3 (Upstate #06−599) or anti-acetyl-histone H4 (Upstate #06−598) antibodies or modification independent anti- H4 (Upstate #07−108) and anti-H3 (Abcam Ab1791−100) followed by quantitative-PCR (qPCR) as previously described (Huang et al., 2006). Primers were selected upstream of respective gene trascription start sites (TSS), with product sizes in the range of 75−125bp in order to amplify from mononucleosomal DNA (147bp). Three primers were designed to amplify sequences proximal to the tyrosine hydroxylase promoter region: Th-a, forward, ttgaagacacagcctgcaac; reverse, ggggaggtcagaagacccta, (70bp product, −652bp from TSS = 150085865; NC_000073.5); Th-b, forward, acggaggcctctctcgtc; reverse, gtcccccacctcctacctc; (103bp product, −91bp from TSS = 150085865; NC_000073.5); and Th-c, forward, ctggggtatccacccattta; reverse, gccgtctcagagcaggatac (113bp product, +48bp from TSS = 150085865; NC_000073.5). Three primers were designed to amplify sequences from the non-coding BDNF promoter regions pI, pIII, and pIV: pI, (106bp product, forward, tggagacccttagtcatggtg; reverse, gcctctctgagccagttacg; pIII, 129bp product, forward, aatgtgcagtggggaaagag; reverse, ggcagggataccgagagaat; pIV, 114bp product, forward, aaatggagcttctcgctgaa, reverse, agtctttggtggccgatatg). Primers were designed for the housekeeping gene β2 microglobulin, B2m, forward, gggaaagtccctttgtaacct, reverse, gcgcgcgctcttatatagtt (112bp product, −57bp from TSS = 121973475; NC_000068.6). For additional information on PCR primers and products, see Supplemental Table.

Statistical Analysis

Biochemical data (immunoblots, quantitative PCR) from experiments with two groups were compared using Student's T-test. For experiments with three or more groups, comparisons were made with one-way ANOVA and the Tukey-Kramer or Least-Significant Differences tests for post hoc comparison (SYSTAT). Significance in all behavior experiments was determined by one- or two-way ANOVA followed by post-hoc analysis (Tukey test unless otherwise stated).

Results

Systemic Pretreatment with D1-agonist and HDACi Enhances Cocaine-induced locomotor activity and reward

We first examined whether cocaine-induced locomotion is affected by previous exposure to the D1/D5 agonist, SKF82958. The drug was administered once daily (0.25 mg/kg i.p.) for 10 days and 24 hours after the last dose, animals received a single dose of cocaine (15 mg/kg i.p.). Comparison of locomotor activity of mice pre-treated for 1−10 days with SKF±SB (2-way ANOVA) revealed significant main effects due to treatment [FSB+SKF vs Sal+SKF (1,70) = 10.1, p<0.01] and time [FSB+SKF vs Sal+SKF (4,70) = 13.3, p<0.001, but no significant interactive effect between treatment and time [FSB+SKF vs Sal+SKF (4,70) = 0.962, p=0.434] (Fig. 1A). Furthermore, in comparison to animals pre-treated with saline, exposure to D1-agonist resulted in a more than 2-fold increase in cocaine-induced locomotion (Fig. 1B), which is in agreement with previous studies (Pierce et al., 1996; De Vries et al., 1998; Sorg et al., 2004). Importantly, this cocaine-related locomotor sensitization was even further enhanced – up to 5-fold when compared to saline controls - in animals pre-treated for 10 days with D1 agonist plus SB (100 mg/kg) (Fig. 1B). The cocaine-induced activity in the group co-treated with 100 mg/kg SB+SKF was also significantly increased compared to mice pretreated with SKF as single drug (Fig 1C) [FSB+SKF vs Sal+SKF (3,28) = 33.39, p < 0.001]. Notably, 100 mg/kg SB administered as single drug was indistinguishable from saline (Fig. 1B,C). Furthermore, SB+SKF co-treatment with a lower dose of SB (25mg/kg) was indistinguishable from the SKF single drug regimen (Fig. 1C). We conclude that pre-treatment with D1 agonist and the HDACi, SB, results in a synergistic and dose-dependent locomotor activity effect of a subsequent dose of cocaine administered 24 hours later.

Figure 1
Changes in cocaine-induced behavior after pre-treatment with D1-agonist and HDACi

Next, we wanted to examine whether or not previous exposure to D1 agonist and HDACi results in sustained (long-term) changes in cocaine-related reward behavior. To examine this, we treated three groups of mice for 10 days either with (i) saline or (ii) SKF 82958 (0.25 mg/kg), (iii) SKF plus SB (100 mg/kg). Then, animals were subjected for a 6-day period to a place preference paradigm (CPP, paradigm 1, see Methods) to distinguish the rewarding effects of cocaine (5 mg/kg) from saline (see Methods for details). On the 6th and final CPP day, animals that had been pre-treated with SKF showed a significant increase in preference for the cocaine chamber (Fig. 1D), which is in good agreement with a recent report in rats (Graham et al., 2007). However, in this paradigm, co-treatment with SB was not more effective than single drug SKF (Fig. 1D), and therefore we conclude that exposure to the D1 agonist but not the HDACi induced a sustained change in behavioral plasticity as it pertains to cocaine-related preference behavior.

The above CPP results suggest that repeated exposure to D1 agonist, but not SB induces sustained changes in reward circuitry that lasted at least 6 days. Next, we wanted to find out whether or not SB enhances cocaine reward of animals that receive a much shorter course of SKF treatments. Therefore, in CPP paradigm 2, no pre-treatment with SKF or SB was administered, and instead these drugs were administered during the training period and cocaine reward was evaluated 48 hours after the last dose of SKF ± SB (see Methods). Indeed, in paradigm 2, mice treated with SKF+SB showed significant cocaine-related place preference. This effect was not seen in animals that received single drug SKF (Fig. 1E). We conclude that exposure to SB enhances cocaine-related reward of D1-agonist within a shorter time frame.

Exposure to D1 agonist and HDACi is associated with increased gene expression in ventral midbrain and chromatin remodeling at selected promoter sequences

To find out whether the increased cocaine-related locomotion in animals pre-treated with SKF82958 and SB is associated with changes in gene transcription in ventral midbrain and striatum as key structures of the reward pathway, we assayed mRNA levels for (i) tyrosine hydroxylase (TH) (Belin et al., 2007) the rate limiting enzyme in catecholamine biosynthesis, (ii) brain-derived neurotrophic factor (BDNF), a nerve growth factor molecule thought to play an important role in the neurobiology of cocaine addiction (Guillin et al., 2001; Hall et al., 2003; Graham et al., 2007), (iii) c-fos, a prototype early response gene and (iv) β2-microglobulin, a “housekeeping gene”, as a control. For each gene (i) – (iv), transcript levels were determined by qRT-PCR and normalized to 18S rRNA levels which differed less than 5 − 10% between groups, with no consistent effect by treatment.

Notably, animals that received 10 daily doses of SKF + 100 mg/kg SB (i.e., the treatment associated with the highest degree of locomotion upon subsequent exposure to cocaine, see Fig. 1B,C) showed significantly higher levels of Th and Bdnf mRNA levels in ventral midbrain, in comparison to SKF+Sal treated animals [F (3,15)SB+SKF vs Sal+SKF = 9.586TH , p<0.03; = 8.891BDNF , p<0.04] (Fig 2A). In contrast, ventral midbrain B2m mRNA levels, and all striatal transcripts were indistinguishable between animals that received SB or Sal as co-treatment together with SKF. (Fig. 2A). We conclude that the locomotor-activating effects of the HDACi, SB, are associated with transcriptional changes in ventral midbrain.

Fig. 2
Treatment with D1 agonist and HDACi is associated with increased gene expression in ventral midbrain and chromatin remodeling at selected promoter sequences

Next, we wanted to examine if the increases in ventral midbrain Th and Bdnf mRNA levels in the SKF+SB treated animals are associated with chromatin remodeling events at the corresponding promoters. Importantly, transcriptional profiling by microarray consistently revealed that after treatment with class I/II HDACi, a nearly equal number of genes show decreased or increased expression (Mariadason et al., 2000; Nusinzon and Horvath, 2005; Chen and Cepko, 2007). Furthermore, it is possible that – in addition to their established function in transcriptional repressor complexes (Butler and Bates, 2006) HDAC activity is necessary to maintain transcriptional activity at selected genomic loci (Dehm et al., 2004). These novel findings suggest that both increased, or decreased histone acetylation in a promoter chromatin environment could potentially be associated with increased gene expression levels. Therefore, we monitored histone H3 acetylation levels at Th, Bdnf, and B2m gene promoters. Immunoprecipitation of ventral midbrain prepared by micrococcal nuclease digestion showed that one out of three sites within close proximity to the Th transcription start site (Fig. 2B, a-c) had a significant decrease in H3 acetylation in 1mg/kg SKF + 200 mg/kg SB treated animals compared to saline controls. The H3 acetylation changes after co-treatment with SKF and the higher SB dose were specific because H4 acetylation at this portion of the Th promoter was unchanged (Suppl. Figure 1). This particular finding may not be too surprising given that differential regulation of H3 and H4 acetylation has been noted before both in cell lines(Rada-Iglesias et al., 2007) and brain tissue(Kumar et al., 2005; Chwang et al., 2007). Moreover, SB-induced H3 acetylation changes were dose dependent, because co-treatments with 1 mg/kg SKF + 25 mg/kg SB did not result in significant histone acetylation changes at the Th promoter (Suppl. Figure 2).

Furthermore, we measured histone H3 acetylation in chromatin surrounding Bdnf - a gene with complex transcriptional regulation , multiple promoters and non-coding exons (Timmusk et al., 1993). For example, increased Bdnf expression after antidepressant treatment involves exon I (Russo-Neustadt et al., 2000; Dias et al., 2003). Moreover, dramatic increases in exon III and IV expression were observed in an animal model for social stress (Tsankova et al., 2006). Given this background, we determined H3 acetylation at the Bdnf for each promoter of the non-coding exons I, III and IV. Chromatin from ventral midbrain of SB+SKF-treated mice showed, in comparison to saline treated controls, no changes in H3 acetylation at Bdnf promoters PI and PIII (Fig. 2B). However, ventral midbrain chromatin from the SKF + SB treated animals showed a significant down-regulation of H3 acetylation at Bdnf promoter IV at the higher SB dose of 200 mg/kg (Fig. 2B) but not after 25mg/kg SB (Suppl. Figure 2). Furthermore, changes in H4 acetylation were more variable (Suppl. Figure 1). Furthermore, there were no significant acetylation changes at the B2m promoter (Fig. 2B). Taken together, our result show that in ventral midbrain, up-regulated expression of Th and Bdnf in response to D1 agonist and HDACi co-treatment is associated with histone H3 deacetylation events of selected portions of the corresponding gene promoters. Given that our immunoprecipitation assays were performed on mononucleosomal chromatin preparations from ventral midbrain (see Methods), we wanted to find out whether a decrease in nucleosomal densities underlies the observed histone hypoacetylation at selected sequences of the Th and Bdnf promoters in the SB+SKF treated animals. We therefore conducted ventral midbrain ChIP with modification-independent anti-H4 or anti-H3 antibodies; however SKF+SB treated animals showed, in 5 out of 6 experiments, an increase in nucleosomal densities at the Th promoter sequence “a” (see also Fig. 2B) and similar changes at Bdnf promoter IV, in comparison to saline-treated controls (data not shown). Therefore, the observed decrease in histone acetylation - which was approximately 0.5-fold for Th and Bdnf (Fig. 2B) - cannot be explained in terms of dispersion or decrease in nucleosome density.

Co-treatment with D1 agonist and HDACi is associated with a transient up-regulation of Th protein in striatum

To find out whether the observed changes in gene expression and histone acetylation at the Th promoter in ventral midbrain occur in conjunction with alterations in TH protein levels, we assayed TH protein levels, including its phospho-activated form, phospho-Ser31-TH (Moy and Tsai, 2004). Animals were sacrificed 30 min after acute or chronic treatment (see Methods), which corresponds to the time (post-injection) at which changes in locomotor activity were observed. We assayed two brain regions, the SN/VTA and striatum including nucleus accumbens and caudate-putamen, a cocaine-sensitive target for dopaminergic fibers(Graybiel et al., 1990; Winder et al., 2002). In the striatum, significant changes were limited to the group of animals treated with SB + SKF, which showed a 2-fold increase in TH immunoreactivity when compared to saline-treated controls (Fig 3A, [FSB+SKF vs Sal+Sal (3,32) = 2.936, p < 0.01]). In contrast, animals treated with single drug SKF or SB did not show significant changes (Fig. 3A). Likewise, significant changes in striatal phospho-Ser31-TH were limited to the group of SKF+SB treated animals, which showed a 30% increase compared to animals treated with single drugs. These changes were significant [FSB+SKF vs SKF+Sal or SB+Sal (3,32) = 2.312, p < 0.040] (data not shown). In contrast to the significant up-regulation of striatal TH immunoreactivity in the SKF+SB treated animals, levels of TH protein in ventral midbrain remained unaffected (Fig. 3B). Furthermore, the observed increase in striatal TH after SKF+SB was transient because it was apparent at 30 min (Fig. 3A) but not 6 days (Fig. 3C) after the last of 10 daily treatments. We conclude that repeated exposure to D1-agonist and HDACi is associated with a transient increase in striatal TH protein. Furthermore, we assayed the concentration of dopamine and its metabolite, DOPAC, by HPLC and no significant differences between treatment groups were observed (Suppl. Figure 3). This would suggest that an increase in striatal TH (including phospho-TH) is not necessarily reflected by a net change in dopamine tissue levels.

Fig. 3
A transient increase in striatal TH after exposure to D1-agonist and HDACi

Activation of D1-signaling is linked to a nucleosomal response in striatum

Based on the findings of the present study, repeated treatment with SKF+SB selectively induces gene expression changes and chromatin remodeling in ventral midbrain, and this occurs in conjunction with an increase in locomotor activity upon a subsequent dose of cocaine (Fig. 1B-C). However, repeated exposure to the D1 agonist SKF – administered with or without the HDACi, SB – results in a sustained change in behavioral plasticity because it was linked to enhanced cocaine reward 6 days after the last dose of SKF (Fig. 1D). As a first step towards understanding these phenomena, we wanted to identify a chromatin-remodeling mechanisms linked to D1-signaling. Notably, previous studies reported D1- agonist or stress induced changes in hippocampal histone phosphorylation and phospho-acetylation (Crosio et al., 2003; Chandramohan et al., 2007) and D2-like antagonist –induced changes in striatal histone phospho-acetylation (Li et al., 2004). Importantly, the kinetics of this generalized H3 phosphorylation and phospho-acetylation bears resemblance to the induction pattern of immediate-early-genes (IEGs) and has been discussed as a “nucleosomal response” in response to receptor activation and other stimuli (Thomson et al., 1999).

To examine the in vivo kinetics of striatal H3 phospho-acetylation (phosphoserine 10, acetyl-lysine 14, H3pS10acK14) – a dual histone modification enriched in neuronal nuclei (Fig. 4A) – in response to D1-receptor activation, we treated mice either with a single dose, or by repeated, daily injections (2 and 10 days) of SKF, with or without SB, and measured striatal H3pS10acK14 levels 30−120 min after the last dose. Levels of H3pS10acK14 showed a more than 2.5-fold increase after acute administration of SKF82958, and returned to baseline within 120 min after treatment (Fig. 4B,C; [FSKF 30min vs Sal (2,13) = 17.954, p < 0.001]. These changes were specific for the dual modification, H3pS10acK14, because levels of the single modification, H3pS10, remained unchanged after SKF82958 treatment (Fig. 4B). Similar changes were observed after repeated exposure for 10 – but not 2 – days of SKF when administered either as single drug or in combination with SB (Fig. 4B,C). In contrast, single drug SB was indistinguishable from saline (Fig. 4B,C). The transient resistance of the histone modification machinery to further induction by SKF82958 in the two day treatment paradigm (Fig. 4B,C) was not due to tolerance, as striatal activation of the prototype early response gene, c-fos, was robust at all time points examined (Suppl. Fig. 4).

Figure 4
D1- receptor signaling regulates H3 phospho-acetylation in striatal neurons

To confirm the role of D1-receptors for these dynamic changes in H3S10pK14ac for a second rodent species, and in order to test if functional brain circuitry is required, we used dissociated rat striatal neuronal cultures that lack midbrain and cortical pre-synaptic inputs. Treatment of striatal cultures with the D1-agonist, SKF82958 (25 − 50 μM), induced a significant 1.4 − 2.0 -fold increase in H3pS10acK14 within 30 min (not shown) and peaked at 3 hours (Fig. 4D, F; *, p<0.05). These changes were specific, because levels of global H3 acetylation remained unaffected in cultures treated with SKF single drug (Fig. 4E). In contrast, addition of >100 μM SB to the cell culture medium resulted in significant increases in H3 acetylation and phosphoacetylation (Fig. 4D, E).

Finally, given that dopamine-regulated gene expression in striatal neurons involves cyclic AMP and NMDA receptor pathways (Konradi et al., 1996), we examined the effects of NMDA receptor blockade (MK-801, 2μM) and inhibition of cAMP-dependent protein kinase A (H89, 20 μM). Indeed, pre-treatment with MK-801 or H89 prevented or attenuated the up-regulation of H3pS10acK14 after D1-agonist treatment (Fig. 4F). Taken together, both studies in vitro and in vivo demonstrate that activation of dopamine D1 receptors up-regulates bulk chromatin levels of H3pS10acK14 in the nuclei of striatal neurons. Furthermore, D1-regulated striatal H3 phospho-acetylation was, at least in vivo, not modulated by concomitant treatment with the HDACi, SB.

DISCUSSION

Several recent studies identified chromatin remodeling in the striatum - including the regulation of histone acetylation - as an important regulator of stimulant-related plasticity and addiction behavior (Kumar et al., 2005; Levine et al., 2005; Kalda et al., 2007; Renthal et al., 2007). The present study extends the findings of these earlier studies in two ways - first, by demonstrating that chromatin remodeling contributes to drug-induced changes in gene expression in other parts of the reward circuitry, including the ventral midbrain at the level of SN/VTA. Secondly, this report underscores the link between D1-dopamine receptor signaling and chromatin remodeling mechanisms, by showing that treatment with D1- agonist (i) is associated with increased sensitization and reward behavior upon subsequent exposure to cocaine (ii) induces a generalized, but short-lasting, nucleosomal response – as defined by the phospho-acetylation of histone H3 in bulk chromatin stimuli (Thomson et al., 1999) – and (iii) regulates under certain conditions, including drug-induced inhibition of class I/II HDAC, histone acetylation and gene expression in ventral midbrain chromatin.

Our study faces several limitations, including the broad molecular action of SB – a drug considered a prototype for inhibition of class I/II HDACs but which also interferes with the de-acetylation of transcription factors, high-mobility group and other non-histones proteins important for chromatin function (Davie, 2003). Therefore, the chromatin remodeling complex mediating unexpected histone de-acetylation at ventral midbrain Bdnf and Th promoters after co-treatment with D1-agonist and SB, in conjunction with an up-regulation of corresponding mRNAs - both shown in the present study - remains to be identified. In any case, given that Bdnf has trophic actions on midbrain dopaminergic neurons (Dluzen et al., 2001; Baker et al., 2005) , the observed increased in Bdnf expression may relate, directly or indirectly, to the rise in Th mRNA (ventral midbrain) and protein (striatum) in SKF/SB treated animals. Notably, expression of Bdnf is dynamically regulated in stress-related models(Lippmann et al., 2007) (and references therein)(Berton et al., 2006; Pu et al., 2006). It will be interesting to determine if D1-agonist and HDACi co-treatments affect expression of GDNF and other growth factors important for ventral midbrain and dopaminergic neuron function(Chen et al., 2006). Notably, recent studies showed that the mood stabilizer, sodium valproate, a short-chain fatty acid structurally similar to sodium butyrate, induces Bdnf expression and promoter-associated histone acetylation in prefrontal cortex (Fukumoto et al., 2001; Bredy et al., 2007). Furthermore, both butyrate and valproate positively regulate a number of intracellular effectors of Bdnf signaling, including extra-cellular signal related kinases (ERK) pathways and the Ca2+/cAMP dependent transcription factor CREB which in turn up-regulate Th expression (Shah et al., 2006; Shaltiel et al., 2007). It is possible that transient increases in neurotrophin supply - including those of Bdnf - evoke further adaptations in a subset of dopaminergic or other neurons, which then underlie the observed changes in cocaine-related behaviors. This scenario would also explain important differences in the timing of the various, drug-induced adaptations, which is another limitation of the present study: While the dynamic changes in striatal H3 phospho-acetylation, and Th and Bdnf expression in ventral midbrain were measured within minutes or the first hours after drug treatment, behavioral outcomes were monitored up to six days after the last treatments with D1-agonist and HDACi.

Remarkably, the up-regulation of striatal histone H3 phospho-acetylation after activation of D1-signaling (present study) or blockade of D2-like signaling (Li et al., 2004) is readily apparent on immunoblots from tissue homogenates or extracts, indicating that this is a “nucleosomal response” (Thomson et al., 1999) that includes, but is not limited to, c-fos, c-jun and other immediate early gene promoters (Thomson et al., 1999; Li et al., 2004). In this context, it is noteworthy that D1-agonist-induced H3 phospho-acetylation in striatal neurons is completely blocked by the PKA inhibitor, H89 (Fig. 4F). Furthermore, H89 inhibits the nucleosomal response in fibroblasts, via functional inactivation of mitogen- and stress-activated protein kinase 1 (MSK1) (Thomson et al., 1999). Notably, recent reports attributed to MSK1 a key regulatory role for hippocampal and striatal histone acetylation and phosphorylation (Brami-Cherrier et al., 2005; Chwang et al., 2007).

The present paper reports that in animals co-treated with D1-agonist and class I/II HDACi, cocaine-induced reward behavior is enhanced. It is therefore tempting to speculate that the opposite strategy, i.e. treatment with D1-antagonist and a histone acetyl-transferase inhibitor (HATi), could perhaps prevent, or attenuate, some of the behaviors associated with cocaine reward. Evidence from clinical trials suggest that administration of D1-antagonist drugs to active users may be ineffective or even counterproductive (Haney et al., 2001), albeit reduction of cocaine-induced euphoria and stimulation had also been reported (Romach et al., 1999). However, there is evidence from animal studies that D1-antagonism may prevent relapse (Alleweireldt et al., 2002; Anderson et al., 2003; Sanchez et al., 2003). From the viewpoint of translational medicine, it will therefore be of considerable interest to explore whether or not co-treatment of animals with histone modifying drugs, including HATi or HDACi, alters reinstatement or relapse of cocaine-related behaviors. Finally, it will be of important to evaluate how chromatin-modifying drugs would affect the developing brain which may be particularly vulnerable to stimulant drugs(Schmauss, 2000; Crandall et al., 2004).

Supplementary Material

Supplemental Table

Supplemental Figure 1

Supplemental Figure 2

Supplemental Figure 3

Supplemental Figure 4

ACKNOWLEDGEMENTS

This work was supported by a grant from the National Institutes of Drug Abuse (NIDA) to S.A. (R01 DA017660).

Footnotes

DISCLOSURE/CONFLICT OF INTEREST

The authors of this manuscript have no related financial interests or considerations to disclose.

SUPPLEMENTARY INFORMATION

Supplementary information is available at the Neuropsychopharmacology website.

REFERENCES

  • Alleweireldt AT, Weber SM, Kirschner KF, Bullock BL, Neisewander JL. Blockade or stimulation of D1 dopamine receptors attenuates cue reinstatement of extinguished cocaine-seeking behavior in rats. Psychopharmacology (Berl) 2002;159:284–293. [PubMed]
  • Anderson SM, Bari AA, Pierce RC. Administration of the D1-like dopamine receptor antagonist SCH-23390 into the medial nucleus accumbens shell attenuates cocaine priming-induced reinstatement of drug-seeking behavior in rats. Psychopharmacology (Berl) 2003;168:132–138. [PubMed]
  • Baker SA, Stanford LE, Brown RE, Hagg T. Maturation but not survival of dopaminergic nigrostriatal neurons is affected in developing and aging BDNF-deficient mice. Brain Res. 2005;1039:177–188. [PubMed]
  • Belin D, Deroche-Gamonet V, Jaber M. Cocaine-induced sensitization is associated with altered dynamics of transcriptional responses of the dopamine transporter, tyrosine hydroxylase, and dopamine D2 receptors in C57Bl/6J mice. Psychopharmacology (Berl) 2007;193:567–578. [PubMed]
  • Berton O, McClung CA, Dileone RJ, Krishnan V, Renthal W, Russo SJ, Graham D, Tsankova NM, Bolanos CA, Rios M, Monteggia LM, Self DW, Nestler EJ. Essential role of BDNF in the mesolimbic dopamine pathway in social defeat stress. Science. 2006;311:864–868. [PubMed]
  • Brami-Cherrier K, Valjent E, Herve D, Darragh J, Corvol JC, Pages C, Arthur SJ, Girault JA, Caboche J. Parsing molecular and behavioral effects of cocaine in mitogen- and stress-activated protein kinase-1-deficient mice. J Neurosci. 2005;25:11444–11454. [PubMed]
  • Bredy TW, Wu H, Crego C, Zellhoefer J, Sun YE, Barad M. Histone modifications around individual BDNF gene promoters in prefrontal cortex are associated with extinction of conditioned fear. Learn Mem. 2007;14:268–276. [PubMed]
  • Butler R, Bates GP. Histone deacetylase inhibitors as therapeutics for polyglutamine disorders. Nat Rev Neurosci. 2006;7:784–796. [PubMed]
  • Chandramohan Y, Droste SK, Reul JM. Novelty stress induces phosphoacetylation of histone H3 in rat dentate gyrus granule neurons through coincident signalling via the N-methyl-D-aspartate receptor and the glucocorticoid receptor: relevance for c-fos induction. J Neurochem. 2007;101:815–828. [PubMed]
  • Chen B, Cepko CL. Requirement of histone deacetylase activity for the expression of critical photoreceptor genes. BMC Dev Biol. 2007;7:78. [PMC free article] [PubMed]
  • Chen PS, Peng GS, Li G, Yang S, Wu X, Wang CC, Wilson B, Lu RB, Gean PW, Chuang DM, Hong JS. Valproate protects dopaminergic neurons in midbrain neuron/glia cultures by stimulating the release of neurotrophic factors from astrocytes. Mol Psychiatry. 2006;11:1116–1125. [PubMed]
  • Chwang WB, Arthur JS, Schumacher A, Sweatt JD. The nuclear kinase mitogen- and stress-activated protein kinase 1 regulates hippocampal chromatin remodeling in memory formation. J Neurosci. 2007;27:12732–12742. [PubMed]
  • Corominas M, Roncero C, Ribases M, Castells X, Casas M. Brain-derived neurotrophic factor and its intracellular signaling pathways in cocaine addiction. Neuropsychobiology. 2007;55:2–13. [PubMed]
  • Crandall JE, Hackett HE, Tobet SA, Kosofsky BE, Bhide PG. Cocaine exposure decreases GABA neuron migration from the ganglionic eminence to the cerebral cortex in embryonic mice. Cereb Cortex. 2004;14:665–675. [PMC free article] [PubMed]
  • Crosio C, Heitz E, Allis CD, Borrelli E, Sassone-Corsi P. Chromatin remodeling and neuronal response: multiple signaling pathways induce specific histone H3 modifications and early gene expression in hippocampal neurons. J Cell Sci. 2003;116:4905–4914. [PubMed]
  • Davie JR. Inhibition of histone deacetylase activity by butyrate. J Nutr. 2003;133:2485S–2493S. [PubMed]
  • De Vries TJ, Cools AR, Shippenberg TS. Infusion of a D-1 receptor agonist into the nucleus accumbens enhances cocaine-induced behavioural sensitization. Neuroreport. 1998;9:1763–1768. [PubMed]
  • Dehm SM, Hilton TL, Wang EH, Bonham K. SRC proximal and core promoter elements dictate TAF1 dependence and transcriptional repression by histone deacetylase inhibitors. Mol Cell Biol. 2004;24:2296–2307. [PMC free article] [PubMed]
  • Dias BG, Banerjee SB, Duman RS, Vaidya VA. Differential regulation of brain derived neurotrophic factor transcripts by antidepressant treatments in the adult rat brain. Neuropharmacology. 2003;45:553–563. [PubMed]
  • Dluzen DE, Gao X, Story GM, Anderson LI, Kucera J, Walro JM. Evaluation of nigrostriatal dopaminergic function in adult +/+ and +/− BDNF mutant mice. Exp Neurol. 2001;170:121–128. [PubMed]
  • Fukumoto T, Morinobu S, Okamoto Y, Kagaya A, Yamawaki S. Chronic lithium treatment increases the expression of brain-derived neurotrophic factor in the rat brain. Psychopharmacology (Berl) 2001;158:100–106. [PubMed]
  • Graham DL, Hoppenot R, Hendryx A, Self DW. Differential ability of D1 and D2 dopamine receptor agonists to induce and modulate expression and reinstatement of cocaine place preference in rats. Psychopharmacology (Berl) 2007;191:719–730. [PubMed]
  • Graybiel AM, Moratalla R, Robertson HA. Amphetamine and cocaine induce drug-specific activation of the c-fos gene in striosome-matrix compartments and limbic subdivisions of the striatum. Proc Natl Acad Sci U S A. 1990;87:6912–6916. [PubMed]
  • Guillin O, Diaz J, Carroll P, Griffon N, Schwartz JC, Sokoloff P. BDNF controls dopamine D3 receptor expression and triggers behavioural sensitization. Nature. 2001;411:86–89. [PubMed]
  • Hall FS, Drgonova J, Goeb M, Uhl GR. Reduced behavioral effects of cocaine in heterozygous brain-derived neurotrophic factor (BDNF) knockout mice. Neuropsychopharmacology. 2003;28:1485–1490. [PubMed]
  • Haney M, Ward AS, Foltin RW, Fischman MW. Effects of ecopipam, a selective dopamine D1 antagonist, on smoked cocaine self-administration by humans. Psychopharmacology (Berl) 2001;155:330–337. [PubMed]
  • Huang HS, Matevossian A, Jiang Y, Akbarian S. Chromatin immunoprecipitation in postmortem brain. J Neurosci Methods. 2006;156:284–292. [PubMed]
  • Hummel M, Unterwald EM. D1 dopamine receptor: a putative neurochemical and behavioral link to cocaine action. J Cell Physiol. 2002;191:17–27. [PubMed]
  • Kalda A, Heidmets LT, Shen HY, Zharkovsky A, Chen JF. Histone deacetylase inhibitors modulates the induction and expression of amphetamine-induced behavioral sensitization partially through an associated learning of the environment in mice. Behav Brain Res. 2007;181:76–84. [PubMed]
  • Kalivas PW, Volkow ND. The neural basis of addiction: a pathology of motivation and choice. Am J Psychiatry. 2005;162:1403–1413. [PubMed]
  • Konradi C, Leveque JC, Hyman SE. Amphetamine and dopamine-induced immediate early gene expression in striatal neurons depends on postsynaptic NMDA receptors and calcium. J Neurosci. 1996;16:4231–4239. [PubMed]
  • Kumar A, Choi KH, Renthal W, Tsankova NM, Theobald DE, Truong HT, Russo SJ, Laplant Q, Sasaki TS, Whistler KN, Neve RL, Self DW, Nestler EJ. Chromatin remodeling is a key mechanism underlying cocaine-induced plasticity in striatum. Neuron. 2005;48:303–314. [PubMed]
  • Levine AA, Guan Z, Barco A, Xu S, Kandel ER, Schwartz JH. CREB-binding protein controls response to cocaine by acetylating histones at the fosB promoter in the mouse striatum. Proc Natl Acad Sci U S A. 2005;102:19186–19191. [PubMed]
  • Li J, Guo Y, Schroeder FA, Youngs RM, Schmidt TW, Ferris C, Konradi C, Akbarian S. Dopamine D2-like antagonists induce chromatin remodeling in striatal neurons through cyclic AMP-protein kinase A and NMDA receptor signaling. J Neurochem. 2004;90:1117–1131. [PubMed]
  • Lippmann M, Bress A, Nemeroff CB, Plotsky PM, Monteggia LM. Long-term behavioural and molecular alterations associated with maternal separation in rats. Eur J Neurosci. 2007;25:3091–3098. [PubMed]
  • Mariadason JM, Corner GA, Augenlicht LH. Genetic reprogramming in pathways of colonic cell maturation induced by short chain fatty acids: comparison with trichostatin A, sulindac, and curcumin and implications for chemoprevention of colon cancer. Cancer Res. 2000;60:4561–4572. [PubMed]
  • Moy LY, Tsai LH. Cyclin-dependent kinase 5 phosphorylates serine 31 of tyrosine hydroxylase and regulates its stability. J Biol Chem. 2004;279:54487–54493. [PubMed]
  • Nusinzon I, Horvath CM. Histone deacetylases as transcriptional activators? Role reversal in inducible gene regulation. Sci STKE. 20052005:re11. [PubMed]
  • Paxinos G, Franklin K. The Mouse Brain in Stereotaxic Coordinates. 2nd Ed. Academic Press; San Diego: 2001.
  • Pierce RC, Born B, Adams M, Kalivas PW. Repeated intra-ventral tegmental area administration of SKF-38393 induces behavioral and neurochemical sensitization to a subsequent cocaine challenge. J Pharmacol Exp Ther. 1996;278:384–392. [PubMed]
  • Pu L, Liu QS, Poo MM. BDNF-dependent synaptic sensitization in midbrain dopamine neurons after cocaine withdrawal. Nat Neurosci. 2006;9:605–607. [PubMed]
  • Rada-Iglesias A, Enroth S, Ameur A, Koch CM, Clelland GK, Respuela-Alonso P, Wilcox S, Dovey OM, Ellis PD, Langford CF, Dunham I, Komorowski J, Wadelius C. Butyrate mediates decrease of histone acetylation centered on transcription start sites and down-regulation of associated genes. Genome Res. 2007;17:708–719. [PubMed]
  • Rajadhyaksha A, Leveque J, Macias W, Barczak A, Konradi C. Molecular components of striatal plasticity: the various routes of cyclic AMP pathways. Dev Neurosci. 1998;20:204–215. [PubMed]
  • Renthal W, Maze I, Krishnan V, Covington HE, 3rd, Xiao G, Kumar A, Russo SJ, Graham A, Tsankova N, Kippin TE, Kerstetter KA, Neve RL, Haggarty SJ, McKinsey TA, Bassel-Duby R, Olson EN, Nestler EJ. Histone deacetylase 5 epigenetically controls behavioral adaptations to chronic emotional stimuli. Neuron. 2007;56:517–529. [PubMed]
  • Romach MK, Glue P, Kampman K, Kaplan HL, Somer GR, Poole S, Clarke L, Coffin V, Cornish J, O'Brien CP, Sellers EM. Attenuation of the euphoric effects of cocaine by the dopamine D1/D5 antagonist ecopipam (SCH 39166). Arch Gen Psychiatry. 1999;56:1101–1106. [PubMed]
  • Russo-Neustadt AA, Beard RC, Huang YM, Cotman CW. Physical activity and antidepressant treatment potentiate the expression of specific brain-derived neurotrophic factor transcripts in the rat hippocampus. Neuroscience. 2000;101:305–312. [PubMed]
  • Sanchez CJ, Bailie TM, Wu WR, Li N, Sorg BA. Manipulation of dopamine d1-like receptor activation in the rat medial prefrontal cortex alters stress- and cocaine-induced reinstatement of conditioned place preference behavior. Neuroscience. 2003;119:497–505. [PubMed]
  • Santini E, Valjent E, Usiello A, Carta M, Borgkvist A, Girault JA, Herve D, Greengard P, Fisone G. Critical involvement of cAMP/DARPP-32 and extracellular signal-regulated protein kinase signaling in L-DOPA-induced dyskinesia. J Neurosci. 2007;27:6995–7005. [PubMed]
  • Schmauss C. A single dose of methamphetamine leads to a long term reversal of the blunted dopamine D1 receptor-mediated neocortical c-fos responses in mice deficient for D2 and D3 receptors. J Biol Chem. 2000;275:38944–38948. [PubMed]
  • Self DW, Stein L. The D1 agonists SKF 82958 and SKF 77434 are self-administered by rats. Brain Res. 1992;582:349–352. [PubMed]
  • Self DW, Choi KH, Simmons D, Walker JR, Smagula CS. Extinction training regulates neuroadaptive responses to withdrawal from chronic cocaine self-administration. Learn Mem. 2004;11:648–657. [PubMed]
  • Shah P, Nankova BB, Parab S, La Gamma EF. Short chain fatty acids induce TH gene expression via ERK-dependent phosphorylation of CREB protein. Brain Res. 2006;1107:13–23. [PubMed]
  • Shaltiel G, Chen G, Manji HK. Neurotrophic signaling cascades in the pathophysiology and treatment of bipolar disorder. Curr Opin Pharmacol. 2007;7:22–26. [PubMed]
  • Sorg BA, Li N, Wu W, Bailie TM. Activation of dopamine D1 receptors in the medial prefrontal cortex produces bidirectional effects on cocaine-induced locomotor activity in rats: effects of repeated stress. Neuroscience. 2004;127:187–196. [PubMed]
  • Stadler F, Kolb G, Rubusch L, Baker SP, Jones EG, Akbarian S. Histone methylation at gene promoters is associated with developmental regulation and region-specific expression of ionotropic and metabotropic glutamate receptors in human brain. J Neurochem. 2005;94:324–336. [PubMed]
  • Thomson S, Clayton AL, Hazzalin CA, Rose S, Barratt MJ, Mahadevan LC. The nucleosomal response associated with immediate-early gene induction is mediated via alternative MAP kinase cascades: MSK1 as a potential histone H3/HMG-14 kinase. Embo J. 1999;18:4779–4793. [PubMed]
  • Timmusk T, Palm K, Metsis M, Reintam T, Paalme V, Saarma M, Persson H. Multiple promoters direct tissue-specific expression of the rat BDNF gene. Neuron. 1993;10:475–489. [PubMed]
  • Tsankova NM, Berton O, Renthal W, Kumar A, Neve RL, Nestler EJ. Sustained hippocampal chromatin regulation in a mouse model of depression and antidepressant action. Nat Neurosci. 2006;9:519–525. [PubMed]
  • Winder DG, Egli RE, Schramm NL, Matthews RT. Synaptic plasticity in drug reward circuitry. Curr Mol Med. 2002;2:667–676. [PubMed]