PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Int J Cancer. Author manuscript; available in PMC Sep 18, 2009.
Published in final edited form as:
PMCID: PMC2746567
NIHMSID: NIHMS137635
Smoking modifies the relationship between XRCC1 haplotypes and HPV16-negative head and neck squamous cell carcinoma
Katie M. Applebaum,1,2 Michael D. McClean,3 Heather H. Nelson,4 Carmen J. Marsit,5 Brock C. Christensen,2 and Karl T. Kelsey5,6
1Department of Epidemiology, Boston University School of Public Health, Boston, Massachusetts
2Department of Environmental Health, Harvard School of Public Health, Boston, Massachusetts
3Department of Environmental Health, Boston University School of Public Health, Boston, Massachusetts
4Masonic Cancer Center, Division of Epidemiology and Community Health, University of Minnesota, Minneapolis, Minnesota
5Department of Community Health, Brown University, Providence, Rhode Island
6Department of Pathology and Laboratory Medicine, Brown University, Providence, Rhode Island
Corresponding author: Karl T. Kelsey Center for Environmental Health and Technology Departments of Community Health and Pathology and Laboratory Medicine Brown University Providence, RI 02912 U.S.A. karl_kelsey/at/brown.edu Phone: 401 863 6420 Fax: 401 863 9008
Reports on the relationship between head and neck squamous cell carcinoma (HNSCC) and polymorphisms in X-ray cross complementing group 1 (XRCC1) have been inconsistent. We hypothesized this may be due to not accounting for Human papillomavirus type-16 (HPV16) and thus examined whether smoking modified the association between XRCC1 haplotypes and HNSCC risk within HPV16 serologic strata. Cases were diagnosed in Greater Boston, Massachusetts. Controls were matched to cases on age, gender, and residential town. Genotyping was conducted on three XRCC1 polymorphisms (Arg194Trp, Arg280His, Arg399Gln) and serology was used to determine HPV16 exposure. Unconditional logistic regression was used to estimate odds ratios (ORs) and 95% confidence intervals (CIs), adjusting for age, sex, race, education, smoking, alcohol consumption, and HPV16 serology. There was no overall association between XRCC1 polymorphisms and HNSCC risk. Smoking did not modify the association between XRCC1 polymorphisms and HNSCC risk among the HPV16 seropositive (Pinteraction=0.89) but it did for the HPV16 seronegative (Pinteraction=0.04). Among the HPV16 seronegative, heavy smokers with a haplotype containing a variant allele had an increased HNSCC risk (haplotype with 399Gln: OR, 1.35; 95% CI, 0.97-1.86), whereas never/light smokers with variant alleles may have a reduced risk. In sum, the association between XRCC1 and HNSCC risk differed by HPV16 status and smoking. Among the HPV16 seronegative, heavy smokers with XRCC1 variant alleles had an increased HNSCC risk. There was no relationship between XRCC1 and HPV16-related HNSCC, regardless of smoking. Our findings underscore the importance of accounting for HPV16 exposure even when studying susceptibility to HNSCC.
Keywords: Human papillomavirus (HPV), head and neck squamous cell carcinoma (HNSCC), tobacco, XRCC1, DNA repair
Approximately 434,000 new cases of head and neck squamous cell carcinoma (HNSCC) are expected worldwide annually1 and over 45,000 of these will occur in the U.S.2 Tobacco and alcohol together are thought to explain 75% of HNSCC incidence.3 The predominant risk factor, tobacco, contains numerous known carcinogens including benzene, polycyclic aromatic hydrocarbons, and nitrosamines. A review of the literature found that smokers are at a 3- to 12- fold greater risk of HNSCC than non-smokers and among those who do not drink alcohol, the relative risks for smoking were between 2 and 5.4
Because of the strong association with tobacco, it has been hypothesized that genetic variation in the DNA repair gene X-ray cross complementing group 1 (XRCC1) translates into greater HNSCC susceptibility. XRCC1 is involved in base excision repair (BER), which repairs base damage, strand breaks, and non-bulky DNA adducts induced by a number of agents including tobacco. XRCC1 acts as a scaffold and coordinates protein interactions in the BER pathway, including DNA ligase III, DNA polymerase β, and poly ADP-ribose polymerase (PARP).5, 6
Three single nucleotide polymorphisms (SNPs) in XRCC1 have been studied more widely because they are common (minor allele frequency >0.05) and nonsynonymous, resulting in amino acid changes that may alter the protein’s ability to perform its functions. These polymorphisms, Arg194Trp, Arg280His, and Arg399Gln, are all located in evolutionarily conserved regions. Research suggests that polymorphisms in XRCC1 may influence DNA repair. For instance, the 399Gln variant was associated with greater levels of glycophorin A variants and DNA adducts,7-9 as well as sister chromatid exchanges.9-11 Others did not observe a relationship between DNA adducts and either the 399Gln or 194Trp polymorphisms.12 In a study of oral cancers, researchers found that the 399Gln allele was associated with a higher frequency of TP53 mutations,13, 14 providing additional support that XRCC1 polymorphisms may alter risk of HNSCC.
Epidemiologic findings for the association of these XRCC1 polymorphisms with HNSCC have been inconsistent. For example, some researchers have reported that HNSCC risk was increased among those with 194Trp15-17 and 280His,17 while others have reported no association with these polymorphisms.15, 18, 19 The most research has been conducted on the 399Gln polymorphism, in part because of its location in a BRCT binding domain thought to be important in protein interaction.6, 20 Olshan et al.18 found that the 399Gln polymorphism was associated with a reduced risk of HNSCC for both blacks and whites. This was later supported by a pooled analysis of two studies in the U.S. and one in Puerto Rico where the homozygous-variant genotype was reported to be protective and statistically significant.21 Contradicting this relationship were studies that found the 399Gln allele to increase HNSCC risk17, 22 or have no relationship with HNSCC risk,15, 16, 19, 23 including a meta-analysis of seven studies which reported no association for both studies of whites and Asian populations.23 Explanations for these conflicting findings included that the studies had low power, the populations studied differed in their tobacco use or exposure to other DNA damaging agents, or the polymorphisms were in linkage disequilibrium with another polymorphism.21
However, another possible explanation is that previous studies did not examine this relationship while accounting for the presence of exposure to Human papillomavirus-type 16 (HPV16). Research suggests that HPV16-related HNSCC differs clinically and etiologically. For instance, survival among HNSCC patients has been found to be better among those with HPV16-related disease.24-31 In addition, the influence of the predominant risk factors, alcohol and tobacco, have been found to be diminished or null among HPV16-related HNSCC.32 Another example involves the relationship between HPV16, HNSCC risk, and Vitamin C consumption. When HPV16 exposure was ignored, the association between Vitamin C and HNSCC appeared null;33 however, when stratified by HPV16, Vitamin C was associated with a decreased HNSCC risk among the HPV16 seronegative but an increased HNSCC risk among the HPV16 seropositive.34 Mounting evidence strongly suggests that HPV16-related HNSCC is a distinct disease. Therefore, if the HPV16-positive individuals are included in an analysis assessing an interaction between XRCC1 polymorphisms and smoking, bias toward the null may occur.
Our objective was to determine whether the XRCC1 polymorphisms Arg194Trp, Arg280His, and Arg399Gln, analyzed as haplotypes, influence the risk of HNSCC. In particular, we evaluated whether smoking modifies this relationship, and if this differed for HPV16-related and HPV16-unrelated HNSCC.
Study population
Incident cases of HNSCC in Greater Boston, Massachusetts diagnosed between December 1999 and December 2003 were identified from head and neck clinics and departments of otolaryngology or radiation oncology at nine Boston-area academic medical facilities (New England Medical Center, Massachusetts General Hospital, Massachusetts Eye and Ear Infirmary, Dana-Farber Cancer Institute, Brigham and Women’s Hospital, Boston Veterans Administration, Beth Israel Deaconess Medical Center, Boston Medical Center, and Harvard Vanguard Medical Associates).
Eligibility criteria for cases included carcinoma of the tongue, gum, floor of mouth, other location in the mouth, oropharynx, hypopharynx, ill-defined site within lip oral cavity and pharynx, and larynx (corresponding to International Classificiation of Disease, Ninth Revision (ICD-9) codes 141, 143, 144, 145, 146, 148, 149, and 161, respectively), as determined by review of pathology reports. The diagnosis needed to occur not more than six months prior to when the patient was contacted for study participation. Patients with recurrent disease were excluded. Additional criteria included being at least 18 years of age and a resident of the study area, which included 249 cities and towns within a one hour drive of Boston.
Population-based controls were identified through Massachusetts town books, which are required by state law to list all residents 17 years and older. Potential controls were contacted if they came from the same town as the matched case and were randomly sampled from those who also matched the case’s sex and age (±3 years). Study protocol and materials were approved by the institutional review board at the nine medical facilities and the Harvard School of Public Health, and all study participants provided written informed consent.
A total of 823 HNSCC cases were found to be eligible for the study, although 57 refused to participate and 44 did not complete their questionnaire. The remaining 722 enrolled in the study. For population-based controls, 1,643 eligible subjects were contacted and 815 consented to participate. Six controls were excluded when their corresponding case later became ineligible. Among the remaining subjects, 765 completed the questionnaire. From 2001 on, blood samples were requested, and these were obtained from 81% of cases and 80% of controls enrolled during that time. Blood samples allowed for the detection of HPV16 antibodies, as well as the genotyping and estimation of XRCC1 haplotypes for 485 cases and 549 controls.
Questionnaire
Subjects answered a self-administered questionnaire that inquired about demographic characteristics, medical history, diet, and smoking and drinking habits. Cases received their questionnaires during a clinic visit. Controls were mailed their questionnaires and a research coordinator reviewed their responses in-person on a subsequent visit.
A detailed description of the data collection for smoking and drinking has been discussed previously.32 A brief description is provided here. The questionnaire sections for smoking and drinking were decade-specific. Subjects reported their average consumption of beer, wine, and liquor in a typical week for each decade of their life. These data were used to calculate the subject’s lifetime average drinks per week. If subjects refused to answer the decade-specific alcohol section (50 cases but no controls refused), they reported their usual alcohol consumption: number of days of the week they would drink and the number of drinks they would typically consume. For smoking, subjects who said they had not smoked more than 100 cigarettes (5 packs) in their lifetime were considered never smokers. The remaining subjects were asked to report the number of packs smoked per day during each decade of life, and from this information we calculated pack-years (pack/day-years). If a subject refused to complete the lifetime smoking section (43 cases and 1 control refused), they reported their average cigarettes smoked per day when they were a regular smoker and how many years they smoked.
HPV16 serology
The method used to ascertain the HPV16 serological status of cases and controls has been described previously.35 Serum was separated within 24 hours of collection and frozen at -80°C. The HPV Competitive Luminex® Immunoassay was used to determine presence of antibodies to the L1 protein of HPV16.36 Positive and negative controls were used for quality controls and testing of samples was done in duplicate.
XRCC1 genotyping
Genomic DNA was extracted from whole blood using the QIAamp Blood Kit (QIAGEN, Valencia, California). Arg194Trp (rs1799782, C to T, exon 6), Arg280His (rs25489, G to A, exon 9), and Arg399Gln (rs25487, G to A, exon 10) were genotyped using PCR-RFLP for each SNP individually. The forward (F) and reverse (R) primers were as follows: Arg194Trp F: 5’-TGAAGGAGGAGGATGAGAGC and R: 5’- CTCTACCCTCAGACCCACGA; Arg280His F: 5’-CCCCAGTGGTGCTAACCTAA and R: 5’- ACACCCTGAAGGATCTTCCC; and Arg399Gln F: 5’-CCAAGTACAGCCAGGTCCTA and R: 5’-AGTCTGACTCCCCTCCGGAT. The PCR conditions started with incubation at 94°C for 5 minutes, followed by 35 cycles at 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 45 seconds, and completing with a hold at 72°C for 1 minute. PCR products were digested with RSA I for Arg280His and Msp I for both Arg194Trp and Arg399Gln (New England Biolabs, Beverly, MA). Each digested sample was separated by electrophoresis in an agarose gel containing Triborate EDTA buffer and ethidium bromide. For quality control, laboratory personnel were blinded to case-control status and negative and positive controls were used to ensure replication.
Statistical analysis
We tested whether the SNPs were in Hardy-Weinberg equilibrium among the controls. Unconditional logistic regression was used to calculate odds ratios (ORs) and 95% confidence intervals (CIs) to examine the relationship between XRCC1 SNPs and HNSCC risk. Unconditional logistic regression is appropriate for frequency matching when matching variables are included in the model.37 Models controlled for age (continuous), sex, race (white or other), education (dichotomized by whether earned high school diploma), HPV16 serologic status (negative or positive), alcohol consumption (<3, 3 to <8, 8 to <25, ≥25 average drinks per week), and tobacco use (never smoker, >0 to <20, 20 to <45, and ≥45 pack-years). Since attempts to determine cutpoints for these variables in controls resulted in half of cases assigned to the highest category, the categories of alcohol consumption and tobacco use were based on the distribution in cases and controls combined. More finely adjusting for smoking and drinking did not change the observed associations. We adjusted for differences in education using a dichotomized variable indicating whether or not a subject had earned a high school diploma. Controlling for household income or adjusting for more categories of education did not change the results. Restricting to whites only did not change the findings presented here, therefore, we included subjects regardless of reported race. All statistical tests were two-sided.
To compare our results with other studies, we first generated models containing indicator variables for the heterozygous genotype and homozygous variant genotype compared with the homozygous wild-types and we did this for each of the polymorphisms individually. Haplotypes of XRCC1 were estimated using the HAPPY macro (http://www.hsph.harvard.edu/faculty/kraft/soft.htm38) in SAS version 9.1. Haplotype trend regression39, 40 was used to calculate ORs and 95% CIs for common haplotypes (>.05%), assuming a codominant model. A global Chi-square test was used to examine whether the XRCC1 haplotypes modified risk of HNSCC. Next we investigated whether HPV16 serologic status influenced an association between XRCC1 haplotypes and HNSCC. We created interaction terms by taking the crossproduct for each haplotype and HPV16 serologic status and including theses terms in the model along with terms for the individual haplotypes and HPV16 serology. We conducted a test for interaction by comparing the -2 log likelihoods for models with the crossproducts compared to those without (a 3-degree of freedom test).
We next investigated whether smoking modified an association between XRCC1 haplotypes and HNSCC risk. To increase power, we dichotomized smoking (<20 or ≥20 pack-years). Because previous research suggested that the association between smoking and HNSCC risk differed by HPV16 status,32 we investigated this interaction, stratified by HPV16 serology. However, we lacked the power to look at this relationship in the HPV16 seropositive. Therefore, the XRCC1 data were simplified into a single binary indicator for having at least one copy of a variant allele for any of the polymorphisms. To test for interaction, a model containing the dichotomized variable for smoking, the indicator variable for having an XRCC1 variant, and their crossproduct was compared with a model that did not include the crossproduct (a 1-degree of freedom test).
We have previously reported that the associations between HNSCC with tobacco and HPV16 serology vary by tumor site, with tobacco use being more strongly associated with laryngeal tumors and HPV16 serology as the greatest risk factor for pharyngeal tumors.32, 35 Therefore, in this analysis, we also examined the relationship between HPV16 serology, XRCC1 polymorphisms, smoking, and HNSCC risk by tumor site. As we have described,32 tumors were classified into laryngeal, oral cavity, and pharyngeal. Following the recommendations of the American Joint Committee on Cancer, tumors at the base of the tongue were considered pharyngeal and those located at the anterior of the tongue were classified as of the oral cavity. Two cases with carcinoma of the tongue were excluded from the site analyses because the pathology review did not allow for further classification. We examined the association between site-specific HNSCC risk and having an XRCC1 variant allele, stratified by pack-years status (<20 or ≥20 pack-years), among the HPV16 seronegative. Polytomous logistic regression was used to estimate ORs and 95% CIs, controlling for age, sex, race, education, and alcohol consumption. To assess statistical interaction between pack-years and having an XRCC1 SNP, we examined the Wald test statistic for the interaction term between pack-years and XRCC1.
The distribution of characteristics in the study population is presented in Table I. The mean age of cases was about 60 years of age and they were predominantly male (74%). The proportion of whites compared to non-whites did not differ statistically between cases and controls after controlling for age and sex (P = 0.85); however, cases were less likely than controls to have earned a high school diploma (P < 0.01). In addition, cases had accumulated more pack-years and consumed more alcoholic beverages per week, on average, than controls (P < 0.01). Serologic results suggested that a higher proportion of cases than controls had a positive antibody titer to HPV16 (P < 0.01).
Table I
Table I
Selected descriptive characteristics for a study of head and neck squamous cell carcinoma in the Greater Boston area
Genotyping for each of the three SNPs was 99% complete. In controls, polymorphisms 194Trp and 280His were rarer than 399Gln (minor allele frequency 6%, 5%, and 35%, respectively). SNPs were in Hardy-Weinberg equilibrium (data not shown). The minor allele frequencies did not differ for whites compared with non-whites (194Trp, 280His, and 399Gln: whites: 0.06, 0.05, 0.35; non-whites: 0.07, 0.06, 0.32, respectively).
None of the SNPs individually was associated with HNSCC risk (Table II). Each SNP tagged for a unique haplotype (Table III). The most common haplotype contained no variant alleles and served as the referent group for the ORs. The global test on the haplotypes did not indicate an association between XRCC1 haplotypes and HNSCC risk after controlling for age, sex, race, education, smoking, drinking, and HPV16 serology (P = 0.88). Further, the ORs for individual haplotypes did not suggest an association.
Table II
Table II
Distribution of XRCC1 genotypes among head and neck squamous cell carcinoma cases and controls
Table III
Table III
Association between XRCC1 haplotypes and head and neck squamous cell carcinoma cases and controls
We examined whether HPV16 serology modified the association between XRCC1 haplotypes and HNSCC risk (Table IV). The test for interaction was not statistically significant (P = 0.89). Next we investigated an interaction between pack-years smoked and XRCC1 in HNSCC after stratifying by HPV16 serology. Due to reduced power, we were unable to examine haplotypes among the HPV16 seropositive. Therefore, the XRCC1 data were simplified to indicate whether a subject had at least one variant allele at any of the loci (Table V). Heavy smoking (≥20 pack-years) modified the relationship between XRCC1 polymorphisms and HNSCC risk among the HPV16 seronegative (Pinteraction = 0.04) but not among the HPV16 seropositive (Pinteraction = 0.89). For the HPV16 seronegative who were light/never smokers, those with a variant allele were at reduced risk of HNSCC compared with those having no XRCC1 variants (OR, 0.70; 95% CI, 0.42-1.17); whereas heavy smokers among the HPV16 seronegative were more likely to be at an elevated risk of HNSCC. For instance, heavy smoking in the HPV16 seronegative was associated with a nonsignificantly elevated risk of HNSCC among those with no XRCC1 variants (OR, 1.62; 95% CI, 0.90-2.93) and there was a 2-fold significantly increased risk among heavy smokers with at least one XRCC1 variant (OR, 2.25; 95% CI, 1.35-3.75). However, among those who were HPV16 seropositive, heavy smoking was not associated with an elevated risk, regardless of XRCC1 variants.
Table IV
Table IV
Association between XRCC1 haplotypes and head and neck squamous cell carcinoma cases and controls, stratified by HPV16 serology
Table V
Table V
Risk of head and neck squamous cell carcinoma from combined exposure to any XRCC1 polymorphism and smoking, stratified by HPV16 serology
Though we lacked power to estimate haplotypes among the HPV16 seropositive, we were able to examine XRCC1 haplotypes for the HPV16 seronegative (Table VI). We again observed that heavy smokers with variant alleles were at greater risk of HNSCC whereas a variant allele for lighter/never smokers appeared to be associated with a reduced risk of HNSCC, and this difference was of borderline statistical significance (Pinteraction = 0.05). Specifically, heavier smokers (≥20 pack-years) who had the 399Gln haplotype were at increased risk of HNSCC (OR, 1.35; 95% CI, 0.97-1.86). Also, heavier smokers with the 194Trp haplotype had an elevated risk of HNSCC (OR, 1.74; 95% CI, 0.87-3.48). Conversely, among never or light smokers, having a haplotype containing a variant allele appeared to be associated with a reduced risk of HNSCC, and this was of borderline statistical significance for the haplotype containing 399Gln (OR, 0.74; 95% CI, 0.51-1.08).
Table VI
Table VI
Restricting to the HPV16 seronegative: Association between XRCC1 haplotypes and head and neck squamous cell carcinoma cases and controls, stratified by pack-years
Next we examined the interaction between the XRCC1 SNPs and tobacco use in the HPV16 seronegative by tumor location. There were 93 laryngeal cases, 187 cases of the oral cavity, and 203 pharyngeal cases. Of these, 75 laryngeal, 160 oral cavity, and 103 pharyngeal cases were HPV16 seronegative (Table VII). Within the strata of never/light smokers who were HPV16 seronegative, having an XRCC1 polymorphism was associated with a nonsignificantly reduced risk of HNSCC, which was consistent regardless of tumor site. However, among the heavier smokers who were HPV16 seronegative, having an XRCC1 polymorphism was associated with a nonsignificant 1.5-fold increased risk of HNSCC for tumors of the oral cavity and pharynx. The interaction between pack-years and XRCC1 polymorphisms reached statistical significance for tumors of the oral cavity (Pinteraction = 0.04) but not pharyngeal tumors (Pinteraction= 0.20) due to the reduced power to examine this relationship in the pharynx. We lacked power to examine an interaction between smoking and XRCC1 polymorphisms by site among the HPV16 seropositive (data not shown).
Table VII
Table VII
XRCC1 polymorphisms, smoking, and association with site-specific head and neck squamous cell carcinoma, restricting to the HPV16 seronegative
Smoking modified the association between XRCC1 polymorphisms and HNSCC risk for the HPV16 seronegative but not the HPV16 seropositive. Among the HPV16 seronegative, those who smoked 20 or more pack-years were at increased risk of HNSCC if they carried a variant polymorphism for XRCC1. For light or never smokers who were HPV16 seronegative, XRCC1 polymorphisms may result in a reduced risk of HNSCC. Among the HPV16 seropositive, there was no relationship between either XRCC1 polymorphisms or smoking and HNSCC risk. The XRCC1 polymorphisms tagged for unique haplotypes. The individual haplotypes containing 399Gln or 194Trp were associated with HNSCC risk among heavier smokers without HPV16 exposure. The data suggested that this interaction among the HPV16 seronegative may be most relevant to tumors of the oral cavity and pharynx. However, the site-specific analyses were preliminary as our power to examine this question was low. Overall, we cannot dismiss the role that chance may have had in these results, yet the data further support the literature indicating that HNSCC pathways may differ by HPV status.
Without accounting for exposure to HPV16, the association between XRCC1 haplotypes, smoking, and HNSCC risk would have been missed. That there was no interaction between HPV16 and XRCC1 is not surprising given that HPV16 carcinogenesis is not directly associated with DNA damage, but rather, the HPV16 proteins E6 and E7 interfere with the tumor suppressors pRb and p53.41, 42 The lack of an interaction between XRCC1 polymorphisms and HPV16 serology suggests that impaired DNA repair does not influence HPV16 carcinogenesis. Similarly, to our knowledge, no DNA damaging agent has been found to enhance the carcinogenicity of HPV16 in HNSCC. For example, it has been previously reported that smoking, which leads to the formation of DNA adducts, does not further increase risk of HNSCC risk among the HPV16 positive.32
Among the HPV16 seronegative, we found that smoking modified an association between XRCC1 polymorphisms and HNSCC risk. DNA adducts from smoking are thought to lead to mutations in daughter cells, and these mutations may deactivate tumor suppressors including p53.43, 44 If the XRCC1 variant alleles result in poorer repair, this increases the likelihood that the DNA adducts would persist, leading to greater risk of HNSCC, consistent with our data among heavy smokers with variant alleles. However, variant alleles for the light/never smokers may be associated with a reduced risk of HNSCC. Previous studies of HNSCC and XRCC1 polymorphisms have also observed this interaction where the variant allele was associated with a reduced risk in the low exposure category but an elevated risk in the high exposure category, when the exposure was either smoking18 or alcohol consumption.21 Researchers who have studied other types of cancer and found reduced risks associated with XRCC1 polymorphisms have attributed this to persistent DNA damage in cells containing the variant allele which leads to more mutations, making the cell more likely to undergo apoptosis.45-47 On the other hand, heavy smokers with variant alleles thus leading to reduced repair capacity may harbor a greater burden of mutations and an increased likelihood of compromising genes involved in apoptosis (e.g., the deactivation of p53), thereby preventing cell death. Thus, the cell and the DNA damage persist, resulting in greater HNSCC risk.
Our estimation of XRCC1 haplotypes and their distribution was similar to other studies.15, 19 In addition, our observation of no overall association between HNSCC risk and XRCC1 polymorphisms was consistent with previous research,15, 18, 19, 23 as was the finding of an interaction with smoking.16, 18, 22 However, as stated earlier, not all previous studies were in agreement with these results. Our results indicate that the discrepancies in the literature may be due to differences in the distribution of smoking and exposure to HPV16 across populations, and that consideration of HPV16 status may be necessary to appropriately evaluate the smoking-XRCC1 relationship in HNSCC.
The allele frequencies we observed were comparable to the frequencies reported in other white populations in the United States,18, 21-23 however, reported frequencies for the 194Trp and 280His alleles tended to be slightly higher and the 399Gln allele frequency lower in Korean15 and Indian17, 48 populations. The majority of the non-whites in our study population were black, and their allele frequencies did not vary greatly from that of whites. This similarity has been reported in studies of XRCC1 where both groups were represented,18, 49 although not always.50 When we compared results that included subjects from all backgrounds and controlled for race with models that restricted to whites, the results were unchanged.
The use of serology to determine exposure to HPV16 has its limitations. For example, serology is not site-specific. Thus, being seropositive is not indicative of where in the body infection occurred, although previously we have demonstrated that increasing HPV titer was associated with presence of HPV DNA in HNSCC tumors.35 In addition, HPV serology has been found to have strong specificity but weaker sensitivity.51 In particular, investigators have reported that seroconversion is less likely with transient infections than with persistent ones.52 As a result, it is possible that we are underestimating past HPV16 exposure. Potential misclassification of HPV16 exposure may have reduced the observed associations, although we cannot say with certainty what impact this misclassification may have had on the observed associations and interactions.
A limitation of this study was the lower participation rate in the controls, a widespread challenge in population-based case-control studies. Among those who did participate, the majority also provided blood samples from which both XRCC1 genotypes and HPV16 seropositivity were determined. Thus, for bias to influence our results, controls would have had to preferentially participate by XRCC1 genotype or by HPV16 exposure. This appears unlikely given that subjects were not informed of the study hypotheses. In contrast, smoking was self-reported, and it has been reported that subjects who decreased their smoking tended to underestimate their past cigarette consumption.53 Therefore, if cases had recently decreased their smoking due to disease, it is possible that they may underreport their past cigarette use. If this was the case, the association with smoking may be underestimated.
XRCC1 polymorphisms may confer susceptibility to HNSCC in the context of smoking, among those who are HPV16 seronegative. Our analysis provides support to the growing recognition that HPV16-related HNSCC is a distinct disease and future research into HNSCC susceptibility and other HNSCC risk factors should examine their disease impact separately by HPV16 status.
ACKNOWLEDGEMENTS
We would like to acknowledge Judith Smith and Janine Bryan of the Department of Vaccine Biologics Research at Merck and Co., Inc. for their efforts in the collection of HPV serology data.
Grant Support: This work was supported by grants OH009390, CA100679, and CA078609 from the National Institute of Occupational Safety & Health, the National Institutes of Health, Friends of the Dana Farber Cancer Center, and the Flight Attendant Medical Research Institute.
Footnotes
Impact of paper: We found that smoking modified the relationship between haplotypes in the DNA repair gene XRCC1 and HNSCC risk only in those not previously infected by Human papillomavirus-type 16 (HPV16); an association that would have been missed if there was no consideration of HPV16 status. Our approach indicates that we have found a very important factor that will minimize bias in genome association studies in HNSCC, and that it is critical to evaluate HPV16-related disease as etiologically distinct.
1. Kamangar F, Dores GM, Anderson WF. Patterns of cancer incidence, mortality, and prevalence across five continents: defining priorities to reduce cancer disparities in different geographic regions of the world. J Clin Oncol. 2006;24:2137–50. [PubMed]
2. American Cancer Society Cancer Facts & Figures 2007. American Cancer Society; 2007.
3. Blot WJ, McLaughlin JK, Winn DM, Austin DF, Greenberg RS, Preston-Martin S, Bernstein L, Schoenberg JB, Stemhagen A, Fraumeni JF., Jr. Smoking and drinking in relation to oral and pharyngeal cancer. Cancer Res. 1988;48:3282–7. [PubMed]
4. Schottenfeld D, Fraumeni JF. Cancer epidemiology and prevention. 3rd ed Oxford University Press; New York: 2006.
5. Kubota Y, Nash RA, Klungland A, Schar P, Barnes DE, Lindahl T. Reconstitution of DNA base excision-repair with purified human proteins: interaction between DNA polymerase beta and the XRCC1 protein. EMBO J. 1996;15:6662–70. [PubMed]
6. Masson M, Niedergang C, Schreiber V, Muller S, Menissier-de Murcia J, de Murcia G. XRCC1 is specifically associated with poly(ADP-ribose) polymerase and negatively regulates its activity following DNA damage. Mol Cell Biol. 1998;18:3563–71. [PMC free article] [PubMed]
7. Lunn RM, Langlois RG, Hsieh LL, Thompson CL, Bell DA. XRCC1 polymorphisms: effects on aflatoxin B1-DNA adducts and glycophorin A variant frequency. Cancer Res. 1999;59:2557–61. [PubMed]
8. Matullo G, Palli D, Peluso M, Guarrera S, Carturan S, Celentano E, Krogh V, Munnia A, Tumino R, Polidoro S, Piazza A, Vineis P. XRCC1, XRCC3, XPD gene polymorphisms, smoking and (32)P-DNA adducts in a sample of healthy subjects. Carcinogenesis. 2001;22:1437–45. [PubMed]
9. Duell EJ, Wiencke JK, Cheng TJ, Varkonyi A, Zuo ZF, Ashok TD, Mark EJ, Wain JC, Christiani DC, Kelsey KT. Polymorphisms in the DNA repair genes XRCC1 and ERCC2 and biomarkers of DNA damage in human blood mononuclear cells. Carcinogenesis. 2000;21:965–71. [PubMed]
10. Lei YC, Hwang SJ, Chang CC, Kuo HW, Luo JC, Chang MJ, Cheng TJ. Effects on sister chromatid exchange frequency of polymorphisms in DNA repair gene XRCC1 in smokers. Mutat Res. 2002;519:93–101. [PubMed]
11. Abdel-Rahman SZ, El-Zein RA. The 399Gln polymorphism in the DNA repair gene XRCC1 modulates the genotoxic response induced in human lymphocytes by the tobacco-specific nitrosamine NNK. Cancer Lett. 2000;159:63–71. [PubMed]
12. Pastorelli R, Cerri A, Mezzetti M, Consonni E, Airoldi L. Effect of DNA repair gene polymorphisms on BPDE-DNA adducts in human lymphocytes. International journal of cancer. 2002;100:9–13. [PubMed]
13. Hsieh LL, Chien HT, Chen IH, Liao CT, Wang HM, Jung SM, Wang PF, Chang JT, Chen MC, Cheng AJ. The XRCC1 399Gln polymorphism and the frequency of p53 mutations in Taiwanese oral squamous cell carcinomas. Cancer Epidemiol Biomarkers Prev. 2003;12:439–43. [PubMed]
14. Tuimala J, Szekely G, Gundy S, Hirvonen A, Norppa H. Genetic polymorphisms of DNA repair and xenobiotic-metabolizing enzymes: role in mutagen sensitivity. Carcinogenesis. 2002;23:1003–8. [PubMed]
15. Tae K, Lee HS, Park BJ, Park CW, Kim KR, Cho HY, Kim LH, Park BL, Shin HD. Association of DNA repair gene XRCC1 polymorphisms with head and neck cancer in Korean population. Int J Cancer. 2004;111:805–8. [PubMed]
16. Demokan S, Demir D, Suoglu Y, Kiyak E, Akar U, Dalay N. Polymorphisms of the XRCC1 DNA repair gene in head and neck cancer. Pathol Oncol Res. 2005;11:22–5. [PubMed]
17. Ramachandran S, Ramadas K, Hariharan R, Kumar R Rejnish, Pillai M Radhakrishna. Single nucleotide polymorphisms of DNA repair genes XRCC1 and XPD and its molecular mapping in Indian oral cancer. Oral oncology. 2006;42:350–62. [PubMed]
18. Olshan AF, Watson MA, Weissler MC, Bell DA. XRCC1 polymorphisms and head and neck cancer. Cancer Lett. 2002;178:181–6. [PubMed]
19. Majumder M, Sikdar N, Paul RR, Roy B. Increased risk of oral leukoplakia and cancer among mixed tobacco users carrying XRCC1 variant haplotypes and cancer among smokers carrying two risk genotypes: one on each of two loci, GSTM3 and XRCC1 (Codon 280) Cancer Epidemiol Biomarkers Prev. 2005;14:2106–12. [PubMed]
20. Zhang X, Morera S, Bates PA, Whitehead PC, Coffer AI, Hainbucher K, Nash RA, Sternberg MJ, Lindahl T, Freemont PS. Structure of an XRCC1 BRCT domain: a new protein-protein interaction module. The EMBO journal. 1998;17:6404–11. [PubMed]
21. Huang WY, Olshan AF, Schwartz SM, Berndt SI, Chen C, Llaca V, Chanock SJ, Fraumeni JF, Jr., Hayes RB. Selected genetic polymorphisms in MGMT, XRCC1, XPD, and XRCC3 and risk of head and neck cancer: a pooled analysis. Cancer Epidemiol Biomarkers Prev. 2005;14:1747–53. [PubMed]
22. Sturgis EM, Castillo EJ, Li L, Zheng R, Eicher SA, Clayman GL, Strom SS, Spitz MR, Wei Q. Polymorphisms of DNA repair gene XRCC1 in squamous cell carcinoma of the head and neck. Carcinogenesis. 1999;20:2125–9. [PubMed]
23. Li C, Hu Z, Lu J, Liu Z, Wang LE, El-Naggar AK, Sturgis EM, Spitz MR, Wei Q. Genetic polymorphisms in DNA base-excision repair genes ADPRT, XRCC1, and APE1 and the risk of squamous cell carcinoma of the head and neck. Cancer. 2007;110:867–75. [PubMed]
24. Haraf DJ, Nodzenski E, Brachman D, Mick R, Montag A, Graves D, Vokes EE, Weichselbaum RR. Human papilloma virus and p53 in head and neck cancer: clinical correlates and survival. Clin Cancer Res. 1996;2:755–62. [PubMed]
25. Gillison ML, Koch WM, Capone RB, Spafford M, Westra WH, Wu L, Zahurak ML, Daniel RW, Viglione M, Symer DE, Shah KV, Sidransky D. Evidence for a causal association between human papillomavirus and a subset of head and neck cancers. J Natl Cancer Inst. 2000;92:709–20. [PubMed]
26. Schwartz SR, Yueh B, McDougall JK, Daling JR, Schwartz SM. Human papillomavirus infection and survival in oral squamous cell cancer: a population-based study. Otolaryngol Head Neck Surg. 2001;125:1–9. [PubMed]
27. Ritchie JM, Smith EM, Summersgill KF, Hoffman HT, Wang D, Klussmann JP, Turek LP, Haugen TH. Human papillomavirus infection as a prognostic factor in carcinomas of the oral cavity and oropharynx. Int J Cancer. 2003;104:336–44. [PubMed]
28. Ringstrom E, Peters E, Hasegawa M, Posner M, Liu M, Kelsey KT. Human papillomavirus type 16 and squamous cell carcinoma of the head and neck. Clin Cancer Res. 2002;8:3187–92. [PubMed]
29. Portugal LG, Goldenberg JD, Wenig BL, Ferrer KT, Nodzenski E, Sabnani JB, Javier C, Weichselbaum RR, Vokes EE. Human papillomavirus expression and p53 gene mutations in squamous cell carcinoma. Arch Otolaryngol Head Neck Surg. 1997;123:1230–4. [PubMed]
30. Sisk EA, Soltys SG, Zhu S, Fisher SG, Carey TE, Bradford CR. Human papillomavirus and p53 mutational status as prognostic factors in head and neck carcinoma. Head Neck. 2002;24:841–9. [PubMed]
31. Chiba I, Shindoh M, Yasuda M, Yamazaki Y, Amemiya A, Sato Y, Fujinaga K, Notani K, Fukuda H. Mutations in the p53 gene and human papillomavirus infection as significant prognostic factors in squamous cell carcinomas of the oral cavity. Oncogene. 1996;12:1663–8. [PubMed]
32. Applebaum KM, Furniss CS, Zeka A, Posner MR, Smith JF, Bryan J, Eisen EA, Peters ES, McClean MD, Kelsey KT. Lack of association of alcohol and tobacco with HPV16-associated head and neck cancer. J Natl Cancer Inst. 2007;99:1801–10. [PubMed]
33. Peters ES, Luckett BG, Applebaum KM, Marsit CJ, McClean MD, Kelsey KT. Dairy products, leanness, and head and neck squamous cell carcinoma. Head Neck. 2008;30:1193–205. [PMC free article] [PubMed]
34. Meyer MS, Applebaum KM, Furniss CS, Peters ES, Luckett BG, Smith JF, Bryan J, McClean MD, Marsit CJ, Kelsey KT. Human papillomavirus type 16 modifies the association between fruit consumption and head and neck squamous cell carcinoma. Cancer Epidemiol Biomarkers Prev. 2008;17 in press. [PMC free article] [PubMed]
35. Furniss CS, McClean MD, Smith JF, Bryan J, Nelson HH, Peters ES, Posner MR, Clark JR, Eisen EA, Kelsey KT. Human papillomavirus 16 and head and neck squamous cell carcinoma. Int J Cancer. 2007;120:2386–92. [PubMed]
36. Dias D, Van Doren J, Schlottmann S, Kelly S, Puchalski D, Ruiz W, Boerckel P, Kessler J, Antonello JM, Green T, Brown M, Smith J, et al. Optimization and validation of a multiplexed luminex assay to quantify antibodies to neutralizing epitopes on human papillomaviruses 6, 11, 16, and 18. Clin Diagn Lab Immunol. 2005;12:959–69. [PMC free article] [PubMed]
37. Rothman KJ, Greenland S. Modern epidemiology. 2nd ed Lippincott-Raven; Philadelphia, PA: 1998.
38. Kraft P, Yen YC, Stram DO, Morrison J, Gauderman WJ. Exploiting gene-environment interaction to detect genetic associations. Hum Hered. 2007;63:111–9. [PubMed]
39. Zaykin DV, Westfall PH, Young SS, Karnoub MA, Wagner MJ, Ehm MG. Testing association of statistically inferred haplotypes with discrete and continuous traits in samples of unrelated individuals. Hum Hered. 2002;53:79–91. [PubMed]
40. Kraft P, Cox DG, Paynter RA, Hunter D, De Vivo I. Accounting for haplotype uncertainty in matched association studies: a comparison of simple and flexible techniques. Genet Epidemiol. 2005;28:261–72. [PubMed]
41. Rapp L, Chen JJ. The papillomavirus E6 proteins. Biochim Biophys Acta. 1998;1378:F1–19. [PubMed]
42. Munger K, Werness BA, Dyson N, Phelps WC, Harlow E, Howley PM. Complex formation of human papillomavirus E7 proteins with the retinoblastoma tumor suppressor gene product. EMBO J. 1989;8:4099–105. [PubMed]
43. Boyle JO, Hakim J, Koch W, van der Riet P, Hruban RH, Roa RA, Correo R, Eby YJ, Ruppert JM, Sidransky D. The incidence of p53 mutations increases with progression of head and neck cancer. Cancer Res. 1993;53:4477–80. [PubMed]
44. Brennan JA, Boyle JO, Koch WM, Goodman SN, Hruban RH, Eby YJ, Couch MJ, Forastiere AA, Sidransky D. Association between cigarette smoking and mutation of the p53 gene in squamous-cell carcinoma of the head and neck. N Engl J Med. 1995;332:712–7. [PubMed]
45. Nelson HH, Kelsey KT, Mott LA, Karagas MR. The XRCC1 Arg399Gln polymorphism, sunburn, and non-melanoma skin cancer: evidence of gene-environment interaction. Cancer Res. 2002;62:152–5. [PubMed]
46. Kelsey KT, Park S, Nelson HH, Karagas MR. A population-based case-control study of the XRCC1 Arg399Gln polymorphism and susceptibility to bladder cancer. Cancer Epidemiol Biomarkers Prev. 2004;13:1337–41. [PubMed]
47. Han J, Hankinson SE, Colditz GA, Hunter DJ. Genetic variation in XRCC1, sun exposure, and risk of skin cancer. Br J Cancer. 2004;91:1604–9. [PMC free article] [PubMed]
48. Majumder M, Sikdar N, Ghosh S, Roy B. Polymorphisms at XPD and XRCC1 DNA repair loci and increased risk of oral leukoplakia and cancer among NAT2 slow acetylators. Int J Cancer. 2007;120:2148–56. [PubMed]
49. Mathonnet G, Labuda D, Meloche C, Wambach T, Krajinovic M, Sinnett D. Variable continental distribution of polymorphisms in the coding regions of DNA-repair genes. J Hum Genet. 2003;48:659–64. [PubMed]
50. Duell EJ, Holly EA, Bracci PM, Wiencke JK, Kelsey KT. A population-based study of the Arg399Gln polymorphism in X-ray repair cross- complementing group 1 (XRCC1) and risk of pancreatic adenocarcinoma. Cancer Res. 2002;62:4630–6. [PubMed]
51. Iftner T, Villa LL. Chapter 12: Human papillomavirus technologies. J Natl Cancer Inst Monogr. 2003:80–8. [PubMed]
52. Newall AT, Brotherton JM, Quinn HE, McIntyre PB, Backhouse J, Gilbert L, Esser MT, Erick J, Bryan J, Formica N, MacIntyre CR. Population seroprevalence of human papillomavirus types 6, 11, 16, and 18 in men, women, and children in Australia. Clin Infect Dis. 2008;46:1647–55. [PubMed]
53. Persson PG, Norell SE. Retrospective versus original information on cigarette smoking. Implications for epidemiologic studies. Am J Epidemiol. 1989;130:705–12. [PubMed]