PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Neurosci. Author manuscript; available in PMC 2010 April 8.
Published in final edited form as:
PMCID: PMC2745949
NIHMSID: NIHMS107868

Neuromedin B and gastrin releasing peptide excite arcuate nucleus neuropeptide Y neurons in a novel transgenic mouse expressing strong renilla GFP in NPY neurons

Abstract

Neuropeptide Y (NPY) is one of the most widespread neuropeptides in the brain. Transgenic mice were generated that expressed bright renilla GFP in most or all of the known NPY cells in the brain, which otherwise were not identifiable. GFP expression in NPY cells was confirmed with immunocytochemistry and single cell RT-PCR.

NPY neurons in the hypothalamic arcuate nucleus play an important role in energy homeostasis and endocrine control. Whole cell patch clamp recording was used to study identified arcuate NPY cells. Primary agents that regulate energy balance include melanocortin receptor agonists, AgRP, and cannabinoids; none of these substances substantially influenced electrical properties of NPY neurons. In striking contrast, neuropeptides of the bombesin family, including gastrin releasing peptide and neuromedin B which are found in axons in the arcuate nucleus and may also be released from the gut to signal the brain, showed strong direct excitatory actions at nanomolar levels on the NPY neurons, stronger than the actions of ghrelin and hypocretin/orexin. Bombesin-related peptides reduced input resistance and depolarized the membrane potential. The depolarization was attenuated by several factors: substitution of choline for sodium, extracellular Ni2+, inclusion of BAPTA in the pipette, KB-R7943 and SKF96365. Reduced extracellular calcium enhanced the current, which reversed around − 20 mV. Together, these data suggest two mechanisms, activation of non-selective cation channels and the sodium/calcium exchanger. Since both NPY and POMC neurons, which we also studied, are similarly directly excited by bombesin-like peptides, the peptides may function to initiate broad activation, rather than the cell-type selective activation or inhibition reported for many other compounds that modulate energy homeostasis.

Keywords: feeding, hypothalamus, arcuate nucleus, bombesin, energy homeostasis, electrophysiology, transgenic mouse

INTRODUCTION

Neurons containing neuropeptide Y (NPY) are found throughout the brain, where NPY plays a number of functional roles. In the hypothalamus, arcuate nucleus NPY neurons are thought to play an important anabolic role in energy homeostasis (Stanley and Liebowitz,1985; Elmquist et al., 1999; Saper et al., 2002; Schwartz et al., 2000; Seeley and Woods, 2003) and neuroendocrine regulation (McDonald and Koenig, 1993). Hypothalamic injections of NPY increase food intake (Stanley and Leibowitz, 1985).

In the hippocampus, NPY has been suggested as an endogenous anti-epileptic peptide (Colmers et al., 1991); in the cortex NPY is found in many inhibitory GABA neurons that modulate pyramidal cell function. In other regions of the brain, NPY cells play a role in cardiovascular function, emotion, fear, arousal, and cognition (Colmers and Wahlestedt, 1993). NPY generally exerts inhibitory actions via a number of NPY receptors (Y1–Y5) that are expressed throughout the CNS (Chen and van den Pol, 1996; van den Pol et al., 1996; Rhim et al., 1997; Kopp et al., 2002; Fu et al., 2004; Acuna-Goycolea et al., 2005). Postsynaptically, NPY can reduce calcium currents, activate potassium currents, reduce spike frequency, and hyperpolarize the membrane potential. NPY can also act presynaptically, reducing transmitter release (Colmers et al., 1991).

The introduction of green fluorescent protein (GFP) as a reporter gene has offered an experimental opportunity that has greatly aided electrophysiological recording from neurochemically defined neuronal populations (Cowley et al., 2001; van den pol et al., 2004). This approach is particularly useful for NPY neurons which, despite their overall numbers, are acattered throughout brain regions and are not distinguishable by morphological criteria alone. To overcome these issues, others have used NPY-GFP (Pinto et al., 2004; Roseberry et al., 2004); however, the GFP expression appeared lower than revealed by histochemistry, here we present a novel line that was made using a large bacterial artificial chromosome (BAC) sequence containing the NPY promoter driving expression of the bright and stable renilla GFP. The large DNA sequence flanking the Npy gene would be expected to preserve the fidelity of the NPY expression pattern. Human codon-corrected renilla GFP from the sea pansy, a type of soft coral, has been suggested to be brighter and more stable than other variations of green fluorescent protein, and by selection from several transgenic lines, we generated one with high levels of GFP expression in what appear to be most if not all the known NPY cells in the mouse brain, as corroborated with immunocytochemistry and single cell RT-PCR.

This transgenic mouse was used to investigate the electrophysiological responses of hypothalamic arcuate nucleus NPY neurons to several neuromodulators implicated in energy homeostasis, including melanocortin receptor agonist MTII and antagonist AgRP, hypocretin/orexin, ghrelin, cannabinoids, and bombesin, and its mammalian analogs gastrin releasing peptide (GRP), and neuromedin B (NMB). GRP and NMB are synthesized in the hypothalamus and by a number of brain regions that project to the medial hypothalamus, and have been suggested to play a role in a number of neurological and psychiatric disorders, and may also influence energy and endocrine homeostasis. GRP and NMB generated a greater (excitatory) effect than any other agent tested.

METHODS

Generation of Npy-hrGFP BAC transgenic mice

To visualize NPY neurons in the brain, we used the humanized renilla green fluorescent protein (rGFP), codon-corrected for human DNA from the original invertebrate codon sequence. The FRT-Kan-FRT cassette from the plasmid pIGCN21 (provided by Dr. N. G. Copeland, Frederick, Maryland, USA) was amplified by PCR and inserted into the MluI site of phrGFP-1 (Stratagene, La Jolla, CA, USA) generating the vector here called phrGFP-FRT-Kan-FRT. A BAC DNA (clone name = RP24-177I12) containing sequences spanning from 114,423 base pairs upstream and 28,595 base pairs downstream of the mouse Npy gene was electroporated into EL250 bacteria (Lee et al., 2001). The hrGFP-FRT-Kan-FRT cassette from the plasmid phrGFP-FRT-Kan-FRT was amplified by PCR using the following primer set: NPY-GFP-F = 5′ ATAGCTGGAATTGGGACAAAGACGAGCAATCTCAGCATCTCCAAGTCTGAGCCTTCT GTATCCACAGatggtgagcaagcagatcctgaa 3′ and NPY-GFP-R = 5 ′ TCGCCCGGATTGTCCGGCTTGGAGGGGTACCCCTCAGCCAGAATGCCCAAACACACG AGCAGAGATAGAGacaaaatattaacgcttaca 3′. Use of these primers inserts the hrGFP ATG exactly into the Npy ATG and deletes the first 41 bp of the Npy coding sequences. EL250 bacteria bearing the Npy BAC DNA were made electrocompetent and the homologous recombinases were induced according to published protocols (Lee et al., 2001). The hrGFP-FRT-Kan-FRT cassette was then electroporated into EL250 bacteria bearing the Npy BAC DNA and recombined into the Npy BAC DNA. EL250 bacteria bearing the Npy-hrGFP-FRT-Kan-FRT BAC DNA were identified by PCR screening. The FRT-Kan-FRT cassette was removed according to published protocols (Lee et al., 2001). EL250 bacteria bearing the Npy-hrGFP BAC DNA without mutation in the hrGFP coding sequences were obtained. These cells were grown to generate the Npy-hrGFP BAC DNA that was prepared using a commercially available kit (Qiagen, Valencia, CA).

The purified DNA was then microinjected into pronuclei of fertilized one-cell stage embryos of FVB mice (Jackson Laboratories) using standard methods (Hogan et al., 1986). Three transgenic mice (founders) were obtained. Brains from the offspring of one of these founders had strong GFP expression that mimicked NPY distribution. Mice from this transgenic line were used for further studies. Genotyping of Npy-hrGFP transgenic mice was performed by PCR using the following primers: NPY-ata-S-F 5′ TATGTGGACGGGGCAGAAGATCCAGG 3′, NPY-ata-S-R 5′ CCCAGCTCACATATTTATCTAGAG 3prime;, and AA33 5prime;ggtgcggttgccgtactgga 3′. A PCR positive mouse was outcrossed to Swiss Webster mice, and then crossbred to generate a homozygous line.

For purposes of comparison, in a few experiments we also used a transgenic mouse (gift of Dr M.Low, Oregon Health Science Center) that expresses GFP within the arcuate nucleus selectively in POMC neurons, as described elsewhere (Batterham et al., 2002; Cowley et al., 2001).

Use of mice in these experiments here and below was approved by the Animal Use committtees of Yale and Harvard Universities and Stockholm’s Norra Djurforsoksetiska Namnd.

Anatomical analysis and immunohistochemistry

Four mice received an intracerebroventricular (icv) colchicine injection 24 or 48h prior to perfusion. Colchicine-treated and naïve (n=10) mice were anesthetized with an intraperitoneal injection of 0.2 ml of sodium pentobarbital (6 mg/ml) and perfused via the ascending aorta with 10 ml of Tyrode’s Ca2+-free solution (37°C), followed by 10 ml of fixative (4% paraformaldehyde and 0.4% picric acid in 0.16M phosphate buffer, pH 6.9, 37°C), followed by 50 ml of the same, but ice-cold (4°C) fixative. The brains were rapidly dissected out, immersed in the same fixative for 3 h and rinsed for at least 24 h in 0.1M phosphate buffer (pH 7.4) containing 10% sucrose, 0.02% bacitracin and 0.01% sodium azide. The brains were sectioned on a cryostat (Microm, Walldorf, Germany) to 14 μm thickness and thaw-mounted onto gelatine-coated glass slides. For immunohistochemical staining, sections were processed by Tyramide signal amplification (TSA; PerkinElmer LAS; Boston, MA) immunohistochemistry. Sections were incubated with primary antisera against NPY (Phoenix Pharmaceuticals, Burlingame, CA; 1:16 000, raised in rabbit), agouti gene-related peptide (AgRP; Phoenix Pharmaceuticals, 1:8 000, raised in rabbit) or α-melanocyte-stimulating hormone (α-MSH; Millipore, Billica, MA, 1:16 000, raised in sheep) diluted in phosphate-buffered saline (PBS) containing 0.3% Triton X-100 at 4°C over night. Sections were rinsed in TNT buffer (0.1M Tris-HCl, pH 7.5, 0.15M NaCl, 0.05% Tween 20), incubated for 30 min at room temperature with TNB buffer (0.1M Tris-HCl, pH 7.5, 0.15M NaCl, 0.05% blocking reagent provided in TSA kit) and subsequently with horseradish-peroxidase-conjugated swine anti-rabbit (for NPY and AgRP staining) or rabbit anti-sheep (for α-MSH staining) immunoglobulins (Dako A/S, Copenhagen, Denmark) diluted to 1:200 in TNB buffer for 30 min at room temperature. Following a 30 min wash in TNT buffer, sections were incubated in Tyramide-tetramethylrhodamine (1:100 in amplification diluent, provided in TSA kit) for 10 mins in room temperature, rinsed again in TNT buffer for 30 mins and mounted with glycerol containing 2.5% triethylenediamine (Sigma).

After processing, the sections were examined in a Nikon fluorescence microscope equipped with D480 excitation/D535 emission and D560 excitation/D630 emission filters or in an Olympus IX70 fluorescence microscope. Every tenth section was collected and inspected for neurons with GFP expression. The mouse brain atlas of Paxinos and Franklin (2001) was used for reference and preparation of schematic images. Micrographs were collected with a Hamamatsu ORCA-ER camera and Wasabi software, or with a Diagnostic Imaging Spot digital camera. Confocal laser scanning micrographs were captured on a Zeiss LSM410 microscope or an Olympus Fluoview 300. Micrographs were processed in Adobe Photoshop and adjusted for brightness and contrast of a whole micrograph.

Single-cell Reverse-transcription PCR (RT-PCR)

The single-cell RT-PCR method of the present study was similar to that reported previously by Kang et al. (2004) with minor modification. Briefly, the cell contents from each neuron were aspirated into a sterile glass micropipette pre-filled with 5–6 μl of DEPC-treated water. This solution was then expelled into a PCR microtube where cDNA synthesis was performed using the SuperScript III Reverse Transcriptase kit (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. First, an 8 μl solution containing 1μl of each gene-specific oligo (2 μM) and 1 μl of dNTP mix (250 mM) in DEPC-treated water were added to each microtube and incubated at 65°C for 5 minutes, then cooled on ice for 1 minute. The gene-specific oligos used were the reverse primers described in the PCR procedure below. Next, 4 μl of 5X first-strand buffer, 1μl 0.1M DTT solution, 1 μl SuperScript III RT (200 U/μl) and 1 μl RNaseOUT (40 U/μl) were added to each microtube and incubated at 53°C for 60 minutes followed by a heat inactivation step at 70°C for 15 minutes. Finally, 1 μl of RNase H (2 U/μl) was added to each microtube and incubated at 37°C for 20 minutes with the final single-cell cDNA products being stored at −20°C until use.

All PCRs were performed using an iCycler thermocycler (Biorad, Hercules, CA) and the Expand High Fidelity PCR kit (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instructions. Each PCR reaction used 5 μl of single-cell cDNA product for template and one pair of gene-specific primers (30 pmol) in a total volume of 50 μl and was thermocycled 35 times with an extension time of 45 sec. Amplified products were run on 1.5% agarose gels and visualized using ethidium bromide. Gene-specific primer pairs were designed to amplify mouse beta-actin, NPY, AGRP, GRP-receptor and NMB-receptor cDNA sequences based on GenBank accession numbers, NM_007393, NM_023456, NM_007427, NM_008177 and NM_008703, respectively, using OligoPrimer Analysis Software version 6.89 (Molecular Biology Insights). A minimum of 550 bp of intronic sequence was spanned in the design of both amplicons in order to easily distinguish cDNA amplification products from any that might arise from the amplification of genomic DNA.

A single round of PCR (35 cycles) was used in the amplification of beta-actin, NPY and AGRP and a second (nested) round (30 cycles) was used for detecting GRP-receptor and NMB-receptor cDNA. The following list details thetarget gene, annealing temperature, amplicon length and primersequences for each PCR. Beta-actin: 56.7°C, 523 bp, F5′-GCC AAC CGT GAA AAG ATG AC-3′, R 5′-CAA CGT CAC ACT TCA TGA TG-3′. NPY: 54.7°C, 294 bp, F 5′-CAC GAT GCT AGG TAA CAA G-3′, R 5′-CAC ATG GAA GGG TCT TCA AG-3′. AGRP: 57.8°C, 406 bp, F 5′-CTG ACT GCA ATG TTG CTG AG-3′, R 5′-CAA CAT CCA TTG GCT AGG TG-3′. GRP-receptor: (initial) 55.2°C, 353 bp, F 5′-AGA TCT TCT GCA CGG TCA AG-3′, R 5′-GTC AGA AAA CAC AGC CTC TG-3′; (nested) 52.8°C, 297 bp, F 5′-TGC GAA ACG TGC CAA ACC TG-3′, R 5′-ACA TAG AGA CAA TCC AGA TC-3′. NMB-receptor: (initial) 57.8°C, 258 bp, F 5′-AGC TGG GCT GCA AAC TCA TC-3prime;, R 5prime;-TGC ATG CTG TGA AAC TGC TG-3prime;; (nested) 53.2°C, 189 bp, F 5prime;-GTT TCT GTG TTC ACT CTC AC-3prime;, R 5prime;-ATC CAA GCT ACC AAT GCG TG-3prime;.

In an analysis of receptor expression, RT-PCR of mouse brain samples was performed by first micro-dissecting discrete regions of the mouse brain from 250 μm thick brain slices using GFP localization with fluorescence microscopy. Total RNA was then extracted from each sample using the RNeasy Micro kit (Qiagen) and quantified using a NanoDrop spectrophotometer (Thermo Scientific, Waltham, MA). Twenty nanograms of total RNA were used as template in reverse transcription reactions, as described above, and 2 μl of the resulting cDNA products were used as template in the subsequent PCR reactions. The PCR reactions for the GRP-receptor and NMB-receptor were performed using the primers and conditions utilized for the initial round of single-cell PCR described above.

Electrophysiology

Preparation of pyhothalamic slices

Experiments were performed on hypothalamic slices (250–350 μm) obtained from NPY-GFP transgenic mice described here. Two to six week-old mice maintained in a 12/12 hr light/dark cycle were given an overdose of sodium pentobarbital (100 mg/kg) during the light part of the cycle (11:00 A.M. to 4:00 P.M.). Their brains were then removed rapidly and placed in an ice-cold, oxygenated (95% O2 and 5% CO2) high-sucrose solution that contained (in mM) 220 sucrose, 2.5 KCl, 6 MgCl2, 1 CaCl2, 1.23 NaH2PO4, 26 NaHCO3, and 10 glucose, pH 7.4 (with an osmolarity of 300–305 mOsm). A block of tissue containing the hypothalamus was isolated and coronal slices were cut on a vibratome. After a 1–2 hr recovery period, slices were moved to a recording chamber mounted on a BX51WI upright microscope (Olympus, Tokyo, Japan) equipped with video-enhanced infrared-differential interference contrast (DIC) and fluorescence. Slices were perfused with a continuous flow of gassed artificial cerebrospinal fluid (ACSF; 95% O2 and 5% CO2) that contained (in mM) 124 NaCl, 2.5 KCl, 2 MgCl2, 2 CaCl2, 1.23 NaH2PO4, 26 NaHCO3, and 10 glucose, pH 7.4. Bath temperature in the recording chamber was maintained at 35 ± 1 °C using a dual-channel heat controller (Warner Instruments, Hamden, CT). Neurons were visualized with an Olympus Optical 40x water-immersion lens.

Patch-clamp recording

Whole-cell current- and voltage-clamp recordings were performed using pipettes with 4–6 MΩ resistance after being filled with pipette solution. The pipettes were made of borosilicate glass (World Precision Instruments, Sarasota, FL) using a PP-83 vertical puller (Narishige, Tokyo, Japan). For most recordings, the composition of the pipette solution was as follows (in mM): 130 KMeSO4 (or KCl for IPSCs), 1 MgCl2, 10 HEPES, 1.1 EGTA, 2 Mg-ATP, 0.5 Na2-GTP, 5 Na2-phosphocreatine, pH 7.3 with KOH (with an osmolarity of 290–295 mOsm). An EPC10 amplifier and Patchmaster software were used for data acquisition (HEKA Elektronik). PulseFit (HEKA Elektronik), Axograph (Axon instruments, Foster City, CA), and Igor Pro (WaveMetrics, Lake Oswego, OR) software were used for analysis. Liquid junction potential correction was performed offline. Slow and fast capacitance compensation was automatically performed using Patchmaster software (HEKA Elektronik, Lambrecht/Pfalz, Germany). Access resistance was continuously monitored during the experiments. Only those cells in which access resistance was stable (changes <10%) were included in the analysis. Both excitatory and inhibitory spontaneous postsynaptic currents were detected and measured with an algorithm in Axograph, and only those events with amplitude >5 pA were used, as described in detail previously (Gao and van den Pol, 2001). The frequency of action potentials was measured using Axograph as well. Data are expressed as mean ± SEM. Group statistical significance was assessed using Student’s t test for comparison of two groups, and one-way ANOVA followed by a Bonferroni post hoc test for three or more groups. P<0.05 was considered statistically significant.

Drugs and drug application

6-cyano-7-nitroquinoxaline-2,3-dione (CNQX), Dl-2-amino-5-phosphonopentanoic acid (AP5), and bicuculline (BIC) were purchased from Sigma (St. Louis, MO). Tetrodotoxin (TTX) was obtained from Alomone Labs, Ltd. (Jerusalem, Israel). R-(+)-[2,3-dihydro-5-methyl-3-(4-morpholinylmethyl)pyrrolo[1,2,3-de]-1,4-benzoxazin-6-yl]-1-naphthalenylmethanone mesylate (WIN55,212,2) was obtained from Tocris (Ellisville, MO). Bombesin, GRP, NMB, AgRP, hypocretin-1, and ghrelin were obtained from Phoenix Pharmaceuticals (Belmont, CA). MTII was obtained from Bachem Bioscience (King of Prussia, PA). All drugs were given by large diameter (500 μm) flow pipette, directed at the recorded cell, unless otherwise noted. When a drug was not being administered, normal ACSF continuously flowed from the flow pipe. Drug solutions were prepared by diluting the appropriate stock solution with ACSF.

RESULTS

Immunocytochemical and single cell RT-PCR confirmation of GFP in NPY neurons

The arcuate nuclei of transgenic NPY-GFP mice consistently displayed intense fluorescence in cells clustered in the ventromedial portion near the base of the third ventricle. Green fluorescence was apparent throughout the cell soma and in proximal dendrites. In sections immunohistochemically stained for NPY, the GFP+ cell bodies were seen enmeshed in a dense NPY-immunoreactive fiber plexus. As a test of the fidelity of GFP expression in NPY neurons, immunostaining and colocalization with GFP was done with antisera against NPY and AgRP, a peptide exclusively colocalized in arcuate NPY neurons. Immunostained red NPY (Fig. 1A–C) cell bodies also expressed GFP; similarly, AgRP was found in GFP positive neurons (not shown). In mice treated with colchicine to increase peptide concentration in the cell body, NPY immunoreactive cell bodies in the arcuate nuclei of colchicine-treated mice were consistently GFP+, in accordance with previous anatomical data (Broberger et al., 1998). In contrast, α-MSH immunoreactivity was observed in a different population of cells distinct from those displaying green fluorescence, and GFP fluorescence was consistently absent from cells showing α-MSH immunostaining (Fig 1D–F). NPY neurons in the arcuate nucleus (Fig. 1A–F) were surrounded by NPY immunoreactive axons and showed long and short dendrites labeled with GFP.

Figure 1
GFP is expressed selectively in NPY neurons

As a further test to confirm that GFP expression was selective for cells that synthesize NPY, single GFP positive neurons were harvested from the arcuate nucleus and tested with single cell RT-PCR. All seven GFP-positive cells tested also showed mRNA coding for Npy at the expected molecular size, as shown in Fig. 1G. We repeated this with another nine GFP fluorescent arcuate neurons, and all contained Npy mRNA. In addition, GFP positive neurons from other brain areas were tested. All eight cells tested from hippocampus, all four from the dorsomedial hypothalamus, and all four from the cortex expressed Npy mRNA. In contrast to this finding that every one of the 32 GFP positive cells tested also expressed NPY mRNA, all neurons harvested from the hypothalamic ventromedial nucleus (n=9) that showed no GFP expression also showed no expression of Npy mRNA (Fig. 1G). In addition, we used primers for AgRP that colocalizes only with NPY in the arcuate nucleus (Broberger et al, 1998). Four of 4 GFP positive arcuate nucleus neurons showed AgRP mRNA expression and NPY mRNA expression (Fig. 1I), confirming that NPY cells expressed GFP.

To test whether NPY mRNA might have been accidentally harvested from nearby cells during the single-cell collection, we also tested 4 GFP negative cells from the arcuate nucleus of the NPY-GFP mouse, and also tested 6 GFP positive neurons from the arcuate nucleus of a POMC-GFP transgenic mouse; NPY and POMC neurons show overlapping distributions in the arcuate nucleus. All non-NPY-GFP cells from the arcuate nucleus (n=10), including GFP-expressing POMC cells and unidentified neurons with no GFP showed no NPY mRNA, indicating that it was unlikely that neurons other than the single cell harvested contributed substantively to the assay. All neurons used expressed control mRNA coding for β-actin.

In the cortex (Fig 2A–D) and hippocampus (Fig. 2E,F) where many inhibitory neurons contain NPY, GFP positive green neurons also showed red NPY immunoreactivity. Similarly, neurons in the hypothalamus outside the arcuate nucleus, for instance in the lateral hypothalamus, that showed GFP expression also showed NPY immunoreactivity (Fig. 2G).

Figure 2
Confirmation of NPY expression in GFP-expressing neurons

Anatomical regions of GFP expression

Beyond the arcuate nucleus, fluorescent cells were detected in many structures throughout the brain. Fluorescence was observed throughout the cytoplasm and often in primary dendrites, in some nuclei extending far into the dendritic arborizations. Immunohistochemical staining for NPY revealed GFP signal in almost all NPY-ir cell somata. In general, the intensity of NPY immunofluorescence paralleled the brightness of GFP signal. In addition, GFP-positive terminal fibers were observed in many regions, as detailed below. Cell and fiber densities were categorized as low-medium, or high-density (LD, MD, HD, respectively) and GFP brightness was designated as low, medium, and high-intensity (LI, MI, HI, respectively).

Rhinencephalon

The olfactory bulb displayed some of the most intense GFP signal in the form of small cell bodies near the mitral layer and exceptionally bright fluorescence in olfactory ensheathing cells within the olfactory nerve layer bordering on the glomerular layer (Fig. 3A). Fluorescent cell bodies and a medium-dense fiber network were also present in all components of the anterior olfactory nucleus.

Figure 3
Fluorescence micrographs of coronal sections from brains of renilla GFP mice showing distribution of fluorescence

Telencephalon

Cerebral cortex

The cerebral cortex displayed consistently high levels of GFP signal, and cells were generally HI with prominent dendritic arbors. GFP positive cells in the cortex had a general morphology typical of inhibitory interneurons. Fluorescence was observed in all cortical regions, with some relative differences; cell and fiber density were highest in somatosensory cortex, prominent also in visual, motor and prefrontal regions, but less intense in e.g. auditory cortex and notably sparse in retrosplenial cortex. The laminar organization was similar between regions: layer I was dense in fluorescent fibers, but low in cell density. In contrast, layer II/III contained the highest accumulation of cells against a brightly fluorescent fiber background. Layer V displayed only occasional cell somata and no fibers, while layer VI exhibited the second greatest cell density and prominent fiber plexa. The claustrum harboured MI cells surrounded by MD fibers.

Archicortex

Similar to the neocortex, the hippocampus was also rich in GFP signal (Fig. 3F). Typical NPY interneurons were found interspersed within the pyramidal cell layer. In the dentate gyrus, the hilar region contained a high number of cells of varying fluorescence intensities, and was also heavily invested with fibers.

Amygdala

The basolateral nuclei displayed a high-density fiber network with scattered HI multipolar cell bodies (Fig. 3D), whereas the central nucleus was virtually devoid of fluorescent structures. A dense cluster of MI cell bodies were also observed in the basomedial complex, and scattered cells were observed throughout the medial and cortical subnuclei.

Septum

The septal nuclei showed little fluorescence, with the exception of scattered MI cells in the lateral septum and diagonal band. In contrast, the bed nucleus of the anterior commissure contained a HD cluster of MI-HI cells, and Mi cells were also observed throughout the medial bed nucleus of the stria terminalis (Fig. 3C).

Striatum

The caudate-putamen contained scattered intensely GFP-positive cells concentrated in the periphery of the nucleus (Fig. 3E) and embedded in a dense fluorescent fiber network. A similar arrangement but with a higher cell density was seen in the nucleus accumbens (Fig. 3B). In contrast, the globus pallidus was notably lacking in fluorescent structures. The interstitial nucleus of the posterior limb of the anterior commissure (IPAC) harboured abundant HI cells.

Diencephalon

Hypothalamus

The most robust expression of GFP was found in the arcuate nucleus (Fig. 3I). The dorsomedial nucleus also contained positive cells (Fig. 3J), but these cells showed less intense GFP expression, and with less cell density. Scattered LI GFP+ cells were observed in the medial preoptic area, periventricular region, and in the lateral hypothalamus and perifornical region. No fluorescent cells were observed in the suprachiasmatic, ventromedial, paraventricular (Fig. 3H) or supraoptic hypothalamic nuclei or in the pituitary gland.

Thalamus

The reticular thalamic nucleus contained numerous cell bodies of MI fluorescence (Fig. 3G). The medial (but not lateral) habenula and the intergeniculate leaflet (Fig. 4A) also harbored HI cell bodies. In contrast, virtually no cell bodies were seen in relay nuclei, though prominent GFP+ fibers extended throughout the ventrobasal complex.

Figure 4
Micrographs of NPY-rGFP in intergeniculate leaflet (A), inferior colliculus (B), adrenergic C1 cell group in ventral medulla oblongata (C), nucleus of the solitary tract (D) and the lateral caudal medulla oblongata (E). Scale bar 100 μm in B,D; ...

Subthalamus

A prominent population of large MI cell bodies with dendrites were seen in the rostral interstitial nucleus of the medial longitudinal fasciculus. A few HI cells were located in the medial extension of the zona incerta.

Parencephalon

The cerebellum was lacking in GFP signal with the exception of occasional nebulous arborized structures originating in the Purkinje layer and branching into the molecular layer.

Mesencephalon

The periaqueductal grey area displayed few cell bodies and no fibers, with the exception of occasional LI cells adjacent to the cerebral aqueduct and a cluster of MI cells in the ventrolateral subnucleus bordering on the cuneiform nucleus (Fig. 4B). Intense fluorescence was seen in the external and dorsal cortices of the inferior colliculus in the form of high-intensity cells and fibers crossing the midline, whereas the central nucleus contained no cells. GFP signal was absent from the superior colliculus complex and the substantia nigra.

Metencephalon

A small group of MI fluorescent cell somata were seen in the paralemniscal nucleus, the ventromedial tip of the locus coeruleus and in the median raphe, whereas GFP signal was absent in the remaining raphe system.

Myelencephalon

In the nucleus of the tractus solitarius, high-intensity cells with dendrites were observed primarily in the gelatinous and ventrolateral parts (Fig. 4D). Large HI cell bodies with extensive dendritic extensions were seen in the ventrolateral medulla matching the adrenergic C1 cell group, and adjacent to the dorsal motor nucleus of the vagus corresponding to the C2 neurons (Fig. 4C). Large MI cells were scattered throughout the medullary reticular nucleus. Within the trigeminal complex, small GFP+ cells were observed in the caudal part of the spinal nucleus lining up along the spinal trigeminal tract (Fig. 4E).

The position of GFP-expressing NPY cells is depicted in coronal brain sections in Figure 5 and and66.

Figure 5
Schematic illustration depicting the distribution of fluorescent cell bodies-forebrain (filled red circles) in renilla GFP mice. Scale bar 1 mm. Anatomical plates taken from Paxinos and Franklin (2001). NPY-GFP cell bodies are found throughout the brain. ...
Figure 6
Schematic illustration depicting the distribution of fluorescent cell bodies-forebrain(filled red circles) in renilla GFP mice. (continuation) See legend from figure 5.

Periphery

NPY immunoreactive axons were found in the small intestine and stomach. In the pancreas, some cells showed modest GFP expression, and GFP-positive axons surrounded the islets, as described in other species with immunostaining (Myojin et al., 2000).

Axons

GFP expressing axons were found throughout the brain. In the hypothalamic paraventricular nucleus that receives a strong axonal innervation from the NPY neurons of the arcuate nucleus (Bai et al., 1985; Broberger et al., 1999), strong green fluorescence is found (Fig. 7A) in fibers with no labeling in cells of the nucleus. The same section shows strong red immunofluorescence after immunostaining with NPY antisera (Fig. 7B), indicating that the GFP expression parallels NPY axonal immunoreactivity. In the corpus callosum, GFP-positive axons run parallel to the rest of the cortical fibers. In thick sections, GFP fluorescence shows more axons than does red immunostaining (Fig. 7C, D), which may in part be due to penetration of antisera. In addition to axons, granule cell presynaptic dendrites that terminate on mitral cells in the external plexiform layer of the olfactory bulb show GFP fluorescence (Fig. 7E, F). These data suggest that sufficient GFP is synthesized in the cell body to diffuse throughout a large part, or all, of the NPY axons or presynaptic dendrites. In the cerebral cortex, strong axonal fluorescence was found in all layers (Fig. 7G).

Figure 7
GFP axons and presynaptic dendrites

A primary rationale for generating and characterizing the NPY-GFP mouse was to use it to study the NPY neurons of the hypothalamus, particularly those in the arcuate nucleus that play a key role in central regulation of energy homeostasis, as described in detail below.

Electrophysiology

Membrane properties of NPY cells in arcuate nucleus

Using whole-cell recording in hypothalamic slices we characterized the membrane properties of GFP-expressing NPY cells in the arcuate nucleus. Of 28 recorded cells, 27 cells fired spontaneously at 1.4 ± 0.2 Hz (range 0.1 to 4.2 Hz). Twelve of the 28 cells showed burst firing (Fig. 8A1), 15 cells fired regularly or irregularly with no bursts (Fig. 8A2), and one cell was silent at rest (−62.6 mV). The mean resting membrane potential was −56.6 ± 1.2 mV (range −46.5 to −72.1 mV, n = 28). The mean spike frequency for non-bursting cells was 1.4 ± 0.3 Hz (0.1 to 4.2 Hz, n=15). For bursting neurons, the burst included 10–20 spikes over a period of 2–3 seconds. Three of 9 cells showed continuous firing during a 700 ms square current pulse of 20 to 40 pA, while the others failed to fire continuously during a current injection of 20 pA or 40 pA (Fig. 8B1–B2) and spike failure was apparent (Fig. 8B2). The mean input resistance was 1320 ± 97 MΩ (822–1997 MΩ, n = 13) calculated from the slope of the linear part of the current-voltage relationship between −60 mV and 0 mV (Fig. 8C1–C2). In 12 of 13 cells, outward current injections hyperpolarized cells to 40 to 70 mV negative to the resting membrane potential; when released from the hyperpolarization, a low threshold spike (LTS) was generated, together with a group of fast spikes (Fig. 8C1). The LTS persisted even in the presence of the Na+ channel blocker TTX 0.5 μM, but was blocked by NiCl2 (200 μM) (Fig. 8C3), suggesting that it is calcium-dependent.

Figure 8
Membrane properties of arcuate nucleus NPY neurons

Synaptic activity was recorded at a holding potential of −35 mV using KMeSO4 pipette solution. The upward events represent the inhibitory postsynaptic currents (IPSCs) and the downward events represent excitatory postsynaptic currents (EPSCs). Both types of synaptic activity were completely blocked by the glutamate and GABA receptor antagonists AP5 (50 μM), CNQX (10 μM) and BIC (30 μM) (Fig. 8D), suggesting that GABA and glutamate account for most of the fast synaptic input to NPY neurons.

Little response to AgRP, melanocortin agonists, or cannabinoids

Two neuropeptides prominent in the regulation of energy homeostasis are the proopiomelanocortin peptides, particularly anorexigenic α-MSH and the MC3/MC4 receptor agonist MTII, and the antagonist at the melacortin receptor, AgRP (Cone, 2006). Neither MTII nor AgRP, used at similar or greater concentrations than used previously (Roseberry et al, 2004; Fu and van den Pol, 2008), changed the activity of NPY cells. After applying MTII (100 nM) for 1 min, neither the spike frequency (110 ± 27% of control (p>0.05, ANOVA, n=6) (control=100%), nor the membrane potential (−1.3 ± 1mV; p>0.05, ANOVA, n=6) was changed; 1 μM MTII had no effect on membrane potential either (1.3 ± 1.1 mV; n=6) or spike frequency (114.3 ± 15.2%). Similarly, one min application of AgRP (100 nM) did not change the spike frequency (94 ± 27% of control; p>0.05, ANOVA, n=8) or membrane potential (−1.4 ± 1mV; p>0.05, ANOVA, n=8) either; 1 μM AgRP also had no effect on membrane potential (0.8 mV ± 0.6 mV; n=6) and no effect on spike frequency (97.9 ± 13.1%, n=6). Furthermore, AgRP (100 nM) had no effect on excitatory synaptic activity, and did not change the frequency of spontaneous EPSCs (4 ± 11% decrease; p>0.05, ANOVA, n=6). AgRP (100 nM) had no effect on spontaneous IPSCs (1.9 ± 3.3 % decrease) (p<0.05 ANOVA, n=5).

Endocannabinoids released from the hypothalamus increase food intake (Cota et al., 2006) and may modulate NPY neurons. Cannabinoids regulate the synaptic activity to arcuate nucleus POMC cells (Hentges et al, 2005). We therefore examined the effect of the type 1 cannabinoid receptor agonist WIN55,212,2 on NPY neuronal activity. WIN55,212,2 (5 μM) exerted no detectable effect on membrane potential (−1.5 ± 0.4 mV; p>0.05, n=5) or spike frequency (+2.0 ± 3.5%; p>0.05, n=5). Cannabinoid receptors are often located on inhibitory terminals. We therefore examined the effect of WIN55,212,2 on spontaneous IPSCs in NPY neurons. In the presence of WIN55,212,2, the sIPSC frequency and amplitude showed little change (5.4 ± 4.2 % and 4.0 ± 6.3%, respectively; n=5, p>0.05, not-significant). We also tested the effect of WIN55,212,2 on spontaneous EPSCs in NPY neurons. In the presence of WIN55,212,2, the sEPSC frequency and amplitude showed little change (3.0 ± 5.3 % and 5.9 ± 6.2%, respectively; n=5, p>0.05, not-significant).

Bombesin/GRP/neuromedin B excite NPY neurons

Bombesin-type receptors are found in the medial hypothalamus; central administration of bombesin suppresses food intake (Merali et al., 1993). Although bombesin probably does not exist in the mammalian brain, closely related peptides of the bombesin family do, and bombesin related peptides have been shown to activate unidentified neurons of the rat arcuate nucleus (Lin and Pan, 1994). The effect of bombesin and the bombesin-related mammalian peptides GRP and NMB on NPY neurons was studied. Bombesin-like peptides reduce feeding when injected into the brain (Tsuchima and Mori, 2005); knockout of one of the bombesin family receptors causes mild obesity (Ohki-Hamazaki et al., 1997). Application of bombesin (250 nM) (a non-selective ligand for bombesin-family receptors (NMB and GRP receptors) depolarized and excited the majority of arcuate NPY neurons (Fig. 9A); a minority of cells tested did not respond to this peptide. Responding cells showed an increased spike frequency sometimes leading to bursts of spikes with an underlying sustained depolarization (Fig. 9A). When data from all 15 cells (responders and non-responders) were analyzed, bombesin increased the spike frequency by 61.5 ± 14.2 %, with a mean depolarization of 5.0 ± 0.5 mV (n=15, p<0.05). Here and below, when some cells in the group did not respond, we show statistics for the responding cells only, and also for the whole group including non-responders, thereby eliminating any statistical bias that might result from data selection. Bombesin increased the spike frequency by 75.6 ± 13.0 % in 12 out of 15 cells studied, with a mean depolarization of 5.8 ± 0.4 mV (n=12; p<0.05); three cells did not show a change >20%, the minimum criterion used to deduce an effect.

Figure 9
GRP/neuromedin B/bombesin excite NPY neurons

Similarly, NMB (250 nM) also excited NPY neurons (Fig. 9B). The mean increase in spike frequency was 80.0 ± 11.5 % in 14 out of 16 cells, with a mean depolarization of 6.2 ± 0.4 mV (p<0.05, Fig. 9); two cells did not meet a >20% change criterion. When all 16 cells were analyzed together, NMB increased the spike frequency by 66.5 ± 10.6 %, with a mean depolarization of 5.6 ± 0.4 mV (n=16, p<0.05). In some cells, the excitatory effect of NMB, similar to bombesin (Fig. 9A), was associated with an oscillation of the membrane potential caused by a rapid burst of spikes leading to a sustained depolarization (Fig. 9A).

GRP (250 nM) at the same concentration as the other peptides excited fewer NPY neurons. As shown in figure 9C,D, GRP (250 nM) increased the spike frequency by 46.0 ± 12.0 % in 7 out of 13 neurons with a mean depolarization of 5.3 ± 0.6 mV. When all 13 cells were included, the spike frequency was increased by 9.2 ± 10.5 % (n=13, p>0.05) after GRP application, with a mean depolarization of 2.6 ± 0.7 mV (n=13, p<0.05). Thus, all three peptides increased spike frequency (Fig. 9D) and depolarized (Fig. 9E) NPY neurons.

Two bombesin-receptors are differentially sensitive to GRP and NMB. To compare the responses of identified neurons, we tested 4 additional concentrations (1, 10, 100, 1000 and 5000 nM) of the two peptides in different sets of NPY neurons. Both GRP and NMB depolarized NPY neurons in a dose-dependent manner. There was no obvious difference in the responses to the two peptides (Fig 9F,G).

To test further whether the NMB or GRP receptor is found in the arcuate nucleus, we used RT-PCR on tissue isolated selectively from the arcuate nucleus. Both NMB-R and GRP-R were identified in the arcuate nucleus (Fig. 9H). When we tried single cell RT-PCR analysis, we were unable to consistently identify either receptor. However, our physiological data showing a consistent response to bombesin like peptide suggested the mRNA was perhaps in too low abundance. We therefore pooled several single NPY cells to increase the amount of template, as described previously (Zhang et al, 2007). In pooled samples, we found a strong NMB-R of the expected molecular weight (Fig. 9I), but found no GRP-R. We did however find GRP-R in other cells of the hypothalamus, indicating the primers were functional, but that GRP-R was either not expressed, or not in detectable abundance in NPY cells. Given the fact that we included a substantial intron spanning sequence, the product is unlikely to be a DNA contaminant, as it would then be expected at a considerably greater molecular weight than found.

Hypocretin/orexin, a hypothalamic neuropeptide involved in cognitive arousal and possibly in increasing food intake (Sakurai et al, 1998) has previously been identified as having an excitatory effect on NPY neurons (Acuna-Goycolea and van den Pol, 2005; van den Top et al, 2004). To assess the magnitude of the response to bombesin-related peptides, we compared the response to hypocretin/orexin at a similar concentration to that used above for bombesin related peptides (250 nM). As shown in figure 9D,E, hypocretin-1 (250 nM) increased the spike frequency by 32.3 ± 15.7 % in 6 out of 8 neurons with a mean depolarization of 2.5 ± 0.3 mV. When all 8 cells were included, the spike frequency was increased by 24.1 ± 12.7 % (n=8, p<0.05) after orexin application, with a mean depolarization of 1.9 ± 0.5 mV (n=8, p<0.05).

Similarly, ghrelin, an appetite-enhancing peptide released by the gut, has been reported to excite NPY neurons (Kumarnsit et al, 2003; Cowley et al, 2003). We applied ghrelin, and recorded both a depolarization and increase in spike frequency. As shown in figure 9D,E, ghrelin (250 nM) increased the spike frequency by 43.3 ± 10.5 % in 5 out of 7 neurons with a mean depolarization of 3.1 ± 0.6 mV. When all 7 cells were included, the spike frequency was increased by 30.9 ± 10.8 % (n=7, p<0.05) after ghrelin application, with a mean depolarization of 2.2 ± 0.7 mV (n=7, p<0.05). When the responses to neuropeptides were compared, bombesin and NMB appeared to exert a greater degree of excitation (p<0.05) than either hypocretin-1 or ghrelin.

Mechanisms of bombesin action on NPY neurons

To determine whether the mechanism of action was pre- or postsynaptic, we first studied the effect of bombesin on membrane potential in the presence of TTX. With TTX (0.5 μM) in the bath, bombesin (250 nM) depolarized the membrane potential by 4.9 ± 0.5 mV (n=5, p<0.05) (Fig. 10A). Similarly, NMB (250 nM) in the presence of TTX depolarized the membrane potential by 5.3 ± 0.3 mV (n=6, p<0.05). These results suggest that bombesin and NMB excite NPY neurons through a direct postsynaptic mechanism that is not dependent on TTX-sensitive Na+ sodium channels.

Figure 10
Direct effect of bombesin on NPY neurons

To determine whether the excitatory actions of bombesin on NPY neurons were accompanied by increases or decreases in channel opening, as detected by changes in input resistance, we delivered negative current steps (from −70 to −10 pA over 500 ms; increments of 10 pA) through the recording pipette and evaluated the changes in the membrane potential before and after bombesin application. In the presence of bombesin, the hyperpolarizing shifts in the membrane potential in response to the injection of negative current steps were reduced (Fig. 10D), and the current-voltage relationship showed a consistent alteration compared with control pre-bombesin conditions (Fig. 10D, E). A linear function was fitted to the current-voltage relationship, and a significant decrease in the slope was observed after bombesin application, consistent with a 22.4 ± 5.7 % reduction in the whole-cell input resistance (n = 8; p < 0.05, Fig. 10D, E).

Depolarization coupled with a decrease in input resistance could be caused by the opening of sodium-dependent channels. To test this hypothesis, we studied the Na+ contribution to bombesin-induced depolarization. When 80% of the extracellular NaCl was replaced by an equimolar concentration of choline chloride, in the presence of TTX (Liu et al., 2002; Wu et al,2004; Sekizawa and Bonham, 2006), the membrane depolarization by bombesin (250 nM) was significantly reduced to 1.8 ± 0.5 mV (n=6) (Fig. 10C,G). When the bombesin depolarizing effects in the presence of NaCl or choline chloride in the bath were compared, a statistically significant difference was detected (p<0.05), suggesting that the bombesin actions on the membrane potential were dependent on extracellular Na+. In addition, when NPY neurons were held at −60 mV under voltage clamp, bombesin induced an inward current (not shown). To determine the reversal potential of this bombesin-induced current, slow voltage ramp protocols (from −120 to 0 mV for 5 sec) were delivered to the NPY cells. These experiments were done in the presence of TTX (0.5 μM), CNQX (10 μM), APV (50 μM) and bicuculline (30 μM) to block any synaptic contribution. The application of bombesin resulted in a consistent inward current, which showed a mean reversal potential near −18.3 ± 3.4 mV in 7 out of 10 cells tested (Fig. 10F). In the remaining 3 cells, the I–V lines remained parallel over the entire voltage range tested (not shown).

With BAPTA (10 mM) in the pipette solution to lower available intracellular Ca2+, the bombesin (250 nM) mediated depolarization of the NPY neuron was reduced from 4.9 ± 0.5 mV to 2.0 mV ± 0.6 mV, a statistically significant reduction (P<0.05). In contrast, when a Ca2+-free extracellular buffer was used, the bombesin-mediated depolarization was increased to 9.0 ± 1.4 mV, a significant increase (p<0.05 Fig. 10B, G), similar to that described for other non-selective cation currents (Hablitz et al, 1986; Xiong et al, 1997). We further tested the effect of SKF96365, a widely used TRP channel inhibitor (Halaszovich et al. 2000). With SKF96365 (30μM) in the bath the bombesin mediated depolarization of the NPY neuron was reduced from 4.9 ± 0.5 mV to 2.7 mV ± 0.6 mV. These results suggest the excitatory effect of bombesin on NPY neurons is mediated by opening of sodium-dependent non-selective cationic channels (Fig. 10G).

In the experiments above, irrespective of the blocker used, some residual depolarization remained, suggesting a second mechanism might be involved. We therefore tested the effects of external Ni2+, a nonselective blocker of the Na+/Ca2+ exchanger (Kimura et al. 1987; Eriksson et al. 2001), on bombesin-induced depolarization. NiCl2 (3 mM) attenuated the depolarization by bombesin. With NiCl2 in the bath, the depolarization by bombesin was 2.4 ± 0.7 mV (n =5; p < 0.05 compared with the 4.9 ± 0.5 mV control depolarization). We next tested the effect of KB-R7943, a selective Na+/Ca2+ exchanger blocker (Iwamoto et al. 1996), on bombesin induced depolarization. Application of KB-R7943 (60 μM) significantly attenuated the depolarization by bombesin (change of membrane potential in the presence of KB-R7943, 2.3 ± 0.9 mV; n = 6; p < 0.05) a statistically significant reduction (Fig. 10G).

These data suggest that bombesin-related peptides excite NPY neurons through two mechanisms, activation of the Na+/Ca2+ exchanger and opening of sodium-dependent non-selective cationic channels, possibly TRP channels.

Bombesin-like peptides modulate synaptic activity

The actions of bombesin on postsynaptic currents in NPY neurons were examined next. As shown in Fig. 11, bombesin (250 nM) decreased the frequency of spontaneous IPSCs by 41.4 ± 5.0 % (n=7, p<0.05) (Fig. 11A). Bombesin also decreased the amplitude of sIPSCs by 18.4 ± 3.8 % (n=7, p<0.05) (Fig. 11B). These studies were performed in the presence of glutamate receptor antagonists CNQX (10 μM) and AP5 (50 μM) with a holding potential −60 mV. To investigate whether bombesin decreases the GABA release by receptors on presynaptic terminals, the effect of bombesin on miniature IPSCs (mIPSCs) was studied in the presence of TTX to block action potentials. Bombesin (250 nM) showed no significant effect on the frequency or amplitude of mIPSCs (change in frequency and amplitude was 5.4 ± 5.5% and 3.3 ± 4.6 %, respectively, n=7, p>0.5; Fig. 11C, D). These results suggest that bombesin decreases GABA release indirectly by acting on cells that projected to NPY neurons, and not by a presynaptic mechanism.

Figure 11
Bombesin modulates synaptic input

Bombesin excites POMC neurons

In contrast to the orexigenic role of NPY cells, the POMC neurons of the arcuate nucleus are considered to serve the opposite function, and to reduce food intake. The effect of bombesin on GFP-identified arcuate POMC neurons was also studied. Similar to NPY cells, bombesin depolarized and excited POMC neurons. Bombesin (250 nM) increased the spike frequency by 97.5 ± 21.4 % in 12 out of 15 cells (p<0.05; n=12), with a mean depolarization of membrane potential of 6.3 ± 0.5 mV (p<0.05, Fig. 12A). The remaining 3 neurons showed only a modest response to bombesin (change <20%). Taking all cells together, bombesin increased the spike frequency from 2.2 ± 0.4 Hz by 83.0 ± 19.5 %, with a mean depolarization of 5.2 ± 0.6 mV (n=15, p<0.05). In the presence of TTX in the bath, bombesin (250 nM) depolarized the membrane potential by 6.2 ± 0.7 mV (n=6, p<0.05) (Fig. 12C), suggesting a direct effect of the peptide.

Figure 12
Bombesin and NMB excite POMC neurons

NMB (250 nM) also excited POMC cells, with a mean depolarization of 5.9 mV ± 0.6 mV and an increase in spike frequency of 79.5 ± 12.6 % with 7 of 7 cells responding (Fig. 12B). The increase in spike frequency and amplitude of depolarization in response to bombesin and NMB was similar in the POMC cells recorded here to the NPY neuron data above. These results suggest that in addition to exciting NPY neurons, bombesin also exerts a direct excitatory action on POMC neurons, and that the magnitude of the excitatory effect was not significantly different from that found in NPY neurons.

DISCUSSION

Robust response to GRP and NMB, but not to melanocortin agonist or antagonist

In a current model of central control of energy homeostasis, arcuate NPY neurons are considered to be orexigenic and provide an anabolic drive (Elias et al., 1999; Schwartz et al., 2000; Saper et al., 2002; Jobst et al., 2004) that counters the anorexigenic POMC neurons. We found little effect of three important neuromodulator receptor agonists that influence energy homeostasis, AgRP, the melanocortin receptor agonist MTII, and cannabinoids. The lack of response to MTII is consistent with the earlier work (Roseberry et al., 2004). In contrast to the lack of a response to these critical modulators of energy homoestasis, bombesin-related peptides evoked a robust excitation of NPY neurons by direct postsynaptic action, sometimes accompanied by rapid spike bursts. The actions of bombesin-related peptides (BRPs) depolarized the membrane potential, resisted TTX block, were attenuated by substitution of choline for sodium, and the induced inward-current reversed around −18 mV suggesting either a non-selective cation channel or the sodium/calcium exchanger. In the presence of Ni2+, or KB-R7943, the effect was attenuated, suggesting activation of the sodium/calcium exchanger. In addition, the current was increased by lowering extracellular Ca2+ but reduced by substitution of Ca2+ for BAPTA in the pipette, and blocked by the TRP channel blocker SKF96365, suggestive of a non-selective cation current. Together, these characteristics are most consistent with two mechanisms, activation of both a non-selective cation channel and of the sodium/calcium transporter.

Bombesin, GRP, and NMB all reduce food intake following systemic administration (Gibbs et al., 1979; Muurahainen et al., 1993; Gutzwiller et al., 1994; Ladenheim et al., 1994; Gonzalez et al., 2008). Our results showing robust excitatory actions of these peptides on the orexigenic NPY neurons may thus appear paradoxical at first. Available data suggest, however, that the satiety-inducing action of bombesin via the GRP-R may be primarily relayed via hindbrain sites such as the nucleus of the solitary tract (Flynn, 1993; 1998; Merali et al., 1993); similarly, the anorexigenic effects of NMB are blocked by fourth ventricular administration of an antagonist specific for the NMB-R (Ladenheim et al., 1997) and may be relayed via the vagus nerve since this effect is not observed after primary sensory neurons are ablated (Ladenheim and Knipp, 2007).

Thus, it may be that the arcuate nucleus effects of BRPs studied here are not related to the previously described satiety effects of these peptides, and that the endogenous anatomical substrate for these actions represents a central BRP system. NMB and GRP are found in neurons in the hypothalamus and brain regions that project to the arcuate nucleus (Panula et al., 1982; Chronwall et al., 1983; Wada et al., 1990; Mikkelsen et al., 1991); their receptors are also expressed in the medial hypothalamus (Zarbin et al., 1985; Wada et al., 1990; 1991; 1992; Moody and Merali,2004). Our RT-PCR analysis of the arcuate nucleus showed expression of both the NMB and GRP receptors, consistent with earlier reports (Kamichi et al., 2005). RT-PCR analysis of NPY cells showed expression of the NMB receptor, but not GRP receptor. The lack of detectable GRP receptor suggests either a variant NMB-R that shows some response to GRP, or a level of GRP-R too low to detect by RT-PCR in these cells. As a third BRP receptor (BRS-3) shows little sensitivity to peptides tested here (Gonzalez et al., 2008), it is unlikely that this receptor is involved in the GRP/NMB responses. The NPY cells are involved not only in energy homeostasis, but also in endocrine regulation (McDonald and Koenig, 1993). The excitatory actions of GRP and bombesin may therefore relate to a role of these neuropeptides in modulating pituitary secretions.

Many neuromodulators have been reported to exert opposing effects on NPY and POMC cells by direct and indirect mechanisms. For instance, leptin excites POMC, but inhibits NPY neurons (Cowley et al., 2001; Coll et al., 2007). Similarly, ghrelin excites NPY neurons, but inhibits POMC neurons (Cowley et al., 2003). Foxo1, a mediator of insulin signalling, stimulates NPY, but inhibits POMC transcription (Kim et al., 2006). Serotonin inhibits NPY, but stimulates POMC cells (Heisler et al., 2003; 2006). In contrast to these opposing actions of other neuroactive substances, we find that in addition to excitatory responses in NPY neurons, BRPs also excite POMC neurons with responses of relatively similar strength. Given the rich innervation of preganglionic sympathetic spinal neurons provided by melanocortin fibers (Saper et al., 1976; Swanson and Kuypers, 1980; Elias et al., 1998), it is also possible that the excitation of POMC cells shown here relate to the potent central sympatho-excitatory effects of BRPs (Brown et al., 1978). The similar excitatory responses to BRPs by NPY and POMC cells suggest that BRPs may be involved in some broad activation of the arcuate nucleus energy homeostasis system, rather than selective activation of either orexigenic or anorexigenic systems. The same may be true for the arousal-promoting neuropeptide hypocretin/orexin, that similarly excites both NPY (van den Top et al, 2004) and POMC neurons (Acuna-Goycolea and van den Pol, 2009). BRP-mediated excitation of the POMC cell appears to override the inhibition that would be caused by activation of inhibitory inputs to POMC cells from similarly stimulated NPY neurons (Cowley et al, 2001). Hypothetically, another possibility is that simultaneous activation of both NPY and POMC cells relates to some decision-making situation determining whether or not to feed under complex environmental input that may include food scarcity, circadian cycle, environmental threat or other factors that merit attention related to food intake.

Renilla transgenic mouse

The fluorescent signal in the transgenic mouse in the present study, based on renilla GFP, was substantially stronger than the signal from another reporter gene, tau-sapphire GFP (Roseberry et al., 2004) and was also much stronger than found in another mouse in which GFP driven by a mouse prion promoter was expressed in NPY neurons in the hilar region of the hippocampus (Fu and van den Pol, 2007). There are several possible reasons for the strong fluorescence in the mouse described here-use of renilla GFP instead of sapphire, use of a long BAC sequence as the promoter, the use of free cytoplasmic GFP rather than attachment to the axonal protein tau, and selection of the mouse line that expressed GFP most robustly from a number of transgenic lines. Physiologically, NPY cells here expressing GFP appeared to show similar physiological characteristics to that previously reported using other means of detection or weaker fluorescence, including burst firing, as described earlier (Roseberry et al., 2004; van den Top et al., 2004; Acuna-Goycolea and van den Pol, 2005). These data support the view that expression of codon corrected renilla GFP does not appear to alter the physiological properties of those neurons that express it.

Cells expressing GFP under the control of the NPY promoter were observed in a wide distribution throughout the brain. As previously published accounts of the distribution of NPY peptide (Chronwall et al., 1985; de Quidt and Emson, 1986; Ubink et al., 1994) and mRNA (Gehlert et al., 1987) in the brain have almost exclusively focused on the rat, these data, to our knowledge, offer the first systematic description of NPY neurons in the mouse brain. The distribution pattern of preproNPY mRNA-expressing cells (Allen Brain Altas: www.brain-map.org) strikingly mirror our findings of NPY-GFP distribution, further supporting the validity of this transgenic model. NPY promoter-driven GFP expression appears to identify clearly living NPY neurons. We could detect GFP-positive cells even in the lateral hypothalamus and dorsomedial nucleus, where NPY is low but enhanced during certain metabolic challenges and during development (Grove et al., 2003); the presence of NPY neurons in these areas was confirmed with immunocytochemistry. We also readily detected fluorescent cells in the reticular thalamic nucleus, which can be difficult to visualize with some NPY antisera (Chronwall et al., 1985; de Quidt and Emson, 1986), but can be observed with preproNPY in situ hybridization (Gehlert et al., 1987). We also found strong GFP expression in olfactory ensheathing cells in the olfactory nerve, confirming earlier reports of NPY in these glia (Ubink et al., 1994; Ubink and Hokfelt, 2000).

We corroborated the identity of the GFP expressing cells with immunocytochemical staining for NPY, and with single cell RT-PCR. In the arcuate nucleus, NPY- and AgRP-immunoreactive cells were GFP-positive, in agreement with the unique coexistence of these peptides (Broberger et al., 1998; Hahn et al., 1998). In contrast, the neighbouring POMC cells did not express GFP. Together, these findings suggest that most, if not all, NPY cells appear to express GFP, and that NPY immunoreactive cells were also GFP positive. Although we found no unexpected GFP expression in any brain region, we did not verify that all GFP cells in the CNS were NPY positive, and so further substantiation of the fidelity of GFP expression outside the hypothalamus will prove useful.

In summary, these data show a novel role for central bombesin-like peptides, with potent excitatory actions on the metabolic sensors of the brain including both NPY and POMC neurons in the arcuate nucleus. Furthermore, we provide a comprehensive map of NPY expression in the mouse brain, visualized by the powerful fluorescence of renilla GFP.

Acknowledgments

We thank Y.Yang, V.Rogulin, and J.N. Davis for technical assistance. RC is currently in the Department of Internal Medicine, Southwestern Medical Center, Dallas, TX. Supported by NIH NINDS NS34887, NS41454, NS48476, PO1 DK56116, and Swedish Research Council (529-2004-6698); European Neuroscience Institutions Network, NovoNordisk, Wenner Gren, Petrus and Augusta Hedlund, and Magnus Bergvall Foundations. LYF and KF contributed equally.

References

  • Acuna-Goycolea C, Tamamaki N, Yanagawa Y, Obata K, van den Pol AN. Mechanisms of neuropeptide Y, peptide YY, and pancreatic polypeptide inhibition of identified green fluorescent protein-expressing GABA neurons in the hypothalamic neuroendocrine arcuate nucleus. J Neurosci. 2005;25:7406–7419. [PubMed]
  • Acuna-Goycolea C, van den Pol AN. Peptide YY(3–36) inhibits both anorexigenic proopiomelanocortin and orexigenic neuropeptide Y neurons: implications for hypothalamic regulation of energy homeostasis. J Neurosci. 2005;25:10510–10519. [PubMed]
  • Acuna-Goycolea C, van den Pol AN. Neuroendocrine proopiomelanocortin neurons are excited by hypocretin/orexin. J Neurosci. 2009;29:1503–1515. [PMC free article] [PubMed]
  • Bai FL, Yamano M, Shiotani Y, Emson PC, Smith AD, Powell JF, Tohyama M. An arcuato-paraventricular and -dorsomedial hypothalamic neuropeptide Y-containing system which lacks noradrenaline in the rat. Brain Res. 1985;331:172–175. [PubMed]
  • Batterham RL, Cowley MA, Small CJ, Herzog H, Cohen MA, Dakin CL, Wren AM, Brynes AE, Low MJ, Ghatei MA, Cone RD, Bloom SR. Gut hormone PYY3–36 physiologically inhibits food intake. Nature. 2002;418:650–654. [PubMed]
  • Broberger C, De Lecea L, Sutcliffe JG, Hökfelt T. Hypocretin/orexin- and melanin concentrating hormone-expressing cells form distinct populations in the rodent lateral hypothalamus: relationship to the neuropeptide Y and agouti gene-related protein systems. J Comp Neurol. 1998;402:460–474. [PubMed]
  • Broberger C, Visser TJ, Kuhar MJ, Hökfelt T. Neuropeptide Y innervation and neuropeptide-Y-Y1-receptor-expressing neurons in the paraventricular hypothalamic nucleus of the mouse. Neuroendocrinology. 1999;70:295–305. [PubMed]
  • Brown M, Rivier J, Vale W. Bombesin affects the central nervous system to produce hyperglycemia in rats. Life Sci. 1978;21:1729–1734. [PubMed]
  • Chen G, van den Pol AN. Multiple NPY receptors coexist in pre- and postsynaptic sites: inhibition of GABA release in isolated self-innervating SCN neurons. J Neurosci. 1996;16:7711–7724. [PubMed]
  • Chronwall BM. Anatomy and physiology of the neuroendocrine arcuate nucleus. Peptides. 1985;6(Suppl 2):1–11. [PubMed]
  • Chronwall B, Pisano J, Bishop J, Moody T, O’Donohue TL. Biochemical and histochemical characterization of ranatensin immunoreactive peptides in rat brain: lack of coexistence with bombesin/GRP. Brain Res. 1983;338:97–113. [PubMed]
  • Coll AP, Farooqi IS, O’Rahilly S. The hormonal control of food intake. Cell. 2007;129:251–262. [PMC free article] [PubMed]
  • Colmers WF, Klapstein GJ, Fournier A, St-Pierre S, Treherne KA. Presynaptic inhibition by neuropeptide Y in rat hippocampal slice in vitro is mediated by a Y2 receptor. Br J Pharmacol. 1991;102:41–44. [PMC free article] [PubMed]
  • Colmers WF, Wahlestedt C, editors. The biology of neuropeptide Y and related peptides. Human Press; Totowa, NJ: 1993. pp. 1–564.
  • Cone RD. Studies on the physiological functions of the melanocortin system. Endocr Rev. 2006;27:736–749. [PubMed]
  • Cota D, Tschop MH, Horvath TL, Levine AS. Cannabinoids, opioids and eating behavior: the molecular face of hedonism? Brain Res Rev. 2006;51:85–107. [PubMed]
  • Cowley MA, Smart JL, Rubinstein M, Cerdan MG, Diano S, Horvath TL, Cone RD, Low MJ. Leptin activates anorexigenic POMC neurons through a neural network in the arcuate nucleus. Nature. 2001;411:480–484. [PubMed]
  • Cowley MA, Smith RG, Diano S, Tschop M, Pronchuk N, Grove KL, Strasburger CJ, Bidlingmaier M, Esterman M, Heiman ML, Garcia-Segura LM, Nillni EA, Mendez P, Low MJ, Sotonyi P, Friedman JM, Liu H, Pinto S, Colmers WF, Cone RD, Horvath TL. The distribution and mechanism of action of ghrelin in the CNS demonstrates a novel hypothalamic circuit regulating energy homeostasis. Neuron. 2003;37:649–661. [PubMed]
  • de Quidt ME, Emson PC. Distribution of neuropeptide Y-like immunoreactivity in the rat central nervous system--II. Immunohistochemical analysis. Neuroscience. 1986;18:545–618. [PubMed]
  • Elias CF, Aschkenasi C, Lee C, Kelly J, Ahima RS, Bjorbaek C, Flier JS, Saper CB, Elmquist JK. Leptin differentially regulates NPY and POMC neurons projecting to the lateral hypothalamic area. Neuron. 1999;23:775–786. [PubMed]
  • Elias CF, Lee C, Kelly J, Aschkenasi C, Ahima RS, Couceyro PR, Kuhar MJ, Saper CB, Elmquist JK. Leptin activates hypothalamic CART neurons projecting to the spinal cord. Neuron. 1998;21:1375–1385. [PubMed]
  • Elmquist JK, Elias CF, Saper CB. From lesions to leptin: hypothalamic control of food intake and body weight. Neuron. 1999;22:221–232. [PubMed]
  • Flynn FW. Fourth ventricle bombesin injection suppresses ingestive behaviors in rats. Am J Physiol. 1998;256:R590–R596. [PubMed]
  • Flynn FW. Fourth ventricular injection of selective bombesin receptor antagonists facilitates feeding in rats. Am J Physiol. 1993;264:R218–R221. [PubMed]
  • Fu LY, Acuna-Goycolea C, van den Pol AN. Neuropeptide Y inhibits hypocretin/orexin neurons by multiple presynaptic and postsynaptic mechanisms: tonic depression of the hypothalamic arousal system. J Neurosci. 2004;24:8741–8751. [PubMed]
  • Fu LY, van den Pol AN. GABA excitation in mouse hilar neuropeptide Y neurons. J Physiol. 2007;579:445–464. [PubMed]
  • Gao XB, van den Pol AN. Melanin concentrating hormone depresses synaptic activity of glutamate and GABA neurons from rat lateral hypothalamus. J Physiol. 2001;533(Pt 1):237–52. [PubMed]
  • Gehlert DR, Chronwall BM, Schafer MP, O’Donohue TL. Localization of neuropeptide Y messenger ribonucleic acid in rat and mouse brain by in situ hybridization. Synapse. 1987;1:25–31. [PubMed]
  • Gibbs J, Fauser DJ, Rowe EA, Rolls BJ, Rolls ET, Maddison SP. Bombesin suppresses feeding in rats. Nature. 1979;282:208–210. [PubMed]
  • Gonzalez N, Moody TW, Igarashi H, Ito T, Jensen RT. Bombesin-related peptides and their receptors: recent advances in their role in physiology and disease states. Curr Opin Endocrinol Diabetes Obes. 2008;15:58–64. [PMC free article] [PubMed]
  • Grove KL, Chen P, Koegler FH, Schiffmaker A, Susan Smith M, Cameron JL. Fasting activates neuropeptide Y neurons in the arcuate nucleus and the paraventricular nucleus in the rhesus macaque. Mol Brain Res. 2003;113:133–138. [PubMed]
  • Gutzwiller JP, Drewe J, Hildebrand P, Lauper JZ, Beglinger C. Effect of intravenous human gastrin-releasing peptide on food intake in humans. Gastroenterology. 1994;106:1168–1173. [PubMed]
  • Hablitz JJ, Heinemann U, Lux H-D. Step reductions in extracellular Ca2+ activate a transient inward current in chick dorsal root ganglion cells. Biophysical Journal. 1986;50:753–757. [PubMed]
  • Hahn TM, Breininger JF, Baskin DG, Schwartz MW. Coexpression of Agrp and NPY in fasting-activated hypothalamic neurons. Nat Neurosci. 1998;1:271–272. [PubMed]
  • Halaszovich CR, Zitt C, Jungling E, Luckhoff A. Inhibition of TRP3 channels by lanthanides. Block from the cytosolic side of the plasma membrane. J Biol Chem. 2000;275:37423–37428. [PubMed]
  • Heisler LK, Cowley MA, Tecott LH, Fan W, Low MJ, Smart JL, Rubinstein M, Tatro JB, Marcus JN, Holstege H, Lee CE, Cone RD, Elmquist JK. Activation of central melanocortin pathways by fenfluramine. Science. 2002;297:609–611. [PubMed]
  • Heisler LK, Jobst EE, Sutton GM, Zhou L, Borok E, Thornton-Jones Z, Liu HY, Zigman JM, Balthasar N, Kishi T, Lee CE, Aschkenasi CJ, Zhang CY, Yu J, Boss O, Mountjoy KG, Clifton PG, Lowell BB, Friedman JM, Horvath T, Butler AA, Elmquist JK, Cowley MA. Serotonin reciprocally regulates melanocortin neurons to modulate food intake. Neuron. 2006;51:239–249. [PubMed]
  • Hentges ST, Low MJ, Williams JT. Differential regulation of synaptic inputs by constitutively released endocannabinoids and exogenous cannabinoids. J Neurosci. 2005;25:9746–9751. [PubMed]
  • Hogan, et al. Manipulating the mouse embryo. Cold spring Harbor Laboratory; 1986. Introduction of new genetic information into the developing mouse embryo; pp. 153–197.
  • Jensen RT, Battey JF, Spindel ER, Benya RV. International union of pharmacology. LXVIII Mammalian bombesin receptors: nomenclature, distribution, pharmacology, signaling, and functions in normal and disease states. Pharmacol Rev. 2008;60:1–42. [PMC free article] [PubMed]
  • Jobst EE, Enriori PJ, Cowley MA. The electrophysiology of feeding circuits. Trends Endocrinol Metab. 2004;15:488–499. [PubMed]
  • Kamichi S, Wada E, Aoki S, Sekiguchi M, Kimura I, Wada K. Immunohistochemical localization of gastrin-releasing peptide receptor in the mouse brain. Brain Research. 2005;1032:162–170. [PubMed]
  • Kang L, Routh VH, Kuzhikandathil EV, Gaspers LD, Levin BE. Physiological and molecular characteristics of rat hypothalamic ventromedial nucleus glucosensing neurons. Diabetes. 2004;53:549–559. [PubMed]
  • Kim MS, Pak YK, Jang PG, Namkoong C, Choi YS, Won JC, Kim KS, Kim SW, Kim HS, Park JY, Kim YB, Lee KU. Role of hypothalamic Foxo1 in the regulation of food intake and energy homeostasis. Nat Neurosci. 2006;9:901–906. [PubMed]
  • Kopp J, Xu ZQ, Zhang X, Pedrazzini T, Herzog H, Kresse A, Wong H, Walsh JH, Hökfelt T. Expression of the neuropeptide Y Y1 receptor in the CNS of rat and of wild-type and Y1 receptor knock-out mice. Focus on immunohistochemical localization. Neuroscience. 2002;111:443–532. [PubMed]
  • Kumarnsit E, Johnstone LE, Leng G. Actions of neuropeptide Y and growth hormone secretagogues in the arcuate nucleus and ventromedial hypothalamic nucleus. Eur J Neurosci. 2003;17:937–944. [PubMed]
  • Ladenheim EE, Taylor JE, Coy DH, Moran TH. Blockade of feeding inhibition by neuromedin B using a selective receptor antagonist. Eur J Pharmacol. 1994;271:R7–R9. [PubMed]
  • Ladenheim EE, Taylor JE, Coy DH, Carrigan TS, Wohn A, Moran TH. Caudal hindbrain neuromedin B-preferring receptors participate in the control of food intake. Am J Physiol. 1997;272:R433–R37. [PubMed]
  • Ladenheim EE, Knipp S. Capsaicin treatment differentially affects feeding suppression by bombesin-like peptides. Physiol Behav. 2007;91:36–41. [PMC free article] [PubMed]
  • Lee EC, Yu D, Martinez de Velasco J, Tessarollo L, Swing DA, Court DL, Jenkins NA, Copeland NG. A highly efficient Escherichia coli-based chromosome engineering system adapted for recombinogenic targeting and subcloning of BAC DNA. Genomics. 2001;73:56–65. [PubMed]
  • Lin JY, Pan JT. Stimulatory effects of bombesin-like peptides on hypothalamic arcuate neurons in rat brain slices. Brain Res Bull. 1994;35:241–246. [PubMed]
  • Liu RJ, van den Pol AN, Aghajanian GK. Hypocretins (orexins) regulate serotonin neurons in the dorsal raphe nucleus by excitatory direct and inhibitory indirect actions. J Neurosci. 2002;22:9453–9464. [PubMed]
  • Ma X, Zubcevic L, Bruning JC, Ashcroft FM, Burdakov D. Electrical inhibition of identified anorexigenic POMC neurons by orexin/hypocretin. J Neurosci. 2007;27:1529–1533. [PubMed]
  • McDonald JK, Koenig JI. Neuropeptide Y actions on reproductive and endocrine functions. In: Colmers WF, Wahlestedt C, editors. The biology of Neuropeptide Y and related peptides. Totowa NJ: Humana; 1993. pp. 419–456.
  • Merali Z, Moody TW, Coy D. Blockade of brain bombesin/GRP receptors increases food intake in satiated rats. Am J Physiol. 1993;264:R1031–R1034. [PubMed]
  • Mikkelsen JD, Larsen PJ, O’Hare MM, Wiegand SJ. Gastrin releasing peptide in the rat suprachiasmatic nucleus: an immunohistochemical, chromatographic and radioimmunological study. Neuroscience. 1991;40:55–66. [PubMed]
  • Moody TW, Merali Z. Bombesin-like peptides and associated receptors within the brain: distribution and behavioral implications. Peptides. 2004;25:511–520. [PubMed]
  • Muurahainen NE, Kissileff HR, Pi-Sunyer FX. Intravenous infusion of bombesin reduces food intake in humans. Am J Physiol. 1993;264:R350–R354. [PubMed]
  • Myojin T, Kitamura N, Hondo E, Baltazar ET, Pearson GT, Yamada J. Immunohistochemical localization of neuropeptides in bovine pancreas. Anat Histol Embryol. 2000;29:167–72. [PubMed]
  • Ohki-Hamazaki H, Watase K, Yamamoto K, Ogura H, Yamano M, Yamada K, Maeno H, Imaki J, Kikuyama S, Wada E, Wada K. Mice lacking bombesin receptor subtype-3 develop metabolic defects and obesity. Nature. 1997;390:165–169. [PubMed]
  • Panula P, Yang HY, Costa E. Neuronal location of the bombesin-like immunoreactivity in the central nervous system of the rat. Regul Pept. 1982;4:275–283. [PubMed]
  • Paxinos G, Franklin KB. The mouse brain in stereotaxic coordinates. Elsevier Press; Amsterdam: 2001.
  • Pinto S, Roseberry AG, Liu H, Diano S, Shanabrough M, Cai X, Friedman JM, Horvath TL. Rapid rewiring of arcuate nucleus feeding circuits by leptin. Science. 2004;304:110–115. [PubMed]
  • Rhim H, Kinney GA, Emmerson PJ, Miller RJ. Regulation of neurotransmission in the arcute nucleus of the rat by different neuropeptide Y receptors. J Neurosci. 1997;17:2980–2989. [PubMed]
  • Roseberry AG, Liu H, Jackson AC, Cai X, Friedman JM. Neuropeptide Y-mediated inhibition of proopiomelanocortin neurons in the arcuate nucleus shows enhanced desensitization in ob/ob mice. Neuron. 2004;41:711–722. [PubMed]
  • Saper CB, Chou TC, Elmquist JK. The need to feed: homeostatic and hedonic control of eating. Neuron. 2002;36:199–211. [PubMed]
  • Saper CB, Loewy AD, Swanson LW, Cowan WM. Direct hypothalamo-autonomic connections. Brain Res. 1976;117:305–312. [PubMed]
  • Schwartz MW, Woods SC, Porte D, Jr, Seeley RJ, Baskin DG. Central nervous system control of food intake. Nature. 2000;404:661–671. [PubMed]
  • Seeley RJ, Woods SC. Monitoring of stored and available fuel by the CNS: implications for obesity. Nat Rev Neurosci. 2003;4:901–909. [PubMed]
  • Sekizawa SI, Bonham AC. Group I metabotropic glutamate receptors on second-order baroreceptor neurons are tonically activated and induce a Na+-Ca2+ exchange current. J Neurophysiol. 2006;95:882–892. [PubMed]
  • Stanley BG, Leibowitz SF. NPY injected in the paraventricular hypothalamus: a powerful stimulant of feeding behavior. Proc Natl Acad Sci U S A. 1985;82:3940–3943. [PubMed]
  • Swanson LW, Kuypers HG. A direct projection from the ventromedial nucleus and retrochiasmatic area of the hypothalamus to the medulla and spinal cord of the rat. Neurosci Lett. 1980;17:307–312. [PubMed]
  • Tsushima H, Mori M. Mechanisms underlying anorexia after microinjection of bombesin into the lateral cerebroventricle. Pharmacol Biochem Behav. 2005;80:289–296. [PubMed]
  • Ubink R, Halasz N, Zhang X, Dagerlind A, Hökfelt T. Neuropeptide tyrosine is expressed in ensheathing cells around the olfactory nerves in the rat olfactory bulb. Neuroscience. 1994;60:709–726. [PubMed]
  • Ubink R, Hökfelt T. Expression of neuropeptide Y in olfactory ensheathing cells during prenatal development. J Comp Neurol. 2000;423:13–22. [PubMed]
  • van den Pol AN, Acuna-Goycolea C, Clark KR, Ghosh PK. Physiological properties of hypothalamic MCH neurons identified with selective expression of reporter gene after recombinant virus infection. Neuron. 2004;42:635–652. [PubMed]
  • van den Pol AN, Obrietan K, Chen G, Belousov AB. Neuropeptide Y-mediated long-term depression of excitatory activity in suprachiasmatic nucleus neurons. J Neurosci. 1996;16:5883–5895. [PubMed]
  • van den Top M, Lee K, Whyment AD, Blanks AM, Spanswick D. Orexigen-sensitive NPY/AgRP pacemaker neurons in the hypothalamic arcuate nucleus. Nat Neurosci. 2004;7:493–494. [PubMed]
  • Wada E, Way J, Lebacq-Verheyden AM, Battey JF. Neuromedin B and gastrin-releasing peptide mRNAs are differentially distributed in the rat nervous system. J Neurosci. 1990;10:2917–2930. [PubMed]
  • Wada E, Way J, Shapira H, Kusano K, Lebacq-Verheyden AM, Coy D, Jensen R, Battery J. cDNA cloning, characterization and brain region-specific expression of a neuromedin-B-preferring bombesin receptor. Neuron. 1991;6:421–430. [PubMed]
  • Wada E, Wray S, Key S, Battey J. Comparison of gene expression for two distinct bombesin receptor subtypes in postnatal rat central nervous system. Mol Cell Neurosci. 1992;3:446–460. [PubMed]
  • Wu M, Zaborszky L, Hajszan T, van den Pol AN, Alreja M. Hypocretin/orexin innervation and excitation of identified septohippocampal cholinergic neurons. J Neurosci. 2004;24:3527–3536. [PubMed]
  • Xiong Z-G, Lu W-Y, MacDonald JF. Extracellular calcium sensed by a novel cation channel in hippocampal neurons. PNAS. 1997;94:7012–7017. [PubMed]
  • Zarbin M, Kuhar MJ, O’Donohue TL, Wolf SS, Moody TW. Autoradiographic localization of (125I-Tyr4)bombesin binding sites in rat brain. J Neurosci. 1985;5:429–437. [PubMed]
  • Zhang C, Bosch MA, Levine JE, Ronnekleiv OK, Kelly MJ. Gonadotropin-releasing hormone neurons express K(ATP) channels that are regulated by estrogen and responsive to glucose and metabolic inhibition. J Neurosci. 2007;27:10153–64. [PubMed]