PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Cancer Res. Author manuscript; available in PMC 2010 June 15.
Published in final edited form as:
PMCID: PMC2744327
NIHMSID: NIHMS123568

ROC1/RBX1 E3 ubiquitin ligase silencing suppresses tumor cell growth via sequential induction of G2/M arrest, apoptosis, and senescence

Abstract

ROC1 (Regulator of Cullins-1) or RBX1 (Ring Box Protein-1) is a RING component of SCF (Skp-1, cullins, F-box proteins) E3 ubiquitin ligases, which regulate diverse cellular processes by targeting a variety of substrates for degradation. However, little is known about the role of ROC1 in human cancer. Here we reported that ROC1 is ubiquitously over-expressed in primary human tumor tissues and human cancer cell lines. ROC1 silencing by siRNA significantly inhibited the growth of multiple human cancer cells via induction of senescence and apoptosis as well as G2/M arrest. Senescence induction is coupled with DNA damage in p53/p21 and p16/pRB-independent manners. Apoptosis is associated with accumulation of Puma and reduction of Bcl-2, Mcl-1, and survivin; and G2/M arrest is associated with accumulation of 14-3-3σ and elimination of cyclin B1 and Cdc2. In U87 glioblastoma cells, these phenotypic changes occur sequentially upon ROC1 silencing, starting with G2/M arrest, followed by apoptosis and senescence. Thus, ROC1 silencing triggers multiple death and growth arrest pathways to effectively suppress tumor cell growth, suggesting that ROC1 may serve as a potential anti-cancer target.

Keywords: ROC1/RBX1, SCF ubiquitin ligases, siRNA silencing, Senescence, Apoptosis, G2/M arrest

Introduction

The SCF E3 ubiquitin ligases, consisting of Skp1, Cullins/Cdc53, F-box proteins, and the RING domain containing protein ROC1/RBX1 (15), are crucial to the regulation of numerous cellular processes under both physiological and pathological conditions as part of the ubiquitin-proteosome system. These E3 ubiquitin ligases promote degradation of diverse substrates, including cell cycle regulatory proteins, transcription factors and signal transducers. Importantly, SCF dysfunction can cause a variety of diseases including cancer (6, 7). For example, the oncogenic F-box protein Skp2 is overexpressed in human tumors, and promotes p27 degradation, contributing to malignant progression (8), whereas the tumor suppressor F-box protein FBW7, which degrades several proto-oncogenes (such as MYC, Notch, JUN and Cyclin E), undergoes numerous cancer-associated mutations, and loss of FBW7 function causes chromosomal instability and tumorigenesis (9).

The core of SCF ubiquitin ligases is a complex of ROC1-cullins (7). ROC1 contains a RING-H2 finger domain (Cys42 -X2- Cys45-X29- Cys75-X1- His77 -X2 - His80 -X2 -Cys83 -X10 - Cys94 -X2 - Asp97 in human), required for zinc ion binding and ubiquitin ligation (2, 10). Crystal structure studies revealed that ROC1 complexes with cullin-F-box proteins which recognize a variety of protein substrates and transfers ubiquitin from E2 to substrates for proteasome-targeted degradation (11). In yeast, ROC1 is required for ubiquitination of the cyclin-dependent kinase inhibitor Sic1 during the G1 to S cell cycle transition (5). ROC1 deletion causes yeast death, which can be rescued by human ROC1 or its family member, ROC2/SAG (2, 5, 12). In Caenorhabditis elegans, ROC1 is essential for cell cycle progression and chromosome metabolism. Depletion of ROC1 by siRNA causes pronounced defects in meiosis, mitotic chromosomal condensation and segregation, and cytokinesis (13). In Drosophila, ROC1a is required for cell proliferation and embryo development. Deletion of ROC1a results in animal death, which cannot be rescued by overexpression of ROC1b, indicating a non-redundant function between the family members (14). We recently reported that ROC1 disruption in mouse causes early embryonic lethality at E7.5 due to proliferation failure as a result of p27 accumulation, which can be partially rescued by simultaneous loss of p27 (15). Furthermore, a shRNA library-based functional genomic screen identified ROC1 as a growth essential gene in a number of human cell lines, although no further mechanistic characterization was performed (16).

In light of these studies showing the importance of ROC1 to cell growth and the known dysfunction of the SCF E3 ubiquitin ligases in a variety of cancers, we hypothesized that ROC1 overexpression is required for proliferation and survival of human cancer cells. We report here that ROC1 is indeed overexpressed in a number of solid human primary tumor tissues and many human cancer cell lines and that ROC1 siRNA silencing remarkably suppressed tumor cell growth via sequential induction of G2/M arrest, apoptosis and senescence, suggesting that ROC1 could serve as a potential anti-cancer target.

Materials and methods

Cell culture

All the cancer cell lines used were from ATCC and cultured in DMEM media containing 10% serum.

Immunohistochemistry (IHC) staining of human tumor tissue array

Human tumor tissue arrays were provided and IHC stained with affinity purified ROC1 specific antibody made against C-terminal peptide of human ROC1 (15) by the University of Michigan Tissue Core, using the DakoCytomation EnVision+ System-HRP (DAB) detection kit.

Lentivirus-based siRNA and lentivirus infection

Lentivirus-based siRNA against ROC1 (LT-ROC1) and p53 (LT-p53) as well as LT-virus expressing scrambled control siRNA (LT-CONT) were constructed as described previously (1719). The target sequences are as follows: LT-ROC1-01: 5’-AACAGTGCCATCTGCAGGAACCACATTTCAAGAGAATG TGGTTCCTGCAGATGGCACAGTTTTTTGT-3’; LT-ROC1–02: 5’-CTAGACAAAAAA C TGTGCCATCTGCAGGAACCACATTCTCTTGAAATGTGGTTCCTGCAGATGGCAC AGTT-3’; LT-p53-01: 5’- GACTCCAGTGGTAATCTACTTTCAAGAGAAGTAGATTAC CACTGGAGTCTTTTTTGT-3’ and LT-p53-02: 5’-CTAGACAAAAAAGACTCCAGTGG TAATCTACTTCTCTTGAAA GTAGATTACCACTGGAGTC-3’; LT-CONT-01: 5’-ATTGTATGCGATCGCAGACTTTTCAAGAGAAAGTCTGCGATCGCATACAATTTTT TGT-3’; and LT-CONT-02: 5’-CTAGACAAAAAATTGTATGCGATCGCAGACTTTCTC TTGAAAAGTCTGCGATCGCATACAAT-3’. A siRNA oliognucleotide specifically targeting ROC1 (siROC1: 5’-GACTTTCCCTGCTGTTACCTAA-3’) (16), along with scrambled control siRNA (siCONT: 5’-ATTGTATGCGATCGCAGACTT-3’), were ordered from Dharmacon (USA). A panel of human cancer cell lines was infected with LT-ROC1 or LT-CONT for 72 hrs, then split for assays as described below. For U87 cells, cells were infected either for 72 hrs and split for ATPlite cell proliferation assay and clonogenic survival assay, or for 120 hrs and subject to SA-β -galactosidase staining, FACS analysis, and immunoblotting analysis.

ATPlite cell proliferation assay and clonogenic survival assay

Cells, infected with LT-ROC1 or LT-CONT, or transfected with siROC1 or siCONT, were split and seeded into 96-well plates with 3000 cells per well in quadruplicate for ATPlite cell proliferation assay at various time points, or seeded into 6-well plates with 100 cells per well in triplicate, followed by incubation for 9 days. The colonies formed were fixed, stained and counted (19).

Soft agar assay

Ten thousand cells after infection with LT-CONT or LT-ROC1 were seeded in 0.33% agar containing 1× cell culture medium and 10% FBS in 60-mm petri dish, and grown at 37°C for 14 days. The cells were stained with p-iodonitrotetrazolium (1 mg/mL; Sigma) overnight and the colonies were counted (17).

FACS analysis

Cells were harvested and fixed in 70% EtOH at −20ºC for 4 hours, stained with propidium iodide (18µg/ml) containing 400µg/mL RNaseA (Roche) with shaking for 1 hour, and analyzed by flow cytometry for apoptosis and cell cycle profile (19). Apoptosis was measured by the percentage of cells in sub-G1 population.

SA-β -Galactosidase Staining

The expression of senescence-associated β–galactosidase (SA–β–gal) in cells was determined by SA–β–gal staining (20).

Immunoblotting (IB) analysis

Cell lysates were prepared and subjected to IB analysis using antibodies against ROC1 (15), Bax, Bad, caspase 3, caspase 7, caspase 8, cyclin B1, cIAP1, cIAP2 (Cell signaling), p16, cdc25c, Cdt 1, cyclin D1, cyclin E1, pRB, Puma, PARP, Mcl-1, 14-3-3σ, Cdc2, p53, IκB, c-Jun (Santa Cruz), XIAP, Bcl-XL, p21, p27, Cdc25b (BD Transduction Laboratories), caspase 9 (Novocastra), β-actin (Sigma), Bak (Upstate), Bim (Imgenex), Noxa (Oncogene Science), Apaf-1 (Trevigen), Bcl-2 (Dako), survivin (Novus biologicals) and phosphor-γH2A (Ser 139) (Millipore).

Phorspho-γH2AX immunofluorescent staining

U87 cells were infected with LT-ROC1 or LT-CONT for 120 hrs with DMSO or 25 µM etoposide added at last 12 hrs. Cells were fixed with 10% formalin and blocked with 3% horse serum and incubated with anti-phorspho-γH2AX moloclonal antibody at 1:100, followed by incubation with Rhodamine Red-labeled anti-mouse IgG at 1:250. Cellular nuclear were stained with DAPI. The stained cells were observed under fluorescent microscope.

Statistical analysis

The statistical significance of differences between groups was assessed using GraphPad Prism4 software (version 4.03). The unpaired, two-tailed t-test was used for the comparison of parameters between groups. The level of significance was set at P < 0.05.

Results

ROC1 was overexpressed in diverse primary human tumor tissues and cell lines

ROC1 expression in human tissues was determined by immunohistochemistry (IHC) staining of human tumor tissue arrays. As shown in Fig 1A, left panels, ROC1 was expressed weakly in normal tissues, including lung, liver and breast, but was over-expressed in carcinomas of lung, liver, breast (Figure 1A, right panels), as well as carcinomas of colon and ovary (data not shown). Over-expressed ROC1 was detected only in tumor mass, not in adjacent stroma tissues. To determine the frequency of cancer tissues with ROC1 overexpression, IHC staining of a human lung cancer tissue array, consisting of 17 normal tissues and 38 tumor tissues of adenocarcinoma (N=19) and squamous carcinoma (N=19) was performed. Based upon staining intensity, we classified the samples into 5 groups with increasing staining intensity from the weakest (±) to the strongest (++++) (Figure 1B). As summarized in Figure 1C, ROC1 staining in normal tissues was very weak with 77% samples in group 1 and the remaining 23% in group 2. In contrast, ROC1 staining was very high in lung tumor tissues. For adenocarcinoma, only 5% samples were in group 1, 21% in group 2, and the remaining 74% in groups 3–5. More strikingly, only 5% of squamous carcinomas were in groups 1 and 2 and the remaining 95% in groups 3–5. Thus, ROC1 was overexpressed with a high frequency in lung cancer tissues. Furthermore, we found by immunoblotting analysis that ROC1 was highly expressed in many human cancer cell lines tested. The list included lung cancer lines (H1299, A549, H460, H1355), breast cancer lines (MDA-MB-461, MDA-MB-231), colon cancer lines (HCT116, DLD1), cervical carcinoma line (HeLa), pancreas cancer line (Panc-1) and glioblastoma lines (U87, U251) (see below and data not shown). The ubiquitous expression of ROC1 at the high levels in diverse primary human tumors and multiple cancer cell lines suggests that ROC1 could play an essential role in tumor cell proliferation and survival.

Figure 1Figure 1
The expression of ROC1 in human tumors and normal counterparts

ROC1 silencing inhibited the growth of human cancer cells

To determine the role of ROC1 in regulation of cancer cell proliferation and survival, ROC1 expression was knocked down by lentivirus-based siRNA targeting ROC1 (LT-ROC1), which co-expresses the GFP. At 72 hrs post infection, GFP expression was clearly observed in about 95% cells infected with either LT-ROC1 or scrambled control siRNA, LT-CONT (data not shown). Compared to LT-CONT, LT-ROC1 infection significantly reduced ROC1 expression in U87 and H1299 cells (Fig 2A&B, top).

Figure 2
ROC1 silencing inhibited the growth of human cancer cells

As shown in Figure 2A&B (middle), ROC1 silencing remarkably reduced the growth of U87 and H1299 cells as measured by ATPlite proliferation assay and by cell counting analysis (not shown). Clonogenic survival assay also showed a 5- to 10-fold reduction of colony numbers in LT-ROC1-infected cells (Fig 2A&B, bottom). Furthermore, the ability of H1299 cells to grow on soft agar was remarkably inhibited up to 4-fold upon ROC1 silencing (Fig 2C). In addition, ROC1 silencing remarkably inhibited the growth of other human cancer cell lines, including HCT116 , PANC-1, and HeLa cells as measured by clonogenic analysis (not shown). These results demonstrated that ROC1 silencing had a broad inhibitory effect on proliferation and survival of human cancer cells.

ROC1 silencing induced cell senescence in p53/p21 and p16/pRB-independent manner

We next investigated the nature of growth suppression induced by ROC1 silencing. Morphological observation revealed that LT-ROC-infected U87 cells were larger in size with flattened shape (Fig 3A, top left), a feature of senescence (21). To address whether ROC1 silencing indeed induced cell senescence, the expression of senescence-associated β–galactosidase (SA–β–gal), a classic biochemical marker of senescence (20), was determined by SA–β–gal staining. Indeed, about 25% of LT-ROC-infected cells, but less than 2% of the control cells, were positively stained with SA–β–gal (Figure 3, bottom left).

Figure 3
ROC1 silencing induced cell senescence in p53/p21- and p16/pRB-independent manner

p53/p21 axis is a major senescence-triggering pathway (22). We first evaluated the effects of p53/p21 on ROC1 silencing-induced cell senescence in U87 cells harboring a wild type p53 (23). As shown in Figure 3A (top right), ROC1 silencing induced neither p53 nor p21. Furthermore, in p53 silenced (via LT-p53) U87 cells (Fig. 3A, bottom right), ROC1 silencing still induced senescence as determined by both cellular morphological observation (Fig 3B, top) and SA–β–gal staining (Fig 3B, bottom), suggesting ROC1 silencing induced cell senescence is p53/p21-independent.

To further confirm this, we used H1299 lung cancer cells, a p53-null line (24). Absence of p53 and p21 expression in this cell line was first confirmed by immunobloting (Fig S1A). However, LT-ROC1-infection still caused H1299 cells to display a senescent morphology with enlarged size and flatten shape (Fig S1 C). Moreover, about 17% of LT-ROC1-infected cells, but only 0.3% of control cells, were positively stained with SA–β–gal (Fig S1 D). We finally confirmed the p53/p21-independency by using H1299-p53ts cells, which express a temperature sensitive mutant p53. The p53 adapts a wild type conformation when cells were grown at 32°C, but a mutant p53 conformation when cultured at 37°C (24). As shown in Fig S1 B, p21, a p53 target protein, could be detected in H1299-p53ts cells cultured at 32°C, but not at 37°C. Consistently, ROC1 silencing was still able to induce senescence in cells cultured at 37°C (Fig S1 E). Taken together, these results strongly indicate that ROC1 silencing-induced senescence is independent of p53/p21.

p16/pRB axis is another major senescence-inducing pathway (22). Since p16 was expressed in neither U87 (25) (Fig 3C, top) nor H1299 cells (26) (not shown), we focused our study on the effects of pRB on ROC1 silencing-induced senescence. Previous study has shown that pRB is subject to degradation by SCF E3 ligase in the presence of E7 oncoprotein or EB virus latent antigen 3C (27, 28). Upon ROC1 silencing, we did not detect pRB accumulation in both U87 cells (Fig 3C, top) and H1299 cells (not shown), suggesting ROC1 is not involved in pRB degradation in these lines. Furthermore, in pRB-inactivated HeLa cells (29) and pRB-null MDA-MB-468 cells (30) (Fig 3C, bottom), ROC1 silencing was still able to induce senescence effectively (Fig 3D). Taken together, these findings demonstrated that cell senescence induced by ROC1 silencing is independent of p16 and pRB as well.

ROC1 silencing induced apoptosis

Our morphological observation also revealed that ~30% of ROC1 silenced U87 and H1299 cells were shrunk in shape and detached from the culture dishes, a reminiscence of apoptosis (not shown). We confirmed this by FACS analysis in which the sub-G1 population is indicative of apoptotic cells. As shown in Figure 4A, 30–40% of LT-ROC1-infected cells underwent apoptosis, compared to 5–10% of LT-CONT-infected cells. Apoptosis induced by ROC1 silencing was further confirmed by the activation of caspases, as demonstration by a) the decrease in pro-caspase forms (casapses 3, 7, 8, and 9), b) the appearance of cleaved active form (caspases 3 and 7), and c) PARP cleavage (Fig 4B, left). Thus, ROC1 silencing also induces apoptosis.

Figure 4
ROC1 silencing induced apoptosis and G2/M arrest in U87 cells

To understand the mechanism by which ROC1 silencing induced apoptosis, we analyzed the expression in U87 cells of pro-apoptotic proteins (Bax, Bak, Puma, Bim, Bad and Bid) and anti-apoptotic proteins (Bcl-2, Mcl-1, survivin, XIAP, Bcl-XL, cIAP1 and cIAP2). Among the pro-apoptotic proteins, Puma was moderately up-regulated, coupled with Bid cleavage, an indicator of apoptosis induction (Fig 4B, right). Among anti-apoptotic proteins, the levels of Bcl-2, Mcl-1 and survivin were significantly reduced, while others were unchanged (Fig 4B, right panel). The results suggested that ROC1 silencing could induce apoptosis by upregulation of some pro-apoptotic proteins (e.g. Puma) and downregulation of anti-apoptotic proteins (e.g. Bcl-2, Mcl-1 and survivin).

ROC1 silencing induced a G2/M arrest

Our FACS analysis also revealed that among the remaining cell populations, not undergoing apoptosis, about 50–60% of LT-ROC1-infected U87 cells were arrested in the G2/M phase of the cell cycle, compared to about 15–20% of control cells at 120 hrs post infection (Fig 4C). Interestingly, ROC1 silencing-induced G2/M arrest was not observed in other tested cell lines including H1299, HeLa and HCT116 (not shown), suggesting that this effect is rather cell-line dependent.

To pursue potential mechanisms, we analyzed the expression of a panel of cell cycle regulatory proteins, including several known substrates of ROC1-SCF E3 ubiquitin ligases, including cyclin D1, cyclin E1, p21, p27, c-Jun, Cdt-1, and IκB (6, 7, 31). As shown in Fig 4D, ROC1 silencing had no effect on expression of Cdc25b, Cdc25c, cyclin D1, cyclin E1, c-Jun, Cdt-1 and IκB while p21 and p27 were undetectable, indicating that the degradation of some of these substrates is likely cell-line dependent. Significantly, ROC1 silencing caused the accumulation of 14-3-3σ, a negative regulator of G2/M progression (32), and the depletion of Cdc2 and cyclin B1, which form a complex to promote the G2 to M progression (33). Thus, accumulation of 14-3-3σ and elimination of Cdc2/cyclin B1 could be responsible for observed G2/M growth arrest.

Sequential induction of G2/M arrest, apoptosis and senescence in U87 cells

We next addressed an obvious question as to how ROC1 silencing induces senescence, apoptosis and G2/M arrest among U87 cells in the same culture dish. Since above results were obtained at one time point, 120 hrs post infection with LT-ROC1, we wonder whether the changes actually occur in a sequential order. To test this, we collected cell samples at 72, 96, or 120 hrs post LT-ROC1 infection, along with LT-CONT control cells, and performed FACS analysis for apoptosis (sub-G1 population) and G2/M arrest, SA-β-gal staining for senescence, and immunoblotting to correlate the phenotypic changes with the degree of ROC1 silencing. As shown in Figure 5A&B, the G2/M arrest occurred early with a 3.5-fold increase over the control cells at 72 hrs post infection, where 20% of ROC1 was silenced (Fig. 5C). Induction of apoptosis started to occur with a 3-fold increase over the control cells at 96 hrs post infection (Fig 5A&B), where 50% of ROC1 was silenced (Fig. 5C). The senescence also occurred at 96 hrs with a 7-fold increase over the control cells (Fig. 5B), but within a minimal cell population (5.8% vs. 0.8%) (Fig. 5A). The level of senescence was remarkably increased, reaching a 20-fold over the control cells among 26% of cell population at 120 hrs post infection (Fig. 5A&B), where 90% of ROC1 was silenced (Fig. 5C). The percentage of cells arrested at the G2/M (60%) or undergoing apoptosis (30%) was also reaching the peak at 120 hrs, but the fold increase over the control cells remained the same at 2.5 to 3.5-fold higher level, since cell populations at the G2/M or sub-G1 phase in control cells were also increased after prolonged virus infection (Fig. 5A&B). The findings suggested that ROC1 silencing-induced phenotypic changes occur sequentially with initial induction of G2/M arrest, followed by apoptosis and senescence in U87 cells.

Figure 5
ROC1 silencing sequentially induced G2/M arrest, apoptosis and senescence

ROC1 siRNA oligonucleotide (siROC1) inhibited cancer cell growth by inducing apoptosis, G2/M arrest, and senescence

To exclude the possibility of off-target effects, we repeated all the experiments using a ROC1 specific siRNA oligonucleotide reported by others (17). As shown in Fig S2A, siROC1 oligonucleotide significantly down-regulated ROC1 expression in both U87 and H1299 cells. Like LT-ROC1, siROC1-mediated ROC1 silencing significantly inhibited cell proliferation in both cancer lines (Fig S2B), induced apoptosis in 40% of ROC1-silenced U87 cells compared to 10% of control cells (Fig S2C), caused G2/M arrest in 45% of ROC1-silenced U87 cells compared to 9% of control cells (Fig S2D), and induced the senescence in about 30% of ROC1-silenced U87 cells (Fig S2E). Taken together, these results clearly demonstrated that observed biological consequences are specific for ROC1 silencing, excluding the possibility of off-target effects.

ROC1 silencing induced DNA damage

Stress-induced DNA damage plays an essential role in induction of G2/M arrest, apoptosis (3436), as well as senescence (3740). We, therefore, determined if ROC1 silencing could induce DNA damage in U87 cells by immunofluorescent staining of phosphor-γH2AX (Ser 139) as an index of DNA damage. Etoposide was included as the positive control. As shown in Figure 6A, positive phosphor-γH2AX staining was apparently observed in ROC1-silenced cells with a similar intensity to that from etoposide-treated cells (top panel). In images at higher magnification, numerous phosphor-γH2AX positive foci could be clearly observed in both ROC1-silenced and etoposide-treated cells (second panel). Strikingly, the phosphor-γH2AX in ROC1-silenced cells at 120 hrs post infection, when the senescence population reached the peak (Figure 5), was remarkably induced with the level similar to that of etoposide treatment (Figure 6B). To further define how early the ROC1 silencing could activate DNA damage response, we performed a time course study. As shown in Figure 6C, no difference in the level of phosphor-γH2AX was observed between LT-CONT and LT-ROC1 infected cells at 48 hour post infection, when no ROC1 silencing was observed. The levels of phosphor-γH2AX started to increase in ROC1-silenced cells at 72 hrs and reach the peak of 11-fold induction at 120 hrs post infection, correlated well with ROC1 silencing. These results clearly demonstrate that ROC1 silencing could induce DNA damage that contributes to the induction of G2/M arrest, apoptosis, and senescence in p53/Rb-independent manner.

Figure 6Figure 6
ROC1 silencing induced DNA damage

Discussion

Previous studies have revealed that ROC1 is a growth essential gene in yeast (5, 12), Caenorhabditis elegans (13), Drosophila (14) and mouse (15) as well as for the growth of several human cancer cell lines (16). Here we demonstrated mechanistically that siRNA silencing of ROC1, dramatically suppressed cell proliferation and survival by induction of senescence and apoptosis in multiple cancer cell lines and of G2/M arrest in a particular line.

Cellular senescence is a powerful mechanism to restrain proliferation of potentially tumorigenic cells and kill cancer cells (41, 42). Senescence is mainly regulated by two tumor suppressor pathways: p53/p21 and p16/pRB (22, 42, 43). Here using multiple approaches in multiple cell lines, we clearly demonstrated that ROC1 silencing induces the senescence independent of p53/p21 and p16/pRB. Significantly, we found that ROC1 silencing could induce DNA damage to a level comparable to that induced by a well-known DNA damaging agent, etoposide (Fig 6). Since senescence, initiated by oncogene activation, telomere, or other stimulus, is frequently associated with DNA damage (3740), ROC1 silencing-induced senescence could result from cellular response to DNA damage. It is very likely that some DNA damage responsive molecule(s) are the substrates of ROC1-SCF E3 ubiquitin ligases, whose accumulation upon ROC1 silencing triggers sustained DNA damage response. Our study, therefore, opens up a new avenue for future study toward the identification of these substrates and elucidation of the novel senescence-inducing pathways that are independent of p53/Rb, but regulated by ROC1-SCF E3 ubiquitin ligases.

Induction of apoptosis is one of the most important strategies for anticancer therapy (34). In this study, we found that ROC1 siRNA silencing induced apoptosis in multiple cancer cells. Mechanistic study revealed that ROC1 silencing not only led to moderate accumulation of pro-apoptotic Puma, but also caused remarkable reduction of anti-apoptotic protein Bcl-2, Mcl-1 and survivin, although we cannot exclude the possibility that these later changes were the consequence of apoptosis. Nevertheless, the changes in more than one protein may explain why our effort to rescue apoptosis-inducing phenotype in ROC1-silenced cells by simultaneous silencing of Puma was not successful (not shown). Given the fact that ROC1 is the RING component of SCF E3 ligases, required for ubiquitination and subsequent degradation of a variety of protein substrates, one could anticipate that alterations of multiple protein substrates would contribute to the induction of senescence and apoptosis upon ROC1 silencing and single gene based rescue would not be sufficient.

A cell line-dependent feature observed upon ROC1 silencing is induction of the G2/M arrest in U87 cells, which is associated with significant accumulation of 14-3-3σ and reduction of Cdc2/cyclin B1. It is known that 14-3-3σ sequesters Cdc2/cyclin B1 in the cytoplasm away from its nuclear targets, leading to a subsequent G2/M arrest (32), whereas the down-regulation of Cdc2 and cyclin B1 could directly impair the formation of Cdc2/cyclin B1 complexes required for G2/M transition (33). Thus, accumulation of 14-3-3σ and reduction of Cdc2 and cyclin B1 could act in a synergistic manner to trigger the G2/M arrest upon ROC1 silencing. Given the fact that G2/M arrest is a common cell cycle checkpoint mechanism in response to DNA damage (35, 36), it is very likely that G2/M arrest is also initiated by DNA damage upon ROC1 silencing. This notion is supported by our observation that both G2/M arrest (Fig 5) and DNA damage (Fig 6) started to occur at early time point (72 hrs post cell infection), when the ROC-1 silencing effect starts to appear.

The major finding of this study is that ROC1 silencing triggers senescence and apoptosis in multiple lines as well as G2/M arrest in U87 cells. How can three distinct phenotypic changes occur, upon ROC1 silencing, among U87 cells while grown under the same culture dish? One explanation is that these pathways were activated consecutively, with induction of G2/M arrest occurring first, followed by apoptotic cell death and senescence, as demonstrated and supported by our time course study (Fig. 5). In fact, the process of G2/M arrest followed by induction of apoptosis and/or senescence has been described in few other systems (4447). Another more sophisticated answer would be that LT-ROC1 infected individual cancer cells rather randomly with an uneven silencing of ROC levels among cells. Individual cells with different degree of ROC1 reduction would accumulate different subsets of ROC1-SCF substrates that are responsible for induction of different phenotypes, namely G2/M arrest, apoptosis, or senescence. The future challenge will be to identify these different sets of ROC1-SCF substrates that separately regulate these growth arrest and death pathways. Toward that goal, a recent study using global protein stability profiling has identified over 350 potential SCF substrates which are closely involved in the regulation of cell cycle, apoptosis, and cell signaling (48, 49). Mechanistic characterization of these SCF substrates would broaden our understanding how ROC1-SCF E3 ligases regulate cell proliferation and survival. Finally, the high sensitivity of ROC1-overexpressed human cancer cells to ROC1-silencing suggest that growth of cancer cells is heavily reliant on a high level of ROC1, rendering ROC1 as a promising anti-cancer target for selective cancer cell killing.

Supplementary Material

supplemental

Acknowledgements

We thank Danfeng Cai, Monique Verhaegen, and Mary Beth Riblett for their technical support. We thank Drs. Dafydd Thomas and Thomas Giordano for providing us the primary human cancer tissue microarrays. This work is supported by NCI grants (CA111554 and CA118762) to YS and CA107237 to M.S.S.

References

1. Skowyra D, Craig KL, Tyers M, Elledge SJ, Harper JW. F-box proteins are receptors that recruit phosphorylated substrates to the SCF ubiquitin-ligase complex [see comments] Cell. 1997;91:209–219. [PubMed]
2. Ohta T, Michel JJ, Schottelius AJ, Xiong Y. ROC1, a homolog of APC11, represents a family of cullin partners with an associated ubiquitin ligase activity. Mol Cell. 1999;3:535–541. [PubMed]
3. Kamura T, Conrad MN, Yan Q, Conaway RC, Conaway JW. The Rbx1 subunit of SCF and VHL E3 ubiquitin ligase activates Rub1 modification of cullins Cdc53 and Cul2. Genes Dev. 1999;13:2928–2933. [PubMed]
4. Tan P, Fuchs SY, Chen A, et al. Recruitment of a ROC1-CUL1 ubiquitin ligase by Skp1 and HOS to catalyze the ubiquitination of IkBa. Mol Cell. 1999;3:527–533. [PubMed]
5. Seol JH, Feldman RMR, Zachariae WZ, et al. Cdc53/cullin and the essential Hrt1 RING-H2 subunit of SCF define a ubiquitin ligase module that activates the E2 enzyme Cdc34. Genes & Dev. 1999;13:1614–1626. [PubMed]
6. Nakayama KI, Nakayama K. Ubiquitin ligases: cell-cycle control and cancer. Nat Rev Cancer. 2006;6:369–381. [PubMed]
7. Petroski MD, Deshaies RJ. Function and regulation of cullin-RING ubiquitin ligases. Nat Rev Mol Cell Biol. 2005;6:9–20. [PubMed]
8. Gstaiger M, Jordan R, Lim M, et al. Skp2 is oncogenic and overexpressed in human cancers. Proc Natl Acad Sci U S A. 2001;98:5043–5048. [PubMed]
9. Welcker M, Clurman BE. FBW7 ubiquitin ligase: a tumour suppressor at the crossroads of cell division, growth and differentiation. Nat Rev Cancer. 2008;8:83–93. [PubMed]
10. Chen A, Wu K, Fuchs SY, Tan P, Gomez C, Pan ZQ. The conserved RING-H2 finger of ROC1 is required for ubiquitin ligation. J Biol Chem. 2000;275:15432–15439. [PubMed]
11. Zheng N, Schulman BA, Song L, et al. Structure of the Cul1-Rbx1-Skp1-F boxSkp2 SCF ubiquitin ligase complex. Nature. 2002;416:703–709. [PubMed]
12. Swaroop M, Wang Y, Miller P, et al. Yeast homolog of human SAG/ROC2/Rbx2/Hrt2 is essential for cell growth, but not for germination: Chip profiling implicates its role in cell cycle regulation. Oncogene. 2000;19:2855–2866. [PubMed]
13. Sasagawa Y, Urano T, Kohara Y, Takahashi H, Higashitani A. Caenorhabditis elegans RBX1 is essential for meiosis, mitotic chromosomal condensation and segregation, and cytokinesis. Genes Cells. 2003;8:857–872. [PubMed]
14. Noureddine MA, Donaldson TD, Thacker SA, Duronio RJ. Drosophila Roc1a encodes a RING-H2 protein with a unique function in processing the Hh signal transducer Ci by the SCF E3 ubiquitin ligase. Dev Cell. 2002;2:757–770. [PubMed]
15. Tan M, Davis S, Saunders TL, Zhu Y, Sun Y. RBX1/ROC1 disruption results in early embryonic lethality due to proliferation failure, partially rescued by simultaneous loss of p27. Proc Natl Acad Sci U S A. 2009 PMID: 19325126. [PubMed]
16. Schlabach MR, Luo J, Solimini NL, et al. Cancer proliferation gene discovery through functional genomics. Science. 2008;319:620–624. [PMC free article] [PubMed]
17. Gu Q, Tan M, Sun Y. SAG/ROC2/Rbx2 is a novel activator protein-1 target that promotes c-Jun degradation and inhibits 12-O-tetradecanoylphorbol-13-acetate-induced neoplastic transformation. Cancer Res. 2007;67:3616–3625. [PubMed]
18. Sun SH, Zheng M, Ding K, Wang S, Sun Y. A small molecule that disrupts Mdm2-p53 binding activates p53, induces apoptosis, and sensitizes lung cancer cells to chemotherapy. Cancer Biol Ther. 2008;7:845–852. [PubMed]
19. Zheng M, Morgan-Lappe SE, Yang J, et al. Growth inhibition and radiosensitization of glioblastoma and lung cancer cells by small interfering RNA silencing of tumor necrosis factor receptor-associated factor 2. Cancer Res. 2008;68:7570–7578. [PMC free article] [PubMed]
20. Itahana K, Campisi J, Dimri GP. Methods to detect biomarkers of cellular senescence: the senescence-associated beta-galactosidase assay. Methods Mol Biol. 2007;371:21–31. [PubMed]
21. Schmitt CA. Cellular senescence and cancer treatment. Biochim Biophys Acta. 2007;1775:5–20. [PubMed]
22. Deng Y, Chan SS, Chang S. Telomere dysfunction and tumour suppression: the senescence connection. Nat Rev Cancer. 2008;8:450–458. [PMC free article] [PubMed]
23. Wang CC, Liao YP, Mischel PS, Iwamoto KS, Cacalano NA, McBride WH. HDJ-2 as a target for radiosensitization of glioblastoma multiforme cells by the farnesyltransferase inhibitor R115777 and the role of the p53/p21 pathway. Cancer Res. 2006;66:6756–6762. [PubMed]
24. Pochampally R, Fodera B, Chen L, Lu W, Chen J. Activation of an MDM2-specific caspase by p53 in the absence of apoptosis. J Biol Chem. 1999;274:15271–15277. [PubMed]
25. Kim SK, Wang KC, Cho BK, et al. Adenoviral p16/CDKN2 gene transfer to malignant glioma: role of p16 in growth, invasion, and senescence. Oncol Rep. 2003;10:1121–1126. [PubMed]
26. Kawabe S, Roth JA, Wilson DR, Meyn RE. Adenovirus-mediated p16INK4a gene expression radiosensitizes non-small cell lung cancer cells in a p53-dependent manner. Oncogene. 2000;19:5359–5366. [PubMed]
27. Huh K, Zhou X, Hayakawa H, et al. Human papillomavirus type 16 E7 oncoprotein associates with the cullin 2 ubiquitin ligase complex, which contributes to degradation of the retinoblastoma tumor suppressor. J Virol. 2007;81:9737–9747. [PMC free article] [PubMed]
28. Knight JS, Sharma N, Robertson ES. Epstein-Barr virus latent antigen 3C can mediate the degradation of the retinoblastoma protein through an SCF cellular ubiquitin ligase. Proc Natl Acad Sci U S A. 2005;102:18562–18566. [PubMed]
29. Ip SM, Huang TG, Yeung WS, Ngan HY. pRb-expressing adenovirus Ad5-Rb attenuates the p53-induced apoptosis in cervical cancer cell lines. Eur J Cancer. 2001;37:2475–2483. [PubMed]
30. Carlson BA, Dubay MM, Sausville EA, Brizuela L, Worland PJ. Flavopiridol induces G1 arrest with inhibition of cyclin-dependent kinase (CDK) 2 and CDK4 in human breast carcinoma cells. Cancer Res. 1996;56:2973–2978. [PubMed]
31. Okabe H, Lee SH, Phuchareon J, Albertson DG, McCormick F, Tetsu O. A critical role for FBXW8 and MAPK in cyclin D1 degradation and cancer cell proliferation. PLoS ONE. 2006;1:e128. [PMC free article] [PubMed]
32. Hermeking H, Benzinger A. 14-3-3 proteins in cell cycle regulation. Semin Cancer Biol. 2006;16:183–192. [PubMed]
33. Porter LA, Donoghue DJ. Cyclin B1 and CDK1: nuclear localization and upstream regulators. Prog Cell Cycle Res. 2003;5:335–347. [PubMed]
34. Ghobrial IM, Witzig TE, Adjei AA. Targeting apoptosis pathways in cancer therapy. CA Cancer J Clin. 2005;55:178–194. [PubMed]
35. Stark GR, Taylor WR. Analyzing the G2/M checkpoint. Methods Mol Biol. 2004;280:51–82. [PubMed]
36. Harper JW, Elledge SJ. The DNA damage response: ten years after. Mol Cell. 2007;28:739–745. [PubMed]
37. d'Adda di Fagagna F. Living on a break: cellular senescence as a DNA-damage response. Nat Rev Cancer. 2008;8:512–522. [PubMed]
38. Bartkova J, Rezaei N, Liontos M, et al. Oncogene-induced senescence is part of the tumorigenesis barrier imposed by DNA damage checkpoints. Nature. 2006;444:633–637. [PubMed]
39. d'Adda di Fagagna F, Reaper PM, Clay-Farrace L, et al. A DNA damage checkpoint response in telomere-initiated senescence. Nature. 2003;426:194–198. [PubMed]
40. Di Micco R, Fumagalli M, Cicalese A, et al. Oncogene-induced senescence is a DNA damage response triggered by DNA hyper-replication. Nature. 2006;444:638–642. [PubMed]
41. Schmitt CA, Fridman JS, Yang M, et al. A senescence program controlled by p53 and p16INK4a contributes to the outcome of cancer therapy. Cell. 2002;109:335–346. [PubMed]
42. Campisi J, d'Adda di Fagagna F. Cellular senescence: when bad things happen to good cells. Nat Rev Mol Cell Biol. 2007;8:729–740. [PubMed]
43. Itahana K, Campisi J, Dimri GP. Mechanisms of cellular senescence in human and mouse cells. Biogerontology. 2004;5:1–10. [PubMed]
44. Oliva JL, Caino MC, Senderowicz AM, Kazanietz MG. S-Phase-specific activation of PKC alpha induces senescence in non-small cell lung cancer cells. J Biol Chem. 2008;283:5466–5476. [PubMed]
45. Wada T, Joza N, Cheng HY, et al. MKK7 couples stress signalling to G2/M cell-cycle progression and cellular senescence. Nat Cell Biol. 2004;6:215–226. [PubMed]
46. Weir NM, Selvendiran K, Kutala VK, et al. Curcumin induces G2/M arrest and apoptosis in cisplatin-resistant human ovarian cancer cells by modulating Akt and p38 MAPK. Cancer Biol Ther. 2007;6:178–184. [PMC free article] [PubMed]
47. Xia W, Spector S, Hardy L, et al. Tumor selective G2/M cell cycle arrest and apoptosis of epithelial and hematological malignancies by BBL22, a benzazepine. Proc Natl Acad Sci U S A. 2000;97:7494–7499. [PubMed]
48. Yen HC, Elledge SJ. Identification of SCF ubiquitin ligase substrates by global protein stability profiling. Science. 2008;322:923–929. [PubMed]
49. Yen HC, Xu Q, Chou DM, Zhao Z, Elledge SJ. Global protein stability profiling in mammalian cells. Science. 2008;322:918–923. [PubMed]