PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Cell Death Differ. Author manuscript; available in PMC 2010 April 1.
Published in final edited form as:
PMCID: PMC2743765
NIHMSID: NIHMS122553

C. elegans caspase homolog CSP-2 inhibits CED-3 autoactivation and apoptosis in germ cells

Abstract

In C. elegans, apoptosis in germ cells is mediated by the same core apoptotic machinery that controls apoptosis in somatic cells. These include the CED-3 caspase, the CED-3 activator CED-4, and the cell death inhibitor CED-9. However, germline apoptosis also differs from somatic apoptosis in its regulation. We found that CSP-3, a caspase homolog that blocks CED-3 autoactivation and apoptosis in somatic cells, does not affect apoptosis in germ cells. Interestingly, the second C. elegans caspase homolog CSP-2 shares sequence similarity to both catalytic subunits of the CED-3 caspase, and surprisingly, contains a stretch of sequence that is almost identical to that of CSP-3. Unlike CSP-3 that acts specifically in somatic cells, loss of CSP-2 causes increased apoptosis only in germ cells, suggesting that CSP-2 is a germ cell specific apoptosis inhibitor. Moreover, like CSP-3, CSP-2 associates with the CED-3 zymogen and inhibits its autoactivation, but does not inhibit CED-4-induced CED-3 activation or the activity of the activated CED-3 protease. Thus, two different C. elegans caspase homologs employ the same mechanism to prevent caspase autoactivation and apoptosis in different tissues, suggesting that this could be a generally applicable strategy for regulating caspase activation and apoptosis.

Keywords: germ cell death, Caenorhabditis elegans, CED-3, caspase activation, cell death inhibitor

In Caenorhabditis elegans, many early developing germ cells undergo apoptosis during normal oogenesis; this process is called germline apoptosis1, 2. Germline apoptosis appears to be an integral component of the oogenesis program and has been suggested to be important for eliminating excess germ cells that acted as nurse cells to provide cytoplasmic components to maturing oocytes13. Germline apoptosis is conserved among eukaryotes, from C. elegans to humans. Therefore, C. elegans provides an excellent model system for studying the regulation of germ cell apoptosis.

The molecular machinery that mediates germline apoptosis has been extensively studied and found to share key components with that of somatic apoptosis. In particular, CED-3, CED-4 and CED-9 are essential for apoptosis in both germ cells and somatic cells1, 2. However, regulation of apoptosis in germ cells and in somatic cells appears to differ significantly. For example, the pro-apoptotic BH3 only protein EGL-1 is crucial for somatic apoptosis but is dispensable for physiological germ cell death1. Moreover, C. elegans somatic cells are resistant to genotoxic insults, whereas germ cells readily respond to genotoxic stresses to undergo apoptosis4, suggesting that the regulation of germ cell death could be fundamentally different from that of somatic cell death.

One crucial aspect of apoptosis regulation is the regulation of caspases, the aspartate-specific cysteine proteases that execute the cell killing process5, 6. Numerous caspase inhibitors have been identified and shown to inhibit the activation or the activities of caspases. In particular, the inhibitor of apoptosis proteins (IAPs), characterized by at least one baculoviral IAP repeat (BIR) and a RING finger motif7, are conserved caspase inhibitors in Drosophila and higher organisms812. However, no IAP homolog has been identified in C. elegans. Instead, a partial caspase homolog CSP-3 was found to protect C. elegans somatic cells from apoptosis by associating with the CED-3 zymogen and inhibiting CED-3 autoactivation13. It is unclear whether CSP-3 also inhibits CED-3 autoactivation in C. elegans germ cells and how the activity of CED-3 is negatively regulated in the germline.

In this study, we found that a second C. elegans caspase homolog CSP-2, which shares sequence similarity to both catalytic subunits of CED-3 (Figure 1a), is expressed specifically in the C. elegans germline and acts as a germ-cell-specific cell death inhibitor. Moreover, CSP-2 associates with the CED-3 zymogen and specifically inhibits CED-3 autoactivation, but not CED-3 activation mediated by CED-4 or CED-3’s catalytic activity. Our findings suggest that caspase homologs lacking protease activities serve as dedicated caspase inhibitors in C. elegans to prevent CED-3 from inadvertent autoactivation and cells from apoptosis.

Figure 1
CSP-2, a CED-3 homologue, is expressed specifically in hermaphrodite germ cells. (a) Sequence alignment of CED-3, CSP-2B, and CSP-3. Residues that are identical are shaded in yellow and residues that are similar in pink. Trp131, Leu132, and Phe 186 of ...

Results

Loss of csp-2 causes increased germ cell death but does not affect somatic cell death

CSP-2 was first identified as a caspase homolog that shares sequence similarity to both catalytic subunits of CED-3 (Figure 1a). However, CSP-2 does not appear to contain a caspase activity in vitro14, probably because it lacks the invariant active-site pentapeptide QACXG (X could be R, Q, or G) found in all active caspases (VCCRG in CSP-2)15. Interestingly, the carboxyl terminal region of CSP-2 is homologous to the small subunit of CED-3 and shares 92% identity to CSP-3 (Figure 1a), raising an intriguing possibility that CSP-2 may act as a caspase inhibitor like CSP-3. To examine the function of csp-2 in C. elegans, we obtained three different csp-2 deletion alleles (Figure 1b). Two deletions, tm2858 and tm3077, remove parts of the carboxyl terminal region of CSP-2, which is present in both csp-2 transcripts identified previously (Figure 1b)14. These two csp-2 transcripts conceptually encode two proteins, CSP-2A and CSP-2B, respectively. CSP-2B is identical to the carboxyl terminus of CSP-2A, which has an extra 563 amino acid at the amino terminus. Since CSP-2B transcript is trans-spliced to the SL1 spliced leader, it is an independent, complete transcript14, 16. Indeed, RT-PCR analysis of mixed stage wild-type animals reveals that CSP-2B is the dominant csp-2 message and we barely detected any CSP-2A transcript (Figure 1c). Moreover, in western blot analysis, we only detected a protein of approximately 33 kDa, the size of CSP-2B, in worm lysate derived from animals carrying a complex transgene array expressing CSP-2::3xFlag under the control of its own promoter (Pcsp-2csp-2::3xFlag; Figure 1b and 1d). These results indicate that CSP-2B is the major CSP-2 protein expressed in C. elegans, although very low-level expression of CSP-2A cannot be ruled out. The third deletion, ok1742, specifically removes a region in CSP-2A but does not affect the CSP-2B coding region.

To investigate whether csp-2 affects apoptosis, we counted the number of apoptotic cells in the germline and embryos of csp-2 deletion mutants, two developmental stages with active apoptosis events. Since apoptotic cells are swiftly engulfed in C. elegans, we sensitized these cell corpse assays by counting ced-6(n2095); csp-2 and ced-2(n1994) csp-2 double mutants, in which cell corpse engulfment is disabled due to the inactivation of the ced-2 or the ced-6 gene and a small increase in cell death will result in a greater increase in the number of persistent cell corpses13, 17. Unlike the csp-3(tm2260) mutation that causes increased cell deaths in C. elegans embryos and ectopic deaths of neurons that normally live13, csp-2(tm2858) and csp-2(tm3077) do not seem to affect embryonic cell deaths (Figure 2a and b) or result in missing touch cells in larvae (Figure 2c; data not shown), suggesting that csp-2 does not affect apoptosis in somatic tissues. However, we did observe a slight increase in germ cell deaths in csp-2(tm2858) and csp-2(tm3077) animals compared with wild-type animals (Figure 3a; data not shown) and the increase in germ cell corpses is easily detected in the ced-6(n2095) and ced-2(n1994) mutant backgrounds (Figure 3b to 3e), suggesting that loss of csp-2 causes increased germ cell deaths and that CSP-2 inhibits apoptosis in germ cells. By contrast, we did not observe increased germ cell corpses in csp-3(tm2260), csp-3(tm2260); ced-6(n2095), or csp-3(tm2260); ced-2(n1994) animals, compared with wild-type, ced-6(n2095), and ced-2(n1994) animals, respectively (Figure 3a, c and e). Nor did we observe further increase in germ cell deaths in the csp-3(tm2260); csp-2(tm3077) double mutant or in the csp-3(tm2260); ced-6(n2095); csp-2(tm3077) and csp-3(tm2260); ced-2(n1994) csp-2(tm3077) triple mutants (Figure 3a, c, and e), indicating that csp-3 does not contribute to the inhibition of germ cell death. Interestingly, unlike csp-2(tm2858) and csp-2(tm3077) deletion mutations, csp-2(ok1742), which removes only the CSP-2A coding region, did not seem to affect germ cell death (Figure 3c). This result is consistent with our observations that the CSP-2B transcript is the dominant csp-2 transcript in C. elegans and suggests that CSP-2B is mainly responsible for inhibiting germ cell death in the csp-2 locus and that CSP-2A is not critical for this inhibitory function. We thus only analyzed the activity of CSP-2B hereafter.

Figure 2
Inactivation of csp-2 does not affect apoptosis in somatic cells. (a, b) Embryonic cell corpse assays. Cell corpses were scored in the indicated strains. The ced-6(n2095) allele was used in b. Bean (B/C), 1.5-fold (1.5), 2-fold (2), 2.5-fold (2.5), 3-fold ...
Figure 3
Loss of csp-2 causes increased apoptosis in germ cells. Germ cell corpses were scored in the indicated strains from one gonad arm 48 hours post L4 to adult molt (a, c, e, f and g) or every 12 hours post L4 to adult molt (b and d). Average numbers of germ ...

Loss of csp-2 reduces animal brood size

We also examined whether ectopic deaths of germ cells in csp-2(lf) mutants affect the brood size of the animals, as what has been observed in animals deficient in ced-9, another anti-apoptosis gene18. Both csp-2 mutants (tm3077 and tm2858) had significantly reduced brood sizes, approximately 60% of that observed in wild-type animals (Table 1). On the other hand, the csp-2(ok1742) mutant, which did not display ectopic germ cell deaths, had a normal brood size (Figure 3c). Moreover, csp-2(tm3077) exacerbated the sterility defect caused by a weak loss-of-function mutation in ced-9 (n1653ts)18, resulting in complete sterility of the ced-9(n1653ts); csp-2(tm3077) double mutant (Table 1). These results suggest that csp-2 is important for normal germline development in C. elegans.

Table 1
The csp-2 mutations cause reduced brood size

CSP-2B is specifically expressed in C. elegans germline

We next examined the expression patterns of csp-2 by constructing a CSP-2 translational GFP fusion under the control of its own promoter (Pcsp-2csp-2::gfp) and generating a low-copy integrated transgene (smIs372) carrying Pcsp-2csp-2::gfp through biolistic bombardment (Figure 1b)19. smIs372 fully rescued the increased germ cell corpse phenotype of the ced-2(n1994) csp-2(tm3077) mutant (Figure 3g), suggesting that the fusion protein is expressed in the right cells and targeted to the appropriate cellular locations. Using an antibody to GFP, we detected CSP-2::GFP in the cytoplasm of all germ cells of smIs372 hermaphrodite animals but failed to see any GFP staining in somatic cells (Figure 1e and data not shown). This cytoplasmic staining pattern of CSP-2::GFP is similar to that of CSP-3::GFP13, suggesting that both proteins act in cytoplasm to inhibit apoptosis. Interestingly, in immunoblotting analysis of worm lysate from male or hermaphrodite animals carrying the Pcsp-2csp-2::3xFlag complex array, we detected expression of CSP-2B only in hermaphrodites but not in males (Figure. 1d). Since no cell death occurs in male germline1, 2, expression of CSP-2 may be dispensable in males.

To verify that germline expression of CPS-2B is sufficient to mediate the csp-2 function, we expressed a GFP::CSP-2B fusion under the control of the pie-1 promoter (Ppie-1GFP::CSP-2B) in complex transgene arrays that allow expression of transgenes in the germline20. Ppie-1GFP::CSP-2B fully rescued the increased germ cell corpse phenotype of the ced-6(n2095); csp-2(tm3077) mutant, whereas a mutant Ppie-1GFP::CSP-2B(W131E, L132R, F186D) construct failed to do so (Figure 3f; see below), confirming that CSP-2B is responsible for the csp-2 activity in inhibiting germ cell deaths. We could also rescue the csp-2(lf) defect or even cause mild suppression of germ cell deaths by ubiquitously overexpressing CSP-2B under the control of the heat-inducible promoter (Phspcsp-2B) from a low-copy transgene (smIs389) generated by biolistic bombardment (Figure 3g). Moreover, the Phspcsp-2B transgenes could rescue the missing cell defect of the csp-3(lf) mutant in somatic cells (Figure 3h)13. However, like CSP-313, overexpression of CSP-2B in soma did not obviously suppress the death of somatic cells that are programmed to die (data not shown). These results indicate that csp-2 may use a similar mechanism like csp-3 to prevent cell death.

CSP-2B associates with the CED-3 zymogen

Because CSP-2B shares sequence similarity to both the large and the small subunits of CED-3 that form the active p17/p13 heterodimeric protease complex (Figure 1a)21, we tested whether CSP-2B may associate with CED-3 in vitro like CSP-313. Using a glutathione S transferase (GST) fusion protein pull-down assay, the CED-3 zymogen tagged with a Flag epitode was pulled down by the GST-CSP-2B fusion, when both were co-expressed in bacteria (Figure 4a). By contrast, the GST control protein failed to do so, suggesting that CSP-2 interacts with the CED-3 zymogen. We then characterized the interaction between CSP-2B and different domains of CED-3 and found that the large subunit (p17) and the small subunit (p13) of CED-3 each could associate with CSP-2B specifically (Figure 4b). Therefore, CSP-2B may interfere with the function of CED-3 by binding to either region of the CED-3 zymogen.

Figure 4
CSP-2B associates with CED-3 in vitro. (a) CSP-2B binds to the CED-3 zymogen. GST-CSP-2B, GST-CSP-2B(mut), or GST was co-expressed in bacteria with the CED-3 zymogen tagged with a Flag epitode (CED-3-Flag). “mut” stands for W131E, L132R, ...

To identify interface residues that are important for CSP-2B binding to CED-3, we constructed a three-dimensional structural model of the CED-3/CSP-2 complex based on the crystal structure of active caspase-3 (Figure 4c)22. We then mutated several potential interface residues and examined whether these mutations interfered with the binding of CSP2B to CED-3 (data not shown). We found that Trp131 and Leu132, two residues in a CSP-2B region homologous to the large subunit of CED-3, were required for CSP-2B binding to the small subunit of CED-3 (Figure 1a and bottom panel of Figure 4b). On the other hand, Phe186 situated in a CSP-2B region homologous to the small subunit of CED-3 was important for CSP-2B binding to the large subunit of CED-3 in vitro (Figure 1a and the upper panel of Figure 4b). Moreover, a CSP-2B mutant carrying these three amino acid substitutions (W131E, L132R, F186D) did not bind CED-3 zymogen (Figure 4a) and failed to rescue the csp-2(tm3077) mutant when expressed under the control of the pie-1 promoter [Ppie-1GFP::CSP-2B(W131E, L132R, F186D); Figure 3f]. These results suggest that association of CSP-2B with CED-3 is important for CSP-2B to protect germ cells from apoptosis.

CSP-2B inhibits specifically autoactivation of the CED-3 zymogen

Since CSP-3 inhibits apoptosis by specifically blocking autoactivation of the CED-3 zymogen, we examined whether CSP-2B has a similar activity using an in vitro CED-3 autoactivation assay described previously13. As shown in Figure 5a (lanes 1–3), CED-3 zymogen synthesized in rabbit reticulocyte lysate and labeled with 35S-Methinione was slowly auto-processed into active forms. The autoactivation of the CED-3 zymogen was inhibited by the addition of the GST CSP-2B protein (Figure 5a, lanes 4–6) but was not affected by the addition of a similar amount of the GST CSP-2B(W131E, L132R, F186D) protein or the GST protein (Figure 5a, lanes 1–3 and 7–9). Addition of oligomeric CED-4 to the reactions expedited the activation of the CED-3 zymogen (compare lanes 1–5 and lanes 6–10 in Figure 5b). Although GST-CSP-2B completely inhibited CED-3 autoactivation (Figure 5b, lanes 11–15), it delayed but did not block the activation of CED-3 induced by oligomeric CED-4 (Figure 5b, lanes 16–20). GST-CSP-2B also failed to inhibit the catalytic activity of the active CED-3 protease (Figure 5c). Therefore, CSP-2B acts exactly like CSP-3: it complexes with the CED-3 zymogen and inhibits its autoactivation, but is unable to block CED-4-induced CED-3 activation or the activity of active CED-3.

Figure 5
CSP-2B specifically inhibits the autoactivation of the CED-3 zymogen in vitro. (a) CSP-2B inhibits autoactivation of the CED-3 zymogen. GST (93 nM, lanes 1–3), GST-CSP-2B (43 nM, lanes 4–6), or GST-CSP-2B(mut) (43 nM, lanes 7–9) ...

Discussion

Apoptosis is a common feature of metazoan germline development. A wild-type C. elegans hermaphrodite has approximately 2000 germ cells generated during its lifetime and more than half of these cells undergo apoptosis in a random fashion1. By contrast, somatic cell deaths in C. elegans occur strictly based on cell lineage information and are invariant from animal to animal23. As such, these two apoptotic processes likely will be controlled through very different regulatory pathways. Indeed, the cell death initiator EGL-1 that is critical for somatic apoptosis is totally dispensable for physiological germ cell death1 and it is unclear how germ cell deaths are initiated. Moreover, in this study, we showed that the CED-3 caspase inhibitor CSP-3 does not affect germ cell death (Figure 3c and 3e), providing further evidence that key regulatory components of germ cell death differ from those of somatic cell death to achieve tissue specificity. This finding also suggests that germ cells might possess an alternative CED-3 caspase inhibitor(s) to prevent inappropriate or excessive germ cell deaths.

CSP-2 is the second caspase homolog identified in C. elegans and shares sequence similarity to both the large and the small subunits of CED-314. However, unlike CSP-1, another worm caspase homolog that possesses a caspase activity14, CSP-2 does not display any caspase activity in vitro, which may result from its lack of the invariant pentapeptide found in active sites of all active caspases15. Intriguingly, the carboxyl terminus of CSP-2 is 92% identical to CSP-3. Phylogenetic analysis of C. elegans CED-3 and CSP proteins suggests that csp-2 and csp-3 may have evolved from a common ancestor (Supplementary Figure 1). Therefore, CSP-2 may behave like CSP-3 in binding to CED-3 and inhibiting CED-3 autoactivation13. However, inactivation of csp-2 does not appear to affect somatic cell death, nor does it enhance the csp-3(lf) defect in somatic cells (Figure 2), indicating that csp-2 does not affect apoptosis in somatic cells. On the other hand, inactivation of csp-2 does increase apoptosis in germ cells (Figure 3), which is not affected by loss of csp-3, suggesting that CSP-2, but not CSP-3, acts specifically in germ cells to inhibit apoptosis. Consistent with these findings, CSP-2 is specifically expressed in the C. elegans germline. Therefore, CSP-2 and CSP-3, two closely related paralogs, somehow diverge during evolution to act in germ cells and somatic cells, respectively, to inhibit apoptosis, leading to tissue-specific cell death regulation.

Given the unique mode by which CSP-3 regulates CED-3 autoactivation and somatic apoptosis13, we tested how CSP-2 inhibits cell death. Our biochemical analysis indicates that CSP-2 directly associates with the CED-3 zymogen through both its small and large subunits (Figure 4a and b). Three amino acid substitutions in CSP-2 (W131E, L132R, F186D) almost completely abolish the binding of CSP-2 to the CED-3 zymogen in vitro (Figure 4a) and the apoptosis inhibitory activity of CSP-2 in vivo (Figure. 3f), suggesting that binding of CSP-2 to CED-3 is critical for its anti-apoptosis function. Moreover, we found that CSP-2 acts exactly like CSP-3 in regulating the activity of CED-3: it associates with the CED-3 zymogen and inhibits its autoactivation, but is unable to block oligomeric CED-4-induced CED-3 activation or inhibit the catalytic activity of activated CED-3 protease (Figure 5a–c). These results establish CSP-2 as the second caspase inhibitor in C. elegans that acts specifically to inhibit autoactivation of CED-3 in germ cells, thereby preventing inappropriate germ cell deaths.

It is interesting that two different caspase homologs employ the same strategy to inhibit CED-3 activation and apoptosis in two different tissues, somatic cells and germ cells (Figure 5d). The repeated use of this unique strategy to negatively regulate CED-3 caspase activation underscores the importance of keeping caspases in check in living cells. In the absence of other obvious caspase inhibitors such as IAPs in C. elegans, such caspase-like inhibitors are important players in modulating the level of CED-3 activation and preventing inadvertent CED-3 activation in cells that should live, without interfering with normal cell death induced by CED-4 (Figure 5d), as CSP-2B only delayed but did not block CED-4-induced CED-3 activation (Figure 5b). We propose that similar incomplete or inactive caspase homologs exist in other organisms and could employ the same mechanism to negatively regulate caspase activation and apoptosis.

Materials and Methods

C. elegans strains

We cultured strains of C. elegans at 20°C using standard protocols24. The Bristol strain N2 was used as the wild type stain. Most of the alleles including ced-2(n1994) and ced-6(n2095) used in this study have been described previously25, except csp-2(tm3077), csp-2(tm2858), csp-2(ok1742), and bzIs8. The csp-2(ok1742) mutant was obtained from Caenorhabditis Genetics Center (CGC) and described in Wormbase (http://www.wormbase.org/). bzIs8 is an integrated transgene located on LG X and contains a Pmec-4gfp construct26, which directs GFP expression in six C. elegans touch receptor neurons. All strains were backcrossed with N2 animals 4–10 times prior to analysis.

Quantification of germline apoptosis

We identified and quantified germ cell corpses based on their characteristic morphology when viewed with Nomarski optics as previously described1. Germline apoptosis was assessed in staged adult animals. At least 15 animals were scored for each time point. Data are reported as mean number of germline cell corpses ± standard error of the mean (s.e.m).

Isolation of csp-2(tm3077) and csp-2(tm2858) deletion alleles

We isolated the csp-2(tm3077) and csp-2(tm2858) deletion alleles from TMP/UV mutagenized worms27. Nested primers used to screen for the csp-2(tm3077) and csp-2(tm2858) alleles by PCR were 5′ GCCGGGCTATCATAATTAAC 3′ and 5′ ATACTGATCACCGAGGCCAT 3′ for the first round amplification and 5′ ACGTTTGGGATATCAGTCGA′ and 5′ CACGTCATTTCTAGACGTCG 3′ for the second round amplification. Both mutants were backcrossed with wild-type (N2) animals at least 4 times before they were analyzed further.

RNA isolation and RT-PCR analysis of csp-2 transcripts

We isolated poly(A)n mRNA from mix-stage wild-type hermaphrodite animals treated with TRIzol reagent (Invitrogen). First-strand cDNA was reverse-transcribed by using Superscript III kit (Invitrogen). PCR was performed using specific primers (csp-2A, 5′ GAGCAGTATAGTGCGTTGAGA-GAG 3′ and 5′ CTTCCTCTTCCCTTTCTCTCTGTT 3′; csp-2B, 5′ ACGTTTGGGA-TATCAGTCGA 3′ and 5′ CTAGACGTCGAAGAATAGTTG 3′), which produce a 706 bp (csp-2A) and a 622 bp (csp-2B) cDNA fragment, respectively. The PCR products were resolved on a 1.5% agarose gel.

Quantification of somatic apoptotic cell corpses and cells labeled with GFP

We counted cell corpses in animals at various embryonic and larval stages using Nomarski optics as previously described13. Also we quantified touch receptor neuron cells in bzIs8 as previously described13.

Plasmids and transgenic strains

We generated the Pcsp-2csp-2::gfp fusion construct by inserting a csp-2 genomic fragment containing 4175 bp sequence upstream of the CSP-2A initiation ATG codon and the whole csp-2 coding region into the pPD95.79 vector. The resulting plasmid was introduced into ced-1(e1735); unc-119(ed3) by the microparticle bombardment together with a marker plasmid MM016B that contains the wild-type unc-119 gene to obtain a low-copy integrated array smIs37219. To examine the expression patterns of CSP-2::GFP, anti-GFP immunostaining was carried out on the exposed gonads and embryos of smIs372 animals28.

We also generated the Ppie-1GFP::CSP-2B fusion construct by inserting the full-length csp-2B cDNA into pTE5 vector (Ppie-1GFP) through SpeI and ApaI site. The Ppie-1 GFP::CSP-2B fusion construct (wild-type or mutant with W131E, L132R, F186D substitutions) was introduced into the ced-6(n2095); csp-2(tm3077) animals through complex DNA arrays as previously described29 and examined for rescue of increased germ cell death phenotype.

Expression and purification of the CSP-2B and CED-3 proteins

We generated all protein expression constructs using the standard PCR-based cloning strategy and verified the clones through sequencing. CSP-2B and CED-3 proteins were expressed either individually or together in Escherichia coli strain BL21(DE3) as a N-terminally GST fusion protein and a C-terminally Flag-tagged protein using a pET-41b vector and a pET-3a vector (Novagen), respectively. The soluble fraction of the E. coli lysate expressing GST-CSP-2B proteins was purified using a Glutathione Sepharose column and eluted with 10 mM reduced glutathione (Amersham).

GST fusion protein pull-down assays

The GST-CSP-2B fusion protein (wild-type or mutants) or GST was co-expressed with CED-3-Flag, CED-3p13-Flag, or Flag-CED-3p17 in BL21(DE3). Bacteria were lysed by sonication in the lysis buffer [50 mM Tris at pH 8.0, 0.5 mM EDTA, 150mM NaCl, 0.01% (v/v) Triton X-100, and 0.5 mM sucrose] with protease inhibitors and the soluble fraction was incubated with Glutathione Sepharose beads at 4°C for 2 h. The Sepharose beads were then washed five times with the same buffer before the proteins were resolved on a 15% SDS polyacrylamide gel (SDS-PAGE), transferred to a PVDF membrane, and detected by immunoblotting with an anti-Flag antibody (Sigma).

In vitro CED-3 zymogen activation assay

The CED-3 zymogen was first synthesized and labeled with 35S-Methionine in the TNT Transcription/Translation coupled system (Promega) at 30°C as described previously30, in the presence of equal amount of GST-CSP-2B, GST-CSP-2B(W131E,L132R,F186D), or GST. An aliquot of the reaction was taken out at different time points and mixed with SDS sampling buffer to stop the reaction. For CED-4-mediated CED-3 activation assay, oligomeric CED-4 was added 20 minutes after the initiation of the translation reaction. An aliquot of the reaction was then taken out at different time points and mixed with SDS sampling buffer to stop the reaction. All samples were resolved by 15% SDS PAGE and analyzed by autoradiography.

Statistics

We performed all statistical analysis using Prism (GraphPad Software). All error bars indicate standard errors of the mean (s.e.m). All t tests are two-tailed unpaired t tests. Time courses curves were analyzed by two-way ANOVA.

Supplementary Material

Acknowledgments

We thank N. Pace for advice on phylogenetic analysis, Y. Shi and members of the Xue laboratory for comments and discussions, L. Yang, H.W. Yang and C.L. Sun for technical support, and M. Driscoll (Rutgers University) for the bzIs8 strain. This work was supported by NIH R01 grants (GM059083 and GM079097) and a Burroughs Welcome Fund Award to D.X. and a grant from MEXT of Japan to S.M. X.G. was supported by U. Colorado Matching Grant to the SCR Training Grant (T32 GM08759).

Abbreviations

AA
amino acid
GFP
green fluorescent protein
L1–L4
larval stages 1–4
N2
wild-type C. elegans strains-Bristol isolate
PCD
programmed cell death
RT-PCR
reverse transcriptase polymerase chain reaction
WT
wild type
CED
cell death abnormal
s.e.m
standard error of the mean

References

1. Gumienny TL, Lambie E, Hartwieg E, Horvitz HR, Hengartner MO. Genetic control of programmed cell death in the Caenorhabditis elegans hermaphrodite germline. Development. 1999;126:1011–1022. [PubMed]
2. Gartner A, Boag PR, Blackwell TK. Germline survival and apoptosis. WormBook. 2008:1–20. [PubMed]
3. Andux S, Ellis RE. Apoptosis maintains oocyte quality in aging Caenorhabditis elegans females. PLoS Genet. 2008;4:e1000295. [PMC free article] [PubMed]
4. Gartner A, Milstein S, Ahmed S, Hodgkin J, Hengartner MO. A conserved checkpoint pathway mediates DNA damage--induced apoptosis and cell cycle arrest in C. elegans. Mol Cell. 2000;5:435–443. [PubMed]
5. Shi Y. Mechanisms of caspase activation and inhibition during apoptosis. Mol Cell. 2002;9:459–470. [PubMed]
6. Boatright KM, Salvesen GS. Mechanisms of caspase activation. Curr Opin Cell Biol. 2003;15:725–731. [PubMed]
7. Deveraux QL, Reed JC. IAP family proteins--suppressors of apoptosis. Genes Dev. 1999;13:239–252. [PubMed]
8. Deveraux QL, Takahashi R, Salvesen GS, Reed JC. X-linked IAP is a direct inhibitor of cell-death proteases. Nature. 1997;388:300–304. [PubMed]
9. Roy N, Deveraux QL, Takahashi R, Salvesen GS, Reed JC. The c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specific caspases. EMBO J. 1997;16:6914–6925. [PubMed]
10. Deveraux QL, Roy N, Stennicke HR, Van Arsdale T, Zhou Q, Srinivasula SM, et al. IAPs block apoptotic events induced by caspase-8 and cytochrome c by direct inhibition of distinct caspases. EMBO J. 1998;17:2215–2223. [PubMed]
11. Meier P, Silke J, Leevers SJ, Evan GI. The Drosophila caspase DRONC is regulated by DIAP1. Embo J. 2000;19:598–611. [PubMed]
12. Hawkins CJ, Wang SL, Hay BA. A cloning method to identify caspases and their regulators in yeast: identification of Drosophila IAP1 as an inhibitor of the Drosophila caspase DCP-1. Proc Natl Acad Sci USA. 1999;96:2885–2890. [PubMed]
13. Geng X, Shi Y, Nakagawa A, Yoshina S, Mitani S, Xue D. Inhibition of CED-3 zymogen activation and apoptosis in Caenorhabditis elegans by caspase homolog CSP-3. Nat Struct Mol Biol. 2008;15:1094–1101. [PMC free article] [PubMed]
14. Shaham S. Identification of multiple Caenorhabditis elegans caspases and their potential roles in proteolytic cascades. J Biol Chem. 1998;273:35109–35117. [PubMed]
15. Cohen GM. Caspases: the executioners of apoptosis. Biochem J. 1997;326:1–16. [PubMed]
16. Blumenthal T. Trans-splicing and operons. WormBook. 2005:1–9. [PubMed]
17. Ellis RE, Jacobson DM, Horvitz HR. Genes required for the engulfment of cell corpses during programmed cell death in Caenorhabditis elegans. Genetics. 1991;129:79–94. [PubMed]
18. Hengartner MO, Ellis RE, Horvitz HR. Caenorhabditis elegans gene ced-9 protects cells from programmed cell death. Nature. 1992;356:494–499. [PubMed]
19. Praitis V, Casey E, Collar D, Austin J. Creation of low-copy integrated transgenic lines in Caenorhabditis elegans. Genetics. 2001;157:1217–1226. [PubMed]
20. Tenenhaus C, Subramaniam K, Dunn MA, Seydoux G. PIE-1 is a bifunctional protein that regulates maternal and zygotic gene expression in the embryonic germ line of Caenorhabditis elegans. Genes Dev. 2001;15:1031–1040. [PubMed]
21. Xue D, Shaham S, Horvitz HR. The Caenorhabditis elegans cell-death protein CED-3 is a cysteine protease with substrate specificities similar to those of the human CPP32 protease. Genes Dev. 1996;10:1073–1083. [PubMed]
22. Rotonda J, Nicholson DW, Fazil KM, Gallant M, Gareau Y, Labelle M, et al. The three-dimensional structure of apopain/CPP32, a key mediator of apoptosis. Nat Struct Biol. 1996;3:619–625. [PubMed]
23. Sulston JE, Horvitz HR. Post-embryonic cell lineages of the nematode, Caenorhabditis elegans. Dev Biol. 1977;56:110–56. [PubMed]
24. Brenner S. The genetics of Caenorhabditis elegans. Genetics. 1974;77:71–94. [PubMed]
25. Riddle DL, Blumenthal T, Meyer BJ, Preiss JR. C. elegans II. Cold Spring Harbor Laboratory Press; Cold Spring Harbor, New York: 1997.
26. Harbinder S, Tavernarakis N, Herndon LA, Kinnell M, Xu SQ, Fire A, et al. Genetically targeted cell disruption in Caenorhabditis elegans. Proc Natl Acad Sci USA. 1997;94:13128–13133. [PubMed]
27. Gengyo-Ando K, Mitani S. Characterization of mutations induced by ethyl methanesulfonate, UV, and trimethylpsoralen in the nematode Caenorhabditis elegans. Biochem Biophys Res Commun. 2000;269:64–69. [PubMed]
28. Darland-Ransom M, Wang X, Sun CL, Mapes J, Gengyo-Ando K, Mitani S, et al. Role of C. elegans TAT-1 protein in maintaining plasma membrane phosphatidylserine asymmetry. Science. 2008;320:528–531. [PubMed]
29. Wang X, Wang J, Gengyo-Ando K, Gu L, Sun CL, Yang C, et al. C. elegans mitochondrial factor WAH-1 promotes phosphatidylserine externalization in apoptotic cells through phospholipid scramblase SCRM-1. Nat Cell Biol. 2007;9:541–549. [PubMed]
30. Yan N, Chai J, Lee ES, Gu L, Liu Q, He J, et al. Structure of the CED-4-CED-9 complex provides insights into programmed cell death in Caenorhabditis elegans. Nature. 2005;437:831–837. [PubMed]