PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Development. Author manuscript; available in PMC 2010 October 1.
Published in final edited form as:
PMCID: PMC2739147
NIHMSID: NIHMS146967
Spatial and temporal regulation of coronary vessel formation by calcineurin-NFAT signaling
Miriam Zeini,1 Calvin T. Hang,1 Joshua Lehrer-Graiwer,1 Tiffany Dao,1 Bin Zhou,2 and Ching-Pin Chang1*
1 Division of Cardiovascular Medicine, Department of Medicine, Stanford University, Stanford, CA 94305 USA
2 Albert Einstein College of Medicine, Department of Genetics, Bronx, NY 10461 USA
* Correspondence: Ching-Pin Chang, Division of Cardiovascular Medicine, Department of Medicine, Stanford University School of Medicine, Stanford, California 94305, Phone: 650-736-8539, Fax: 650-723-6903, chingpin/at/stanford.edu
Formation of the coronary vasculature requires reciprocal signaling between endothelial, epicardially-derived smooth muscle and underlying myocardial cells. Our studies show that calcineurin-NFAT signaling functions in endothelial cells at specific time windows to regulate coronary vessel development. Mouse embryos exposed to cyclosporine (CsA), which inhibits calcineurin phosphatase activity, failed to develop normal coronary vasculature. To determine the cellular site where calcineurin functions for coronary angiogenesis, we deleted calcineurin in endothelial, epicardial and myocardial cells. Disruption of calcineurin-NFAT signaling in endothelial cells resulted in failure of coronary angiogenesis, recapitulating the coronary phenotype observed in CsA-treated embryos. In contrast, deletion of calcineurin in either epicardial or myocardial cells had no effects on coronary vasculature during early embryogenesis. To define the temporal requirement for NFAT signaling, we treated developing embryos with CsA at overlapping windows from E9.5 to E12.5 and examined coronary development at E12.5. These experiments demonstrate that calcineurin-NFAT signaling functions between E10.5 to E11.5 to regulate coronary angiogenesis. Consistent with these in vivo observations, endothelial cells exposed to CsA within specific time windows in tissue culture were unable to form tubular structures and their cellular responses to VEGF-A were blunted. Thus, our studies demonstrate specific temporal and spatial requirements of NFAT signaling for coronary vessel angiogenesis. These requirements are distinct from the roles of NFAT signaling in the angiogenesis of peripheral somatic vessels, providing an example of the environmental influence of different vascular beds on the in vivo endothelial responses to angiogenic stimuli.
Keywords: Calcineurin, NFAT, VEGF, endothelial cell, coronary vessel, heart development, Hedgehog
Development of the coronary vasculature is a unique process during embryogenesis (Reese et al., 2002). Early coronary vessels develop through vasculogenesis as angioblasts coalesce to form a primitive vascular plexus on the surface of developing hearts (Kattan et al., 2004; Perez-Pomares et al., 2002; Tomanek et al., 2002; Tomanek et al., 1999; Tomanek and Zheng, 2002; Tomanek et al., 2001; Yue and Tomanek, 2001). The final growth of the coronary tree occurs by angiogenesis as new capillaries extend from these pre-formed blood vessels (Tomanek et al., 2001; Yue and Tomanek, 2001). Later, these endothelial channels remodel and evolve into mature coronary vessels as smooth muscle cells and fibroblasts are recruited to the vessel wall. Smooth muscle cells and fibroblasts in the coronaries derive from epicardial cells through a process of epicardial-to-mesenchymal transformation (Lu et al., 2001; Wada et al., 2003) and subsequent differentiation within the myocardium. Signals from epicardial and myocardial cells are thus critical for the formation of a mature coronary vasculature. Mice having mutations in certain genes that are expressed in epicardial or myocardial cells, such as Wt1 (Moore et al., 1998), FOG-2 (Tevosian et al., 2000), GATA-4 (Crispino et al., 2001), Bves (Wada et al., 2001) among others, have impaired coronary vessel development, indicating a close interaction of myocardial and epicardially-derived cells with endothelial cells to regulate coronary formation.
Endothelial cells play a central role in coronary and peripheral vascular patterning. Multiple cell surface receptors and their ligands have been shown to regulate endothelial cell differentiation, vasculogenesis and angiogenesis (Carmeliet, 2000; Yancopoulos et al., 1998). Most of the receptors involved in vascular development, such as VEGF-R2/Flk-1 (Shalaby et al., 1995), VEGF-R1/Flt-1 (Fong et al., 1995) and VEGF-R3/Flt-4 (Dumont et al., 1998), are tyrosine kinases that activate MAP kinase cascades and Ca2+ signaling. Ca2+ signals can lead to the activation of calcineurin, a Ca2+/calmodulin-dependent serine-threonine phosphatase composed of catalytic (CnA) and regulatory B (CnB) subunits (Klee et al., 1998). Calcineurin activation results in rapid dephosphorylation of NFATc proteins (c1 to c4), causing them to translocate into the nucleus (Beals et al., 1997a; Clipstone and Crabtree, 1992; Crabtree, 1989; Crabtree and Olson, 2002; Flanagan et al., 1991). Once in the nucleus, NFATc proteins cooperate with nuclear partners (NFATn) to form NFAT transcriptional complexes on target genes (Crabtree, 1989; Flanagan et al., 1991). The NFAT pathway is opposed by Dyrk1a and GSK3 kinases, which act sequentially to actively export NFATc proteins from the nucleus (Arron et al., 2006; Beals et al., 1997b). A second level of opposition to the pathway occurs through inhibitors of calcineurin, such as DSCR1 (RCn1, calcipressin1 or MCIP1) (Gorlach et al., 2000; Kingsbury and Cunningham, 2000; Rothermel et al., 2001). Furthermore, the activity of calcineurin and NFATc function can be specifically blocked by the immunosuppressive drugs cyclosporine A (CsA) and FK506 (Emmel et al., 1989; Liu et al., 1991). Although biochemical studies have suggested that calcineurin has many substrates (Aperia et al., 1992), genetic studies indicate that calcineurin is rather dedicated to NFATc proteins during early embryonic development (Chang et al., 2004; de la Pompa et al., 1998; Graef et al., 2001; Graef et al., 2003; Ranger et al., 1998; Wu et al., 2007).
Calcineurin-NFAT signaling has been shown to regulate important processes during cardiovascular development, including heart valve morphogenesis (Chang et al., 2004; de la Pompa et al., 1998; Ranger et al., 1998), myocardial development (Bushdid et al., 2003; Chang et al., 2004; Schubert et al., 2003) and peripheral vascular patterning (Graef et al., 2001). Mice with NFATc3/c4 or Cnb1 mutation exhibit excessive vessel growth into normally avascular tissues and a failure to form mature vessels, leading to embryonic lethality at E11.5 (Graef et al., 2001). These peripheral vascular defects are caused by excessive production of vascular endothelial growth factor A (VEGF-A) by peri-vascular tissues, a result of the de-repression of VEGF-A expression due to lack of calcineurin or NFATc3/c4 (Chang et al., 2004; Graef et al., 2001). Despite the importance of NFAT signaling in peripheral vessel angiogenesis, its role in coronary vascular formation is unknown as Cnb1-or NFATc2/c4-null embryos die at E11.5 before the formation of coronary vessels. To overcome the early lethality of Cnb1-null mice, we have used pharmacological inhibition and tissue-specific disruption of calcineurin function to define the temporal and spatial requirements of calcineurin-NFAT during coronary angiogenesis. Our studies demonstrate that NFAT signaling regulates coronary angiogenesis by a mechanism distinct from its roles in the peripheral somatic vasculature, and provide a model to understand the interactions between endothelial cells and peri-vascular tissues in the angiogenic process of different vascular beds.
Mice
All mouse strains were maintained in outbred backgrounds. The Cnb1F (Neilson et al., 2004), Tie2Cre (Kisanuki et al., 2001), Sm22αCre (Holtwick et al., 2002; Stankunas et al., 2008), and Gata5Cre (Merki et al., 2005) strains are previously described. The date of observing a vaginal plug was set as E0.5, and embryonic development was confirmed by ultrasonography before sacrificing pregnant mice (Chang et al., 2003).
Cyclosporine treatment
Pregnant females were injected with cyclosporine A (CsA) during the time windows indicated in Figure 2D. CsA was administered at a dose of 50 mg/kg through intraperitoneal injection twice a day at 9–10 am and at 7–8 pm. Embryos were harvested at E11.5 or E12.5 for PECAM whole mount staining. Control females were injected with phosphate buffered saline (PBS) at the same time points.
Fig. 2
Fig. 2
Calcineurin inhibition leads to abnormal coronary angiogenesis
Whole mount staining
Pecam1 whole mount staining was performed in whole embryos or embryonic hearts as described previously (Graef et al., 2001; Stankunas et al., 2008). These tissues were stained with 1:100 anti-Pecam1 antibody (Pharmingen). A donkey anti-rat HRP-conjugated secondary antibody was used for detection of the signal with DAB substrate. Tissues were postfixed in 4% PFA, imaged under a Leica dissecting microscope, and then processed for sectioning. Paraffin sections were counterstained with nuclear fast red and imaged using a Nikon microscope.
Immunohistochemistry
For Ki67 and calcineurin immunostaining paraffin sections were deparaffinized and treated with 3% hydrogen peroxide. Citrate (Ki67) or trypsin (calcineurin) antigen retrieval was followed by overnight incubation with anti-Ki67 (DAKO, Denmark) or anti-calcineurin (Sigma, Saint Louis, MO) antibodies. HRP-conjugated secondary antibodies were used for detection of the signal with DAB substrate. TUNEL assay was performed according to manufacturer’s guidelines (Roche).
For frozen sections, embryos were fixed in PFA 4% for 1h at 4°C and then cryoprotected in sucrose 30% overnight at 4°C. The embryos were then embedded in OCT compound and kept at −20°C until sectioning in a Leica cryostat. Tissue was permeabilized with Triton 0.3% in PBS, blocked with 5% normal goat serum and incubated with the antibodies overnight at 4°C (anti-Pecam1 from Chemicon and anti-Pdgfrb from eBioscience). Jackson fluorescent secondary antibodies were used for detection of the signal.
RNA in situ hybridization
This procedure was performed as described previously (Stankunas et al., 2008). Digoxigenin-labeled antisense transcripts were synthesized (Roche) from plasmid templates: NFATc1 (de la Pompa et al., 1998), NFATc2 (Open Biosystems, Huntsville, AL), NFATc3 and NFATc4 (Graef et al., 2001; Graef et al., 1999) and VEGF-A (Chang et al., 2004).
Quantification of ventricular surface covered by endothelial tubes
Total ventricular area and area covered by the coronary endothelial bed were measured using the NIS-Elements program. The ratio between the surface covered by endothelial cells and total ventricular surface in control embryonic hearts was set at 100% for comparison. This ratio in CsA-treated embryos or different mutant embryos was calculated as a percentage of the value in control littermates.
Cell culture and proliferation studies
Human umbilical vein endothelial cells (HUVECs) and human coronary artery endothelial cells (HCAEC) were obtained from Cambrex, NJ and grown in endothelial growth media from Lonza, MD (EGM-2 containing hEGF, hydrocortisone, GA-1000 (Gentamicin, Amphotericin-B), fetal bovine serum (FBS), VEGF, hFGF-B, R3-IGF-1, ascorbic acid and heparin). H5V mouse endothelial cells (Garlanda et al., 1994) were grown in M-199 medium with 10% FBS and penicillin-streptomycin. SVR40 mouse endothelial cells were grown in DMEM with 10% FBS and penicillin-streptomycin. Cell proliferation studies were performed in growing HUVEC cells pulsed with 10 μM BrdU for 6h or 24h. Cells were stained for BrdU using a BrdU Kit, following the manufacturer’s instructions (ZYMED, CA). Positive labelled cells were counted and referred as a percentage of the total number of cells analyzed.
Matrigel tube formation assay
24-well dishes were coated with matrigel (BD Pharmingen) and incubated at 37°C for 20 min followed by seeding with HUVEC, HCAEC or H5V cells in 1ml of complete medium at 50,000 cells/ml. Recombinant VEGF (100ng/ml) was added when cells were plated on matrigel. CsA (100ng/ml) was added at the same time of seeding the cells on the matrigel, or at different times after plating on the gels. Tube formation was assessed 24h after plating the cells on the matrigel. Quantitation of tubular structures was performed by manual counting of tubes using light microscopy. Tube-like structures forming in untreated control cells was considered 100%, and the percentage of tube formation under other treatments was calculated relative to the control. Standard two-tailed Student t-test was used for statistical analysis.
Quantitative RT-PCR
HUVECs and HCAECs were cultured on multiwells or matrigel coated multiwells. RNA extraction was performed using Trizol (Invitrogen) and 150 ng of purified RNA were used as a template to synthesize cDNA using the Superscript III reverse transcription system (Invitrogen). PCR was performed using the following primer sequences (all 5’ to 3’) for HUVEC and HCAEC cells: ESM1-F: GCTGAGGTGTCAGCCTTCTAAT, ESM1-R: CAGGTCTCTCTGCAATCCA T C, C D H 5-F: GGCTAGGCATAGCATTGGATAC, CDH5-R: GGCCTCCACAGTCAGGTTATAC, ENG-F: AAACAGTCCATTGTGACCTTCA, ENG-R: TTTACACTGAGGACCAGAAGCA, BMPR2-F: GGAAAGGATGGCTGAACTTATG, BMPR2-R: CGATGCTGTCAGTATGATGGAT, TIE2-F: ATGGACTCTTTAGCCGGCTTA, TIE2-R: CCTTATAGCCTGTCCTCGAA, FLT1-F: AGCACTACACATGGAGCCTAAGA, FLT1-R: GTAGAAACCGTCAGAATCCTCCT, KDR-F: GTTAGTGACCAACATGGAGTCGT, KDR-R: GCTGATCATGTAGCTGGGAATAG, , hHPRT-F: CTGAGGATTTGGAAAGGGTGT, hHPRT-R: CTTGAGCACACAGAGGGCTAC. A Bio-Rad iCycler was used for quantitative analysis. The primer sets were first validated for use in quantitative PCR according to parameters recommended in a Technical Note from Stratagene, “Standard Curves in Real-Time Quantitative PCR”, using HUVEC or HCAEC cDNA as a template. Mean threshold cycles were determined for 3 repeats of each reaction using 3 control and 3 treated samples. The mean fold change in expression between the control and treated samples was calculated including correction for the efficiency of amplification of each primer set and normalization to HPRT levels.
Coronary vascular patterning during embryonic development
To observe the sequence of coronary vascular patterning, endothelial cell formation on the surface of the heart was analyzed in wildtype embryos at different developmental stages from E10.5 to E13.5. Pecam1 (platelet-endothelial cell adhesion molecule 1) (Baldwin et al., 1994) whole mount staining was performed on isolated embryonic hearts to analyze the nascent endothelial tube formation in vivo. At E10.5, a few Pecam1-positive cells were observed on the posterior surface of the heart (Fig. 1A). At E11.5, primitive, yet unrefined, endothelial network or patches were observed in the atrioventricular junction (Fig. 1C). By E12.5, these endothelial tubes extended from the atrioventricular junction inferiorly and laterally to the apical and lateral regions of the ventricles, forming a more elaborate vascular network (Fig. 1E) that began to encroach upon the anterior surface of the heart (Fig. 1F). By E13.5, many endothelial tubes had coalesced to form more distinct vascular pattern in the posterior surface (Fig. 1G). Endothelial tubes became apparent at the lateral border of the heart, and a number of endothelial nodules appeared on the anterior surface of the heart (Fig. 1H). This sequence of events suggests that cells at the distal end of endothelial tubes proliferate to expand the vascular formation or new endothelial cells are recruited to keep the progression of vascular network. Retroviral cell tagging studies of chick hearts suggest that coronary vessels grow discontinuously by recruiting and coalescing new endothelial cells (Mikawa and Fischman, 1992).
Fig. 1
Fig. 1
Vascular patterning of the coronaries during embryonic development
Calcineurin inhibition leads to abnormal coronary angiogenesis
To study the role of calcineurin-NFAT signaling in coronary vessel development, we used cyclosporine A (CsA) to inhibit calcineurin activity in embryos at different gestational ages. As we described previously, CsA effectively inhibits calcineurin activity in embryos within 3 hours of administering to pregnant mice (Chang et al., 2004). Its level in embryos drops to the control background level within 24 hours after CsA treatment, providing precision of one developmental day to define the window of calcineurin-NFAT action.
Pregnant mice were treated with CsA (50 mg/kg, intraperitoneal injection, twice a day) starting from E9.5, E10.5 or E11.5, and embryos were harvested at E12.5 for analysis of coronary vasculature patterning. Embryos exposed to CsA in utero were grossly indistinguishable from untreated embryos at E12.5, regardless of the starting time of CsA treatment (Fig. 2A). Hearts from CsA-treated embryos were also similar in size to littermate controls (Fig. 2B, C), suggesting that there was no gross developmental delay at E12.5 with CsA treatment. Coronary vessel development was analyzed by Pecam1 whole mount staining of E12.5 hearts. E12.5 was chosen as the time point for analysis because embryos treated with CsA died at early E13 due to heart valve defects (Chang et al., 2004), precluding further examination of coronary development at or beyond E13. Pecam1 whole mount analysis showed an extensive network of coronary endothelial cells in untreated embryos at E12.5 whereas embryos exposed to CsA at E10.5 showed limited endothelial patterning (Fig. 2B, C). The endothelial tubes were fused and restricted to the atrioventricular junction, failing to form an elaborate endothelial network. In contrast, embryos exposed to CsA at E9.5–10.5 or E11.5–E12.5 displayed normal coronary endothelial patterning at E12.5 (Fig. 2D). Also, embryos exposed to CsA during these windows from E9.5 to E12.5 showed no endothelial patterning abnormalities in the peripheral vascular beds of cranial, intersomitic and dorsal regions of the embryo (data not shown), consistent with previous reports that calcineurin functions at E7.5–E8.5 to regulate peripheral angiogenesis (Graef et al., 2001). Taken together, these observations indicate a specific temporal requirement of calcineurin at E10.5 for normal coronary vessel development.
Calcineurin-NFAT signaling is not required in epicardial or myocardial cells for embryonic coronary angiogenesis
The next question becomes where the calcineurin-NFAT functions to regulate coronary development. Coronary development requires reciprocal signaling between neighboring cells or tissues that include epicardial, myocardial, vascular smooth muscle cells and endothelial cells. Since calcineurin is widely expressed in all these cells (Chang et al., 2004), calcineurin could function in any of these cell types to regulate coronary vessel formation. To determine the cellular site of calcineurin action during coronary angiogenesis, we performed tissue-specific gene deletion of the calcineurin regulatory subunit (Cnb1) using the murine cre-lox genetic method.
To study the roles of calcineurin in epicardial or myocardial cells for coronary vascular patterning, we deleted Cnb1 in epicardial and myocardial cells, using Gata5Cre and SM22αCre mouse lines, respectively. The Gata5 promoter in Gata5Cre mouse line directs the expression of Cre recombinase to epicardial cells (Merki et al., 2005), which give rise to vascular smooth muscle cells of coronary vessels (Mikawa and Fischman, 1992; Mikawa and Gourdie, 1996; Perez-Pomares et al., 2002). The Gata5Cre activity is evident by E9.25 in the proepicardial cells, and by E9.5–E10.0 in the epicardial cells (Merki et al., 2005). Epicardial-restricted Cnb1 mutant mice (Gata5Cre;Cnb1F/F) were grossly normal (Fig. 3A) and displayed no defects in endothelial patterning at E12.5 by whole mount Pecam1 staining (Fig. 3B, C). Furthermore, Gata5Cre;Cnb1F/F mice lived to adulthood, and they were indistinguishable from their wildtype littermates at birth (data not shown). This observation indicates that calcineurin in epicardial or in epicardially-derived cells is not required for coronary vessel formation.
Fig. 3
Fig. 3
Calcineurin-NFAT signaling is not required in epicardial cells or myocardial cells for coronary vessel patterning
To study the role of calcineurin in the myocardial cells during coronary development, we used SM22αCre mouse line to delete Cnb1 in myocardial cells (Fig. 3D). Cre-recombinase driven by the SM22α promoter is active in both vascular smooth muscle cells and myocardial cells. The SM22αCre expression in myocardial cells occurs as early as E9.0 as described previously (Stankunas et al., 2008; Umans et al., 2007) SM22αCre;Cnb1F/F embryos were grossly normal (Fig. 3D) and showed normal coronary endothelial patterning at E12.5 (Fig. 3E, F). Sm22αCre;Cnb1F/F mice also lived to adulthood with no evidence of coronary patterning defects at birth (data not shown). These findings indicate that calcineurin is not essential in myocardial or vascular smooth muscle cells for coronary angiogenesis.
To verify the deletion of Cnb1 from epicardial and myocardial cells, we performed calcineurin immunostaining in Gata5Cre;Cnb1F/F and Sm22αCre;Cnb1F/F embryos. We found that calcineurin was indeed removed from proepicardial cells of Gata5Cre;Cnb1F/F embryos by E9.5 (Fig. 3G, H) and from myocardial cells of Sm22αCre;Cnb1F/F embryos by E10.5 (Fig. 3I, J) before the critical window when calcineurin was required for coronary angiogenesis (Fig. 2D). These observations thus validate the conclusion that calcineurin does not function in epicardial, myocardial or vascular smooth muscle cells to regulate early coronary development.
Endothelial calcineurin-NFAT signaling is essential for coronary vascular patterning
To examine endothelial calcineurin function, we used a Tie2Cre mouse line to direct the deletion of Cnb1 in endothelial cells (Chang et al., 2004; Kisanuki et al., 2001). As we reported previously, this Tie2Cre activity is detectable in endothelial cells by E8.0, and calcineurin is deleted in endocardial cells by E9.5 (Chang et al., 2004). Tie2Cre;Cnb1F/F embryos showed no gross developmental defects compared to their wildtype littermates at E12.5 (Fig. 4A). The Pecam1 whole mount staining of Tie2Cre;Cnb1F/F hearts at E12.5 showed limited endothelial branching in contrast to an extensive network of endothelial tubes of the littermate control (Fig. 4B, C). Coronary endothelial cells in Tie2Cre;Cnb1F/F hearts were fused and limited to the atrioventricular junction. These cells were unable to extend apically or laterally in the heart (Fig. 4C). Histological sections of the wildtype hearts showed that Pecam1-positive endothelial cells assembled to form tubes that extended to the lateral and apical parts of the heart, whereas in the Tie2Cre;Cnb1F/F hearts Pecam1-positive cells were limited to the basal portion of the ventricles with no endothelial cells reaching the apical region of the heart (Fig. 4D). These endothelial patterning defects in Tie2Cre;Cnb1F/F embryos phenocopy the defects observed in CsA-treated embryos (Fig. 2C). Combined with the data obtained from mice lacking Cnb1 in epicardial and myocardial cells, these findings demonstrate that calcineurin is specifically required in endothelial cells to regulate endothelial assembly in early coronary vascular development.
Fig. 4
Fig. 4
Endothelial Calcineurin-NFAT signaling is required for normal coronary vessel patterning
The next question became whether endothelial calcineurin is also required for peripheral vascular patterning in developing embryos. We performed Pecam1 whole mount immunostaining of embryos at E10.5 and E11.5, and observed no significant differences in the peripheral vasculature between wildtype and Tie2Cre;Cnb1F/F embryos. Cranial, intersomitic and dorsal vessels of Tie2Cre;Cnb1F/F mutant embryos appeared normal (Fig. 4E, F). Of note, these Tie2Cre;Cnb1F/F embryos died at E13 due to heart valve defects, consistent with previous reports (Fig. 4G) (Chang et al., 2004). These studies suggest that calcineurin in endothelial cells is not essential for peripheral vascular patterning. The differential effects of endothelial calcineurin in coronary versus peripheral vascular development suggest that distinct mechanisms are involved in the development of these two vascular beds.
We next examined whether NFATc genes were expressed in coronary endothelial cells at E12.5 when they first became easily detectable (Fig. 1). By RNA in situ hybridization, we found that NFATc3 and NFATc4, but not NFATc1 or NFATc2, were expressed in coronary endothelial cells (Fig. 4H, I, J, K), suggesting that endothelial NFATc3 and NFATc4 are activated by calcineurin to transduce the signals required for coronary angiogenesis.
To determine the extent of the coronary vasculature defects observed at E12.5 in CsA-treated embryos or in the different genetic models, we measured the percentage of surface area of the ventricles covered by the endothelial network marked by Pecam1 staining (Fig. 5A). We found that CsA treatment resulted in a diminished endothelial network compared to that of the control embryos (42.2±5.7 % vs. 100±13.4 %; p<0.01) (Fig. 5B). In contrast, coronary endothelial network was not impaired in embryos lacking either epicardial (Gata5Cre;Cnb1F/F) or myocardial (Sm22αCre;Cnb1F/F) Cnb1 (Fig. 5B). However, in embryos lacking endothelial Cnb1 (Tie2Cre;Cnb1F/F), the endothelial defects occurred to a similar extent to those caused by CsA treatment (40.6±3.8 %), indicating that the primary effects of CsA treatment on coronary angiogenesis were mediated through endothelial calcineurin.
Fig. 5
Fig. 5
Quantitation of the coronary endothelial network formation and recruitment of perivascular supporting cells
Next we asked whether the Cnb1-null endothelial cells were capable of recruiting pericytes to form a vessel wall. We analyzed the expression of a marker of pericytes, Pdgfrb, to assess the assembly of endothelial cells and pericytes in Tie2Cre;Cnb1F/F embryos. By co-immunostaining of Pecam1 (to mark endothelial cells) and Pdgfrb (to mark pericytes), we observed that pericytes were recruited normally to the remaining coronary endothelial cells of Tie2Cre;Cnb1F/F embryos by E12.5 (Fig. 5C, D). Similarly, recruitment of pericytes to endothelial cells occurred normally in the peripheral vessels of Tie2Cre;Cnb1F/F embryos (Fig. 5E, F). Together with previous reports showing that calcineurin-NFATc3/c4 is essential for endothelial-pericyte assembly in the cranial and somatic vasculature (Graef et al., 2001), our observations indicate that vessel wall formation of the peripheral vasculature is regulated by the non-endothelial or peri-vascular functions of calcineurin-NFAT. This is in contrast to the pericyte recruitment in the coronary vascular beds as the peri-endothelial tissues lacking Cnb1 in smooth muscle cells and myocardium of Sm22αCre;Cnb1F/F embryos had no effects on pericyte/smooth muscle cell recruitment of coronary vessels (data not shown). Unfortunately, vascular smooth muscle cell recruitment to coronary vessels of Tie2Cre;Cnb1F/F embryos could not be examined since these cells had not yet been recruited to the endothelial tubes before Tie2Cre;Cnb1F/F embryos died by early E13 (Fig. 4G and data not shown) (Mikawa and Gourdie, 1996).
Calcineurin contributes to the initiation of endothelial cells to undergo tubular formation
To understand the cellular defects underlying the coronary phenotype observed in the Tie2Cre;Cnb1F/F mutants, we first examined the effects of calcineurin inactivation on the proliferation and cell death of endothelilal cells. By Ki67 staining, we found no difference in the percentage of coronary endothelial cells in cell cycle between wildtype and mutant embryos at E12.5 (Supplemental Fig. 1A, B). Neither was there significant apoptotic cell death in these embryos as shown by TUNEL staining (Supplemental Fig. 1C, D). Furthermore, human umbilical venous endothelial cells (HUVECs) treated with CsA did not show any significant difference in the BrdU incorporation rate compared with untreated cells. TUNEL assay showed no significant increase in cell death in HUVEC cells in the presence of CsA. Also, there was no difference in the cell number of HUVECs in the presence of CsA (data not shown). These findings suggest that calcineurin does not inhibit endothelial vascular network formation by reducing proliferation or inducing apoptosis of endothelial cells.
Previous studies suggest that calcineurin is required for endothelial cells to form tubular strutures on matrigel cultures (Hernandez et al., 2001; Rafiee et al., 2004). Endothelial cells, when cultured on matrigel, spontaneously aggregate and assemble into multicellular capillary-like tubular structures (Folkman and Haudenschild, 1980; Grant et al., 1991), recapitulating many aspects of angiogenesis, including cellular migration, differentiation and metalloproteinase activation. However, it is not known whether there is a specific temporal requirement of calcineurin function for that process similar to what we have observed in coronary angiogenesis in developing embryos.
To determine the temporal requirement for calcineurin function in endothelial tube formation, we used CsA to treat HUVECs on matrigel coated plates, starting at different time points in the presence or absence of additional VEGF-A treatment within a 24-hour observation period. HUVEC cells assembled into tube-like structures on the matrigel (Fig. 6A), a process that was increased by 30% in the presence of VEGF-A (Fig. 6B, I). When CsA was administered at the time of plating the cells or within the first 6 hours of HUVEC culture, it significantly inhibited tube formation regardless of the presence of VEGF-A (Fig. 6C, D, I). CsA treatment inhibited tubular formation by 40% in VEGF-A treated cultures, thus offsetting the additional tubular formation due to VEGF-A treatment. Interestingly, many of the HUVECs exposed to CsA during this period aggregated to form large epithelial sheets on the matrigel (Fig. 6C, D), which were never observed in the control HUVECs (Fig. 6A, B). These epithelial sheets resembled the broad endothelial patches present in embryos treated with CsA (Fig. 2C) or lacking endothelial calcineurin (Fig. 4C). These observations suggest that HUVECs and embryonic coronary endothelial cells share similar cellular responses to CsA or calcineurin inhibition.
Fig. 6
Fig. 6
Calcineurin-NFAT signaling contributes to the initiation of endothelial tube formation
However, when CsA was added after the first 6 hours of HUVEC culture, CsA had no significant effect on HUVEC endothelial tube formation (Fig. 6E, F, I) within the 24-hour observation period, although there were some residual HUVEC epithelial patches. These findings indicate that calcieurin is required predominantly in the early phase of tubular transformation of HUVECs, consistent with a narrow temporal requirement of calcineurin in coronary angiogenesis (Fig. 2D). To further determine if an early, but narrow, window of CsA exposure was sufficient to inhibit endothelial tubular formation, we treated HUVECs with CsA for the first 6 hours in culture, washing off CsA, and then continued the culture for another 18 hours to assess the HUVEC tubular formation. We found that HUVECs pulsed with CsA for the first 6 hours exhibited 30–40% reduction in endothelial tubular formation, and these cells aggregated to form large epithelial sheets (either in the presence or absence of additional VEGF stimulation) (Fig. 6G, H), in contrast to HUVECs treated with CsA between the 6th and 24th hour in culture or HUVECs not exposed to CsA (Fig. 6E, F, A, B). The latter two experimetal groups showed no difference in endothelial tubular formation. A quantification of endothelial tubular formation in these experiments is represented on Figure 6I. Furthermore, FK506, another inhibitor of calcineurin activity, yielded similar results (data not shown). The reduction of endothelial tubular formation in HUVECs exposed to CsA in the first 6 hours was not caused by cell detachment from the matrigel since the culture supernatantat collected at the 7th and 24th hour of culture among all three experimental groups showed no difference in the number of detached cells (data not shown). Taken together, these findings indicate that calcineurin functions predominantly within the first 6 hours to transduce VEGF-A signaling and trigger endothelial tubular formation.
Similar temporal and cellular responses of endothelial tubular formation to CsA treatment were observed in two additional endothelial cells: human coronary artery endothelial cells (HCAEC, Cambrex, NJ) and mouse embryonic heart endothelial cells (H5V)(Garlanda et al., 1994) (Fig. 6J, K and Supplemental Fig. 2). Thus, these studies demonstrate a narrow time window in which calcineurin-NFAT signaling is required for VEGF-A to trigger endothelial tube formation, similar to the presence of a defined developmental window when endothelial calcineurin is required for coronary angiogenesis.
Calcineurin inhibition does not impair endothelial cell differentiation
To further test the differentiation of CsA-treated endothelial cells and to determine whether endothelial expression of certain angiogenic factors could be compromised in the presence of CsA, we did a survey and examined the expression of several endothelial differentiation and angiogenic factors in CsA-treated HUVECs and HCAECs by quantiative RT-PCR. Included in our survey were ESM-1 (endothelial specific marker1), a proteoglycan involved in endothelial cell adhesion and integrity (Aitkenhead et al., 2002); CDH5 (VE-Cadherin), involved in remodeling and maturation of endothelial cells (Carmeliet et al., 1999; Gory-Faure et al., 1999; Radice et al., 1997); ENG (endoglin), an accessory protein for the TGF-B receptor complex that promotes endothelial cell proliferation (Lebrin et al., 2004; Li et al., 1999); BMPR2 (bone morphogenetic protein receptor type-2), a receptor for BMPs, members of the TGF-β superfamily of ligands involved in endothelial cell proliferation and angiogenesis (Nakaoka et al., 1997; Zhao, 2003); TIE2 (angiopoietin-1 receptor), an endothelial receptor tyrosine kinase involved in angiogenesis (Mustonen and Alitalo, 1995); FLT1 and KDR, receptors of VEGF-A to mediate angiogenesis (Peters et al., 1993; Quinn et al., 1993)(Fig. 7A, B). By quantitative RT-PCR, we observed no significant changes of these factors expressed in CsA-treated endothelial cells, suggesting that calcineurin inhibition does not alter the differentiation of endothelial cells. Furthermore, embryos lacking endothelial Cnb1 (Tie2Cre;Cnb1F/F) had no significant changes of VEGF-A expression (Supplemental Fig. 3). Therefore, the blunted response of CsA-treated endothelial cells to VEGF-A was not due to mis-regulation of VEGF or VEGF receptor expression, but due to the absence of calcineurin activity to transduce VEGF-VEGFR signaling.
Fig. 7
Fig. 7
Models of the spatial and temporal actions of calcineurin-NFAT during cardiovascular development
NFAT signaling has a distinct role in coronary vascular formation
Previous studies have shown that calcineurin-NFATc3/c4 signaling prevents aberrant growth of peripheral vessels by repressing VEGF-A expression in peri-vascular tissues (Graef et al., 2001), an important mechanism to confine peripheral vessels within anatomic boundaries. In contrast to NFAT signaling in the peripheral vasculature, our current studies demonstrate distinct spatial, temporal and molecular mechanisms of calcineurin-NFAT signaling during coronary vascular development (Table 1). Calcineurin acts in different tissues (peri-vascular vs endothelial cells), at different time windows (E7.5–8.5 vs E10.5–11.5) and through a different mechanism (repressing VEGF-A expression vs facilitating endothelial response to VEGF-A) to regulate peripheral and coronary vascular patterning.
Table 1
Table 1
Models of distinct in vivo actions of calcineurin-NFAT signaling during the development of peripheral versus coronary vasculature.
The specificity of VEGF isoforms and the spatiotemporal distribution of VEGF are critical for proper coronary vascular development. Mice expressing solely VEGF120 showed an impairment in coronary arterial-venous differentiation (van den Akker et al., 2008). Ablation of smoothened (transducer of hedgehog signaling) in myocardial or peri-vascular cells in mice resulted in an arrest of coronary vessel formation due to reduced expression of VEGF ligands (Lavine et al., 2008; Lavine and Ornitz, 2009). In view that VEGF signaling is transduced by endothelial calcineurin-NFAT during coronary angiogenesis (current study), we propose a model in which epicardial sonic hedgehog (Shh) signals myocardial or peri-vascular cells to produce different VEGF ligands that activate calcineurin and NFAT signaling in endothelial cells to control coronary vessel development (Fig. 7C). This model provides a framework for future studies of the signaling interactions between endothelial cells and their environment during coronary development. Further investigations of how hedgehog signals are initiated, how different VEGF ligands activate calcineurin-NFAT, and what molecules NFAT transduces the signals to will be critical for understanding the development of coronary vasculature.
Calcineurin-NFAT contributes to the programming of endothelial cells to form endothelial tubes
We show that calcineurin provides an early signal directing endothelial angiogenesis in an in vitro matrigel culture model. Inhibition of calcineurin at an early, but not later, stage of HUVEC, HCAEC and H5V cells matrigel cultures results in failure of endothelial network formation. Once endothelial cells begin to form tubular networks, calcineurin is no longer required in this patterning process. Since calcineurin is dispensable for endothelial cell proliferation, survival and differentiation, these studies suggest that calcineurin-NFAT signaling is crucial for the initial programming of endothelial cells to undergo morphogenetic changes and form vascular network, consistent with previous observations that NFAT is required for the initiation of pathological angiogenesis by VEGF-A (Hernandez et al., 2001). These findings also provide a cellular basis for the presence of a critical developmental window within which calcineurin acts to initiate the formation of coronary endothelial network.
Specific temporal and spatial requirements of calcineurin-NFAT signaling during cardiovascular development
The temporal and spatial expression of calcineurin-NFAT signaling is tightly regulated during embryogenesis (Chang et al., 2004; de la Pompa et al., 1998; Graef et al., 2001; Schubert et al., 2003). NFAT signaling functions within narrow developmental windows and in specific tissues to regulate distinct processes of cardiovascular development (Fig. 7D). NFATc3/c4 signaling is required in peri-vascular tissues at E7.5–E8.5 to control the patterning of peripheral vasculature in developing embryos (Graef et al., 2001). At E9.5, NFATc2/3/4 represses VEGF-A expression in cushion myocardium to initiate endocardial-to-mesenchymal transformation (EMT) and heart valve morphogenesis (Chang et al., 2004). Later at E11.5, NFATc1 signaling functions in cushion endocardial cells to direct heart valve elongation and maturation (Chang et al., 2004; de la Pompa et al., 1998; Ranger et al., 1998). Furthermore, NFAT signaling is required for the development of atrial myocardium from E14.5 until birth (Schubert et al., 2003). Our current study defines a new role of calcineurin-NFAT signaling in cardiovascular development. NFAT signals in endothelial cells at E10.5 to regulate the development of coronary vasculature, further demonstrating a tight temporal and spatial control of calcineurin-NFAT signaling during development.
Implications of the temporal and spatial NFAT signaling in cardiovascular development
The temporal actions of calcineurin-NFAT signaling suggest that NFAT is critical for the initiation of cardiovascular morphogenesis. NFAT signals occur 1–2 days before the morphological changes of specific cardiovascular tissues take place in development (Fig. 7D). Interestingly, NFAT is not required for sustaining these developmental processes once they are initiated. During heart valve morphogenesis, for example, NFAT signaling initiates EMT in the endocardial cushion, but it is not necessary for the completion of the EMT process, a phenomenon observed in both zebrafish and mice (Beis et al., 2005; Chang et al., 2004). Also, after NFAT triggers the elongation of heart valves, the continuation of valve elongation and maturation does not depend on NFAT signaling (Chang et al., 2004). Similarly, calcineurin-NFAT signaling functions at the initial, but not later phase of coronary angiogenesis (current study). These restricted temporal functions of NFAT signaling support the notion that a major function of the NFAT pathway resides in the initiation, but not sustaining, of specific developmental processes. This model implicates that NFAT signaling triggers precursor cells to undertake the morphogenetic path that leads to tissue formation.
The spatial patterns of NFAT signaling in development demonstrate that the initiation and control of tissue morphogenesis are accomplished by NFAT either cell-autonomously or non-cell-autonomously. For instance, NFAT functions within endothelial cells to activate their tubular transformation (current study); however, the mesenchymal transformation of endocardial cells requires NFAT activity in the neighboring myocardium (Chang et al., 2004). NFAT signaling thus operates in the target cells or their surrounding environment to control the target cell differentiation and tissue morphogenesis.
The temporal and spatial patterns of NFAT signaling could be defined by multiple control mechanisms of the calcineurin-NFAT pathway during development. First, the activation of calcineurin could be determined by specific cell surface receptors that only respond to morphogenetic signals in particular tissues and at distinct time windows. Second, the distribution of the NFAT activity could be established by developmental cues that trigger the expression or activation of the NFATn component of NFAT transcriptional complexes. Third, developmental signals may regulate the activity of other modulators of NFAT signaling, such as GSK3, DSCR1 and Dyrk1a (Arron et al., 2006; Beals et al., 1997b; Gorlach et al., 2000; Kingsbury and Cunningham, 2000; Rothermel et al., 2001; Wu et al., 2007), to control the pattern of NFAT activity. These regulatory mechanisms are not mutually exclusive. Indeed, a combinatorial regulation of NFAT signaling at multiple levels may provide a sophisticated means to orchestrate the diverse and complex morphogenetic processes that occur over a wide range of tissues and developmental windows.
Supplementary Material
Acknowledgments
We thank K. Zhang for technical assistance. We are indebted to Dr. P. Ruiz-Lozano for providing the Gata5Cre mice, and to Dr. Isabella Graef for advice. C.P.C. was supported by funds from the National Heart Lung and Blood Institute (NHLBI)(HL085345), American Heart Association (AHA)(0535239N), Children’s Heart Foundation, March of Dimes Birth Defects Foundation, and Office of the University of California (TRDRP). M.Z. was supported by a Stanford Dean’s fellowship, and a Marie Curie Outgoing International fellowship; C.T.H by an AHA predoctoral fellowship and a NIH training fellowship (5T32 CA09302); J.L.G. by an NHLBI vascular medicine training fellowship (T32 HL007708); T.D. by a Stanford Bio-X fellowship and by a Stanford VPUE Faculty Grant for Undergraduate Research; B.Z. by a NHLBI grant (HL078881).
  • Aitkenhead M, Wang SJ, Nakatsu MN, Mestas J, Heard C, Hughes CC. Identification of endothelial cell genes expressed in an in vitro model of angiogenesis: induction of ESM-1, (beta)ig-h3, and NrCAM. Microvasc Res. 2002;63:159–71. [PubMed]
  • Aperia A, Ibarra F, Svensson LB, Klee C, Greengard P. Calcineurin mediates alpha-adrenergic stimulation of Na+, K(+)-ATPase activity in renal tubule cells. Proc Natl Acad Sci U S A. 1992;89:7394–7. [PubMed]
  • Arron JR, Winslow MM, Polleri A, Chang CP, Wu H, Gao X, Neilson JR, Chen L, Heit JJ, Kim SK, et al. NFAT dysregulation by increased dosage of DSCR1 and DYRK1A on chromosome 21. Nature. 2006;441:595–600. [PubMed]
  • Baldwin HS, Shen HM, Yan HC, DeLisser HM, Chung A, Mickanin C, Trask T, Kirschbaum NE, Newman PJ, Albelda SM, et al. Platelet endothelial cell adhesion molecule-1 (PECAM-1/CD31): alternatively spliced, functionally distinct isoforms expressed during mammalian cardiovascular development. Development. 1994;120:2539–53. [PubMed]
  • Beals CR, Clipstone NA, Ho SN, Crabtree GR. Nuclear localization of NF-ATc by a calcineurin-dependent, cyclosporin-sensitive intramolecular interaction. Genes Dev. 1997a;11:824–34. [PubMed]
  • Beals CR, Sheridan CM, Turck CW, Gardner P, Crabtree GR. Nuclear export of NF-ATc enhanced by glycogen synthase kinase-3. Science. 1997b;275:1930–4. [PubMed]
  • Beis D, Bartman T, Jin SW, Scott IC, D’Amico LA, Ober EA, Verkade H, Frantsve J, Field HA, Wehman A, et al. Genetic and cellular analyses of zebrafish atrioventricular cushion and valve development. Development. 2005;132:4193–204. [PubMed]
  • Bushdid PB, Osinska H, Waclaw RR, Molkentin JD, Yutzey KE. NFATc3 and NFATc4 are required for cardiac development and mitochondrial function. Circ Res. 2003;92:1305–13. [PubMed]
  • Carmeliet P. Mechanisms of angiogenesis and arteriogenesis. Nat Med. 2000;6:389–95. [PubMed]
  • Carmeliet P, Lampugnani MG, Moons L, Breviario F, Compernolle V, Bono F, Balconi G, Spagnuolo R, Oosthuyse B, Dewerchin M, et al. Targeted deficiency or cytosolic truncation of the VE-cadherin gene in mice impairs VEGF-mediated endothelial survival and angiogenesis. Cell. 1999;98:147–57. [PubMed]
  • Chang CP, Chen L, Crabtree GR. Sonographic staging of the developmental status of mouse embryos in utero. Genesis. 2003;36:7–11. [PubMed]
  • Chang CP, Neilson JR, Bayle JH, Gestwicki JE, Kuo A, Stankunas K, Graef IA, Crabtree GR. A field of myocardial-endocardial NFAT signaling underlies heart valve morphogenesis. Cell. 2004;118:649–63. [PubMed]
  • Clipstone NA, Crabtree GR. Identification of calcineurin as a key signalling enzyme in T-lymphocyte activation. Nature. 1992;357:695–7. [PubMed]
  • Crabtree GR. Contingent genetic regulatory events in T lymphocyte activation. Science. 1989;243:355–61. [PubMed]
  • Crabtree GR, Olson EN. NFAT signaling: choreographing the social lives of cells. Cell. 2002;109(Suppl):S67–79. [PubMed]
  • Crispino JD, Lodish MB, Thurberg BL, Litovsky SH, Collins T, Molkentin JD, Orkin SH. Proper coronary vascular development and heart morphogenesis depend on interaction of GATA-4 with FOG cofactors. Genes Dev. 2001;15:839–44. [PubMed]
  • de la Pompa JL, Timmerman LA, Takimoto H, Yoshida H, Elia AJ, Samper E, Potter J, Wakeham A, Marengere L, Langille BL, et al. Role of the NF-ATc transcription factor in morphogenesis of cardiac valves and septum. Nature. 1998;392:182–6. [PubMed]
  • Dumont DJ, Jussila L, Taipale J, Lymboussaki A, Mustonen T, Pajusola K, Breitman M, Alitalo K. Cardiovascular failure in mouse embryos deficient in VEGF receptor-3. Science. 1998;282:946–9. [PubMed]
  • Emmel EA, Verweij CL, Durand DB, Higgins KM, Lacy E, Crabtree GR. Cyclosporin A specifically inhibits function of nuclear proteins involved in T cell activation. Science. 1989;246:1617–20. [PubMed]
  • Flanagan WM, Corthesy B, Bram RJ, Crabtree GR. Nuclear association of a T-cell transcription factor blocked by FK-506 and cyclosporin A. Nature. 1991;352:803–7. [PubMed]
  • Folkman J, Haudenschild C. Angiogenesis in vitro. Nature. 1980;288:551–6. [PubMed]
  • Fong GH, Rossant J, Gertsenstein M, Breitman ML. Role of the Flt-1 receptor tyrosine kinase in regulating the assembly of vascular endothelium. Nature. 1995;376:66–70. [PubMed]
  • Garlanda C, Parravicini C, Sironi M, De Rossi M, Wainstok de Calmanovici R, Carozzi F, Bussolino F, Colotta F, Mantovani A, Vecchi A. Progressive growth in immunodeficient mice and host cell recruitment by mouse endothelial cells transformed by polyoma middle-sized T antigen: implications for the pathogenesis of opportunistic vascular tumors. Proc Natl Acad Sci U S A. 1994;91:7291–5. [PubMed]
  • Gorlach J, Fox DS, Cutler NS, Cox GM, Perfect JR, Heitman J. Identification and characterization of a highly conserved calcineurin binding protein, CBP1/calcipressin, in Cryptococcus neoformans. Embo J. 2000;19:3618–29. [PubMed]
  • Gory-Faure S, Prandini MH, Pointu H, Roullot V, Pignot-Paintrand I, Vernet M, Huber P. Role of vascular endothelial-cadherin in vascular morphogenesis. Development. 1999;126:2093–102. [PubMed]
  • Graef IA, Chen F, Chen L, Kuo A, Crabtree GR. Signals transduced by Ca(2+)/calcineurin and NFATc3/c4 pattern the developing vasculature. Cell. 2001;105:863–75. [PubMed]
  • Graef IA, Mermelstein PG, Stankunas K, Neilson JR, Deisseroth K, Tsien RW, Crabtree GR. L-type calcium channels and GSK-3 regulate the activity of NF-ATc4 in hippocampal neurons. Nature. 1999;401:703–8. [PubMed]
  • Graef IA, Wang F, Charron F, Chen L, Neilson J, Tessier-Lavigne M, Crabtree GR. Neurotrophins and netrins require calcineurin/NFAT signaling to stimulate outgrowth of embryonic axons. Cell. 2003;113:657–70. [PubMed]
  • Grant DS, Lelkes PI, Fukuda K, Kleinman HK. Intracellular mechanisms involved in basement membrane induced blood vessel differentiation in vitro. In Vitro Cell Dev Biol. 1991;27A:327–36. [PubMed]
  • Hernandez GL, Volpert OV, Iniguez MA, Lorenzo E, Martinez-Martinez S, Grau R, Fresno M, Redondo JM. Selective inhibition of vascular endothelial growth factor-mediated angiogenesis by cyclosporin A: roles of the nuclear factor of activated T cells and cyclooxygenase 2. J Exp Med. 2001;193:607–20. [PMC free article] [PubMed]
  • Holtwick R, Gotthardt M, Skryabin B, Steinmetz M, Potthast R, Zetsche B, Hammer RE, Herz J, Kuhn M. Smooth muscle-selective deletion of guanylyl cyclase-A prevents the acute but not chronic effects of ANP on blood pressure. Proc Natl Acad Sci U S A. 2002;99:7142–7. [PubMed]
  • Kattan J, Dettman RW, Bristow J. Formation and remodeling of the coronary vascular bed in the embryonic avian heart. Dev Dyn. 2004;230:34–43. [PubMed]
  • Kingsbury TJ, Cunningham KW. A conserved family of calcineurin regulators. Genes Dev. 2000;14:1595–604. [PubMed]
  • Kisanuki YY, Hammer RE, Miyazaki J, Williams SC, Richardson JA, Yanagisawa M. Tie2-Cre transgenic mice: a new model for endothelial cell-lineage analysis in vivo. Dev Biol. 2001;230:230–42. [PubMed]
  • Klee CB, Ren H, Wang X. Regulation of the calmodulin-stimulated protein phosphatase, calcineurin. J Biol Chem. 1998;273:13367–70. [PubMed]
  • Lavine KJ, Long F, Choi K, Smith C, Ornitz DM. Hedgehog signaling to distinct cell types differentially regulates coronary artery and vein development. Development. 2008;135:3161–71. [PubMed]
  • Lavine KJ, Ornitz DM. Shared circuitry: developmental signaling cascades regulate both embryonic and adult coronary vasculature. Circ Res. 2009;104:159–69. [PMC free article] [PubMed]
  • Lebrin F, Goumans MJ, Jonker L, Carvalho RL, Valdimarsdottir G, Thorikay M, Mummery C, Arthur HM, ten Dijke P. Endoglin promotes endothelial cell proliferation and TGF-beta/ALK1 signal transduction. Embo J. 2004;23:4018–28. [PubMed]
  • Li DY, Sorensen LK, Brooke BS, Urness LD, Davis EC, Taylor DG, Boak BB, Wendel DP. Defective angiogenesis in mice lacking endoglin. Science. 1999;284:1534–7. [PubMed]
  • Liu J, Farmer JD, Jr, Lane WS, Friedman J, Weissman I, Schreiber SL. Calcineurin is a common target of cyclophilin-cyclosporin A and FKBP-FK506 complexes. Cell. 1991;66:807–15. [PubMed]
  • Lu J, Landerholm TE, Wei JS, Dong XR, Wu SP, Liu X, Nagata K, Inagaki M, Majesky MW. Coronary smooth muscle differentiation from proepicardial cells requires rhoA-mediated actin reorganization and p160 rho-kinase activity. Dev Biol. 2001;240:404–18. [PubMed]
  • Merki E, Zamora M, Raya A, Kawakami Y, Wang J, Zhang X, Burch J, Kubalak SW, Kaliman P, Belmonte JC, et al. Epicardial retinoid X receptor alpha is required for myocardial growth and coronary artery formation. Proc Natl Acad Sci U S A. 2005;102:18455–60. [PubMed]
  • Mikawa T, Fischman DA. Retroviral analysis of cardiac morphogenesis: discontinuous formation of coronary vessels. Proc Natl Acad Sci U S A. 1992;89:9504–8. [PubMed]
  • Mikawa T, Gourdie RG. Pericardial mesoderm generates a population of coronary smooth muscle cells migrating into the heart along with ingrowth of the epicardial organ. Dev Biol. 1996;174:221–32. [PubMed]
  • Moore AW, Schedl A, McInnes L, Doyle M, Hecksher-Sorensen J, Hastie ND. YAC transgenic analysis reveals Wilms’ tumour 1 gene activity in the proliferating coelomic epithelium, developing diaphragm and limb. Mech Dev. 1998;79:169–84. [PubMed]
  • Mustonen T, Alitalo K. Endothelial receptor tyrosine kinases involved in angiogenesis. J Cell Biol. 1995;129:895–8. [PMC free article] [PubMed]
  • Nakaoka T, Gonda K, Ogita T, Otawara-Hamamoto Y, Okabe F, Kira Y, Harii K, Miyazono K, Takuwa Y, Fujita T. Inhibition of rat vascular smooth muscle proliferation in vitro and in vivo by bone morphogenetic protein-2. J Clin Invest. 1997;100:2824–32. [PMC free article] [PubMed]
  • Neilson JR, Winslow MM, Hur EM, Crabtree GR. Calcineurin B1 is essential for positive but not negative selection during thymocyte development. Immunity. 2004;20:255–66. [PubMed]
  • Perez-Pomares JM, Carmona R, Gonzalez-Iriarte M, Atencia G, Wessels A, Munoz-Chapuli R. Origin of coronary endothelial cells from epicardial mesothelium in avian embryos. Int J Dev Biol. 2002;46:1005–13. [PubMed]
  • Peters KG, De Vries C, Williams LT. Vascular endothelial growth factor receptor expression during embryogenesis and tissue repair suggests a role in endothelial differentiation and blood vessel growth. Proc Natl Acad Sci U S A. 1993;90:8915–9. [PubMed]
  • Quinn TP, Peters KG, De Vries C, Ferrara N, Williams LT. Fetal liver kinase 1 is a receptor for vascular endothelial growth factor and is selectively expressed in vascular endothelium. Proc Natl Acad Sci U S A. 1993;90:7533–7. [PubMed]
  • Radice GL, Rayburn H, Matsunami H, Knudsen KA, Takeichi M, Hynes RO. Developmental defects in mouse embryos lacking N-cadherin. Dev Biol. 1997;181:64–78. [PubMed]
  • Rafiee P, Heidemann J, Ogawa H, Johnson NA, Fisher PJ, Li MS, Otterson MF, Johnson CP, Binion DG. Cyclosporin A differentially inhibits multiple steps in VEGF induced angiogenesis in human microvascular endothelial cells through altered intracellular signaling. Cell Commun Signal. 2004;2:3. [PMC free article] [PubMed]
  • Ranger AM, Grusby MJ, Hodge MR, Gravallese EM, de la Brousse FC, Hoey T, Mickanin C, Baldwin HS, Glimcher LH. The transcription factor NF-ATc is essential for cardiac valve formation. Nature. 1998;392:186–90. [PubMed]
  • Reese DE, Mikawa T, Bader DM. Development of the coronary vessel system. Circ Res. 2002;91:761–8. [PubMed]
  • Rothermel BA, McKinsey TA, Vega RB, Nicol RL, Mammen P, Yang J, Antos CL, Shelton JM, Bassel-Duby R, Olson EN, et al. Myocyte-enriched calcineurin-interacting protein, MCIP1, inhibits cardiac hypertrophy in vivo. Proc Natl Acad Sci U S A. 2001;98:3328–33. [PubMed]
  • Schubert W, Yang XY, Yang TT, Factor SM, Lisanti MP, Molkentin JD, Rincon M, Chow CW. Requirement of transcription factor NFAT in developing atrial myocardium. J Cell Biol. 2003;161:861–74. [PMC free article] [PubMed]
  • Shalaby F, Rossant J, Yamaguchi TP, Gertsenstein M, Wu XF, Breitman ML, Schuh AC. Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice. Nature. 1995;376:62–6. [PubMed]
  • Stankunas K, Hang CT, Tsun ZY, Chen H, Lee NV, Wu JI, Shang C, Bayle JH, Shou W, Iruela-Arispe ML, et al. Endocardial Brg1 represses ADAMTS1 to maintain the microenvironment for myocardial morphogenesis. Dev Cell. 2008;14:298–311. [PMC free article] [PubMed]
  • Tevosian SG, Deconinck AE, Tanaka M, Schinke M, Litovsky SH, Izumo S, Fujiwara Y, Orkin SH. FOG-2, a cofactor for GATA transcription factors, is essential for heart morphogenesis and development of coronary vessels from epicardium. Cell. 2000;101:729–39. [PubMed]
  • Tomanek RJ, Holifield JS, Reiter RS, Sandra A, Lin JJ. Role of VEGF family members and receptors in coronary vessel formation. Dev Dyn. 2002;225:233–40. [PubMed]
  • Tomanek RJ, Ratajska A, Kitten GT, Yue X, Sandra A. Vascular endothelial growth factor expression coincides with coronary vasculogenesis and angiogenesis. Dev Dyn. 1999;215:54–61. [PubMed]
  • Tomanek RJ, Zheng W. Role of growth factors in coronary morphogenesis. Tex Heart Inst J. 2002;29:250–4. [PMC free article] [PubMed]
  • Tomanek RJ, Zheng W, Peters KG, Lin P, Holifield JS, Suvarna PR. Multiple growth factors regulate coronary embryonic vasculogenesis. Dev Dyn. 2001;221:265–73. [PubMed]
  • Umans L, Cox L, Tjwa M, Bito V, Vermeire L, Laperre K, Sipido K, Moons L, Huylebroeck D, Zwijsen A. Inactivation of Smad5 in endothelial cells and smooth muscle cells demonstrates that Smad5 is required for cardiac homeostasis. Am J Pathol. 2007;170:1460–72. [PubMed]
  • van den Akker NM, Caolo V, Wisse LJ, Peters PP, Poelmann RE, Carmeliet P, Molin DG, Gittenberger-de Groot AC. Developmental coronary maturation is disturbed by aberrant cardiac vascular endothelial growth factor expression and Notch signalling. Cardiovasc Res. 2008;78:366–75. [PubMed]
  • Wada AM, Reese DE, Bader DM. Bves: prototype of a new class of cell adhesion molecules expressed during coronary artery development. Development. 2001;128:2085–93. [PubMed]
  • Wada AM, Willet SG, Bader D. Coronary vessel development: a unique form of vasculogenesis. Arterioscler Thromb Vasc Biol. 2003;23:2138–45. [PubMed]
  • Wu H, Kao SC, Barrientos T, Baldwin SH, Olson EN, Crabtree GR, Zhou B, Chang CP. Down syndrome critical region-1 is a transcriptional target of nuclear factor of activated T cells-c1 within the endocardium during heart development. J Biol Chem. 2007;282:30673–9. [PMC free article] [PubMed]
  • Yancopoulos GD, Klagsbrun M, Folkman J. Vasculogenesis, angiogenesis, and growth factors: ephrins enter the fray at the border. Cell. 1998;93:661–4. [PubMed]
  • Yue X, Tomanek RJ. Effects of VEGF(165) and VEGF(121) on vasculogenesis and angiogenesis in cultured embryonic quail hearts. Am J Physiol Heart Circ Physiol. 2001;280:H2240–7. [PubMed]
  • Zhao GQ. Consequences of knocking out BMP signaling in the mouse. Genesis. 2003;35:43–56. [PubMed]