PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Virology. Author manuscript; available in PMC 2009 September 3.
Published in final edited form as:
PMCID: PMC2737340
NIHMSID: NIHMS126356
A single amino acid change in the C-terminal domain of the matrix protein M1 of influenza B virus confers mouse adaptation and virulence
Jonathan A. McCullers, Erich Hoffmann, Victor C. Huber, and Asia D. Nickerson
Department of Infectious Diseases, St. Jude Children's Research Hospital, 332 North Lauderdale Street, Memphis, TN 38105−2794
Address correspondence to: Dr. Jonathan A. McCullers Department of Infectious Diseases St. Jude Children's Research Hospital 332 N. Lauderdale St. Memphis, TN 38105−2794 Phone: (901) 495−5164 FAX: (901) 495−3099 Email: jon.mccullers/at/stjude.org
Serial passage of an initially avirulent influenza B virus, B/Memphis/12/97, resulted in the selection of a variant which was lethal in mice. Virulence correlated with improved growth in vivo and prolonged replication. Sequencing of the complete coding regions of the parent and mouse adapted viruses revealed 8 amino acid differences. Sequencing and characterization of intermediate passages suggested that one change in the C-terminal domain of the M1 protein, an asparagine to a serine at position 221, was responsible for acquisition of virulence and lethality. Site directed mutagenesis of the M segment of a different virus, B/Yamanashi/166/98, to change this amino acid residue confirmed its importance by conferring improved growth and virulence in mice. This observation suggests a role for the C domain of the M1 protein in growth and virulence in a mammalian host.
Keywords: influenza B virus, mouse, adaptation, animal model, matrix protein, virulence, reverse genetics
Three types of influenza viruses exist, termed influenza A, B, and C viruses(Nicholson, 1998). Although both influenza A and B viruses are important in human disease, there are differences in their evolution and epidemiology(Yamashita, Krystal et al., 1988;McCullers, Wang et al., 1999). Influenza A viruses evolve by periodic antigenic shift taking genes from a large avian reservoir(Webster, Bean et al., 1992), as well as by constant antigenic drift(Webster, Laver et al., 1982;Fitch, Leiter et al., 1991) and reassortment among circulating human strains(Lindstrom, Hiromoto et al., 1998). Influenza B viruses also undergo antigenic drift(Krystal, Young et al., 1983;Air, Gibbs et al., 1990;McCullers, Saito et al., 2004) and reassortment(McCullers, Wang et al., 1999;Lindstrom, Hiromoto et al., 1999;McCullers, Saito et al., 2004), but do not have a nonhuman gene pool from which antigenic shift might occur. While the pandemic potential of influenza A viruses has made them natural targets for study, influenza B viruses have received less attention. One of the challenges facing such study is the lack of a good small animal model. Influenza B viruses are not natural pathogens of mice, and the few mouse adapted viruses available were generated by passage through animals such as ferrets and mice rather than by culture in eggs or tissue(Francis, 1940) and are only distantly related to the strains circulating today. There is interest in small animal vaccine challenge and drug treatment models for influenza B viruses. Mouse adaptation of a modern strain, identification of the responsible amino acid changes, and application of reverse genetics techniques to introduce these changes into other viruses, should allow better study of these viruses.
Mouse adaptation and the acquisition of virulence by passage in mouse lungs has been studied in influenza A viruses and is a pleiotropic process(Brown, Liu et al., 2001;Brown, 1990;Ward, 1997;Smirnov, Lipatov et al., 2000;Scheiblauer, Kendal et al., 1995;Scheiblauer, Kendal et al., 1995;Hartley, Reading et al., 1997;Ward, 1995;Gitelman, Kaverin et al., 1984;Govorkova, Gambaryan et al., 2000). Multiple gene changes occur, and it is unclear which are responsible for either adaptation or virulence. Most studies have focused on changes in either the hemagglutinin (HA)(Smirnov, Lipatov et al., 2000;Hartley, Reading et al., 1997;Gitelman, Kaverin et al., 1984;Rudneva, Kaverin et al., 1986;Kaverin, Finskaya et al., 1989;Frosner & Gerth, 1973;Smeenk & Brown, 1994;Brown, 1990;Smeenk, Wright et al., 1996;Govorkova, Gambaryan et al., 2000) or the matrix (M1)(Smeenk, Wright et al., 1996;Govorkova, Gambaryan et al., 2000;Smeenk & Brown, 1994;Ward, 1995) genes as determining factors. After successfully mouse adapting an influenza B virus, we wanted to determine the gene(s) responsible and compare our findings to published studies on influenza A virus. We expected to reap two benefits from these studies, obtaining targets for understanding the role of particular genes in the manifestation of disease, and identification of specific amino acids which might be altered by reverse genetics(Hoffmann, Mahmood et al., 2002) to confer mouse adaptation and / or virulence on influenza B viruses. We report here that a single amino acid change in the M1 gene of an influenza B virus conferred virulence and lethality during the adaptation process.
Growth characteristics of mouse adapted intermediates
Influenza virus B/Memphis/12/97 (Mem97) was passaged 15 times through mouse lungs until it was lethal in mice. Virus was amplified in MDCK cells between each lung passage, resulting in 15 initial virus stocks. Five viruses were selected for study, the parent virus Mem97 (M0), 3 intermediate passages (M3, M6, M9) and the 15th passage (MA). After plaque purification and preparation of virus stocks under identical conditions, we determined the growth characteristics of the viruses in MDCK cells. No significant differences could be observed in the peak viral titers of the viruses after 96 hours, although a trend towards higher growth for later passages was seen (Fig. 1A). No differences in growth curves were observed as measured by sequential reciprocal HA titers (Fig. 1B). Peak reciprocal HA titers were 256 to 512 for all viruses.
Fig. 1
Fig. 1
Growth of mouse adapted intermediates in MDCK cell culture. Viral titer was assayed at 96 hours (A) for parental virus (M0), 3rd (M3), 6th (M6), 9th (M9), and 15th (MA, mouse adapted) passages. Time course of infection (B) was assayed by measuring the (more ...)
Morbidity and mortality of mouse adapted intermediates in mice
Groups of 6 mice were administered 1 × 106 TCID50 of each of the 5 viruses intranasally and followed daily for weight loss. All mice were infected and exhibited clinical signs of influenza including decreased activity, huddling, hunched posture, and ruffled fur. Mice in the M0, M3, M6, and M9 groups could not be distinguished by visual inspection and recovered clinically after 2−3 days and resumed their normal activity. Mice in the MA group, however, grew progressively more ill with worsening clinical signs including labored breathing and tail cyanosis over the first 14 days before recovering slowly over an additional 7−10 days. Weight loss reflected this difference in morbidity between the MA group and the other 4 groups (Fig. 2A). Mice in the MA group lost weight progressively over the first 7−10 days and did not begin to recover until approximately 14 days post infection. Mortality could not be observed at any dose of the M0, M3, M6, and M9 viruses (up to a maximum dose of 1 × 107 TCID50), while the MLD50 of the MA virus was determined to be approximately 3 × 106 TCID50 and the virus was 100% lethal at a dose of 1 × 107 TCID50. The virus had similar virulence in C57Bl/6 mice (data not shown). These results indicate that changes which occurred between the 9th and 15th passages conferred virulence and lethality on the virus.
Fig. 2
Fig. 2
Virulence of mouse adapted intermediates in mice. Groups of 6 mice were infected with parental virus (M0), 3rd (M3), 6th (M6), 9th (M9), and 15th (MA, mouse adapted) passages and followed for daily for weight loss (A) as a measure of morbidity. Mice infected (more ...)
Viral growth in mouse lungs
Groups of 6 mice were infected with 1 × 106 TCID50 of each of the 5 viruses. Three mice from each group were sacrificed on days 3 and 7 post infection (p.i.) and viral titers were determined from their lungs. Virus could be recovered from the lungs of all mice at day 3 p.i., and viral titers were significantly higher in the MA infected group than in the M0, M3, and M6 groups (Fig. 2B). Virus was recovered at day 7 p.i. from all the lungs of MA infected mice at titers similar to those seen at day 3 p.i., while virus could only be recovered sporadically and at low titers from the other 4 groups at day 7 p.i. Virus could not be recovered from brain or blood at any dose of the MA virus (data not shown). Thus, the MA virus is better adapted to mouse lungs as evidenced by improved growth both at peak (day 3 p.i.) and late in infection (day 7 p.i.), although differences in peak viral titer between the M9 and M15 viruses were only seen at 7 days. These data suggest that the failure to clear the virus from the lungs is responsible for the increased virulence and lethality observed with the MA virus.
Differences in nucleotide and deduced amino acid sequences of the parent and MA viruses
The coding regions of all 10 genes of the M0 and MA viruses were sequenced and compared. Thirty nucleotide changes resulted in 8 deduced amino acid differences in 5 of the 8 gene segments and 6 of the 10 genes of influenza B virus (Table 1). Two of the deduced amino acid changes occurred as a result of 1 nucleotide change in gene segment 6 which contains overlapping reading frames coding for the neuraminidase (NA) and the NB proteins. Thus 7/30 (23%) nucleotide changes resulted in deduced changes in amino acids. This is in contrast to data from the mouse adaptation of an influenza A virus, where 11/15 (73%) of nucleotide changes resulted in amino acid changes(Brown, Liu et al., 2001).
Table 1
Table 1
Nucleotide and amino acid changes in wild-type and mouse-adapted influenza virus B/Memphis/12/97
Two deduced amino acid changes were present in the NA and the NB and 1 change was present in each of the PA, HA, NP, and M1. No deduced amino acid changes were present in the PB1, PB2, BM2, NS1, or NS2. The amino acid changes Thr412Asn in the PA, Val459Ala in the NA, and Asn221Ser in the M1 are unique at their positions among all influenza B virus sequences available in the Influenza Sequence Database (ISD)(Macken, Lu et al., 2001). The remaining 5 deduced amino acid changes were at positions where variation is present in sequences in the ISD and were not unique. The change at nucleotide position 664 of the HA (A to G) leading to deduced amino acid change Asn223Asp was not constant; electrophoretic peaks for both an A and a G could be seen at that position during sequencing of the M3 and M6 intermediates, although the G predominated after the 9th passage. Similarly, both A and G were seen variably in the M3, M6, and MA intermediates at position 758 of gene segment 7 which could potentially lead to an amino acid change Lys245Arg. However, the A at that position predominated as the major electrophoretic peak and was most reliably present in all viruses with repeated sequencing so no change from the conserved Lys at that position is reported. Sequencing results are from the same plaque purified virus stock as the in vivo experiments.
Order of deduced amino acid changes during passaging in mice
Partial sequencing of the M3, M6, and M9 viruses was done including all positions where there were differences between the parent and the MA virus. Four deduced amino acid changes were present by the third passage (Table 2). All of these early differences were changes to non-unique amino acids at non-conserved positions, three of them within the portion of gene segment 6 containing the overlapping reading frames for NA and NB. Two changes occurred between the 3rd and 6th passages, and 1 change each between the 6th and 9th and the 9th and 15th passages. Three of the latter 4 changes were to amino acids unique for that position at positions that are otherwise conserved among influenza B viruses. The exception was the difference in the HA which was seen variably in intermediate passages. It is unclear from this analysis which of these changes contribute to adaptation of the virus to mouse lungs. However, the increase in virulence and failure to clear the virus from mouse lungs seen between the 9th and 15th passages can be attributed to a single amino acid change, asparagine to serine at position 221 of the M1.
Table 2
Table 2
Sequence of amino acid changes during mouse adaptation
A serine at position 221 of the M1 confers mouse adaptation and virulence
Although it was evident that the Asn221Ser change in the M1 protein was necessary for expression of virulence, two questions remained. It was not clear whether other changes that occurred earlier in the adaptation process also contributed to adaptation and were therefore necessary for expression of virulence with the change in the M1, and it was not known whether an M1 containing this change could confer adaptation and/or virulence in a different background, i.e., another influenza B virus. Therefore we utilized the eight plasmid reverse genetics system (Hoffmann, Mahmood et al., 2002) for influenza B viruses to transfer the M gene segment of the Mem97-MA virus containing the serine at position 221 to a different virus, B/Yamanashi/166/98 (Yam98) creating a 1:7 reassortant (rgYam98-M(Mem97MA)). Besides the amino acid of interest at 221, the viruses differ in the M1 at position 97 (threonine in Yam98 and isoleucine in Mem97), in the BM2 at position 82 (asparagine in Yam98 and serine in Mem97), and at 9 other amino acid positions scattered throughout the genome. Therefore we also mutated the Yam98 M1, changing the asparagine at position 221 to a serine so the new virus (rgYam98-M1(N221S)) could be compared to an otherwise isogenic wildtype parent (rgYam98). The peak HA titers (256−512 HA units) and TCID50s of the stocks (1×107 − 1×107.5) did not differ significantly among the 3 viruses.
The wild-type virus, rgYam98, was found to be avirulent in mice with an MLD50 of greater than 107 TCID50. To evaluate any difference in virulence caused by changes in the M segment, groups of 6−8 mice were given 1×106 TCID50 of either rgYam98, rgYam98-M(Mem97MA), or rgYam98-M1(N221S) and followed for weight loss and mortality. Infection with rgYam98 resulted in no weight loss, no clinical signs of infection, and no deaths. However, infection with rgYam98-M(Mem97MA) and rgYam98-M1(N221S) caused typical clinical symptoms of influenza infection, severe weight loss (Fig. 3A), and 100% mortality (Fig. 3B). In a separate experiment, groups of 8 mice were infected with 2×105 TCID50 of each virus for determination of lung titers (the lower dose was used so mice would survive until day 7). Lung titers at day 3 and day 7 were higher in mice infected with rgYam98-M(Mem97MA) and significantly higher in mice infected with rgYam98-M1(N221S) (Fig. 3C); virus was completely cleared from mice infected with rgYam98 by day 7. These experiments establish that adaptation and virulence can be conferred on another influenza B virus by reassortment with the M segment from the MA virus using reverse genetics.
Fig. 3
Fig. 3
A serine at position 221 of the M1 confers mouse adaptation and virulence. Reassortant viruses containing either 7 genes from Yam98 but the M segment of Mem1297-MA, or a mutated M1 gene with the N221S change, caused more weight loss (A), high mortality (more ...)
Adaptation can be described as the modification of an organism or its parts that makes it more fit for existence under the conditions of its environment. Adaptation can manifest as infection of an increased number or range of cell types (tissue tropism), an increase in susceptibility in hosts of different ages (host range), or as the ability to induce pathology(Ward, 1997). Virulence is more difficult to define but is linked to the ability of an organism to cause disease in its host; as relative virulence increases so does the severity of disease and the likelihood of death. Most modern influenza B virus strains will grow without adaptation to low titers in mouse lungs but are avirulent (personal observation, author J.A.M.). In the mouse adapted variant we describe here, it is uncertain which, if any, of the 7 deduced amino acid changes seen prior to the change in the M1 can contribute to adaptation or support virulence, since no change in phenotype was seen during the first 9 passages (Figs. 1, ,2),2), and only the contribution of the M gene segment was examined using reverse genetics.
During the first 3 passages, all 4 of the predicted amino acid changes (Table 2) occurred at sites which were neither unique nor conserved, 3 of them in the stretch of nucleotides coding for both the cytoplasmic portion of the NB protein and the hypervariable stalk region of the NA(Burmeister, Baudin et al., 1993). In all 4 instances the change was from a less common variant in the parent to a more common variant in the MA virus (data not shown). For these reasons they are less likely to be involved in adaptation than later changes which result in unique amino acids at conserved sites. Two further deduced amino acid changes occurred between the 3rd and 6th passages, Thr412Asn in the PA and Val459Ala in the NA. The amino acid change Val459Ala is in the highly conserved C-terminal region of the NA head distal to the 6th beta-strand(Burmeister, Ruigrok et al., 1992). Although not a part of the enzyme active site, a mouse adapted influenza A virus also has a mutation in the corresponding region implying a potential role in growth or adaptation(Brown, Liu et al., 2001). Changes at amino acids 458 and 463 of the NA in a temperature sensitive influenza B virus mutant have been implicated in assembly and growth defects at the non-permissive temperature(Miyazaki, Nakayama et al., 1993). Therefore, changes in this area of the NA could potentially affect replication and growth, and could contribute to adaptation either independently or in concert with the change in M1. The MA virus on the Mem97 background with these changes was not evaluated head to head with the rgYam98-M(Mem97MA) virus that lacked these changes, so no conclusions can be drawn at this point.
Many earlier publications focused on the role of the HA and the M1 proteins in adaptation to mouse lungs(Smirnov, Lipatov et al., 2000;Hartley, Reading et al., 1997;Gitelman, Kaverin et al., 1984;Rudneva, Kaverin et al., 1986;Kaverin, Finskaya et al., 1989;Frosner & Gerth, 1973;Smeenk & Brown, 1994;Brown, 1990;Govorkova, Gambaryan et al., 2000;Smeenk, Wright et al., 1996;Ward, 1995). We identified a change in the HA between the 6th and 9th passages, but it was only variably present in the quasi-species pool of viruses and did not result in any change in virulence. The change in the M1, however, is clearly related to virulence. An examination of previously published work on mouse adaptation(Lee, Youn et al., 2001;Govorkova, Gambaryan et al., 2000;Brown, Liu et al., 2001) and of the M1 sequences in the Influenza Sequence Database(Macken, Lu et al., 2001) shows that many mouse adapted influenza viruses have unique changes in a short stretch of the C-terminal domain (C) of the M1 protein (Fig. 4). The predicted amino acid change Lys245Arg seen in B/Lee/40 was also present variably in intermediates during passaging of Mem97, but was not the predominant residue at any point. Variation in the N-terminal (N) and middle (M) domains of the M1 have also been associated with virulence in mouse lungs, albeit less frequently(Ward, 1997;Lee, Youn et al., 2001;Brown & Bailly, 1999;Brown, 1990).
Fig. 4
Fig. 4
Unique amino acids found in the C region of the M1 protein associated with mouse adaptation of influenza A and B viruses. The broad downgoing arrowhead indicates the position of the amino acid change M1 N221S reported here, while narrow upgoing arrowheads (more ...)
The M1 protein is involved during multiple steps of replication with roles in assembly and budding(Bui, Whittaker et al., 1996;Ye, Liu et al., 1999;Liu, Muller et al., 2002). Functional and structural studies have localized RNA and RNP binding to the M and N domains, but little is known about the C domain(Ye, Liu et al., 1999;Ye, Pal et al., 1987;Liu & Ye, 2002;Sha & Luo, 1997). The C domain, which is not visualized by X-ray crystallography, may either hang into the virion's interior(Sha & Luo, 1997) or may be membrane embedded(Shishkov, Goldanskii et al., 1999). Functionally, it may interact with the RNP or with an unidentified host protein(Sha & Luo, 1997). Although there is significant sequence homology between influenza viruses in the N and M domains of M1, little is seen in the C domain where the majority of changes in mouse adapted viruses are found(Briedis, Lamb et al., 1982). Our data suggest that this region of the M1 contributes to growth and virulence in mouse lungs although identification of the mechanism awaits further study.
We have mouse adapted an influenza B virus representative of currently circulating strains until it was lethal. Transfer of the M gene segment of this virus to another virus or site directed mutagenesis of the M segment of the second virus conferred mouse adaptation and virulence. Knowledge that this change can confer virulence should allow us to rapidly adapt influenza B viruses using reverse genetics. Use of an M segment containing a serine at position 221 during construction of viruses by reverse genetics should allow study of the role of unrelated genes such as the HA or NA in mouse models of vaccine efficacy or drug treatment.
Infectious Model
Six to eight week old female Balb/cByJ mice (Jackson Laboratory, Bar Harbor, ME) were maintained in a Biosafety Level 2 facility in the Animal Resource Center at St. Jude Children's Research Hospital. Influenza virus was diluted in sterile PBS and administered intranasally in a volume of 100 μl (50 μl per nostril) to anesthetized mice held in an upright position. Mice were weighed and followed at least daily for illness and mortality. Mice found to be moribund were euthanized and considered to have died on that day. Anesthetized mice were euthanized by cervical dislocation or CO2 inhalation. Lungs were removed under sterile conditions, washed three times in sterile PBS, and placed into 500 μl of sterile PBS. Lung homogenates were spun at 10,000 × g for 5 minutes and the supernatants used for determination of viral titers. Viral titers were determined by 10-fold serial dilutions on MDCK cell monolayers to obtain the dose infectious for 50% of tissue culture wells (TCID50). All experimental procedures involving mice were approved by the Animal Care and Use Committee at St. Jude Children's Research Hospital and were done under general anesthesia with inhaled isoflurane 2.5% (Baxter Healthcare Corporation, Deerfield, IL).
Adaptation of B/Memphis/12/97 to mouse lungs
Influenza virus B/Memphis/12/97(McCullers, Facchini et al., 1999) was obtained from the virus repository at St. Jude Children's Research Center and passaged in mice. During each passage, groups of 3 mice were infected with a 1:100 dilution of viral stock (approximately 103 to 104 TCID50 of virus per mouse depending on the passage) and euthanized 72 hours later to recover virus from the lungs. Virus was amplified once for stock in MDCK cells in the presence of 0.1% trypsin-TPCK (Worthington Biochemical Corporation, Lakewood, NJ) before being put back into mice at each passage by blindly passaging a 1:1000 dilution of lung homogenate on MDCK cells for 96 hours. The lung homogenates were titered simultaneously on a separate tissue culture plate. This allowed determination of viral titers and preservation of stock virus for further studies, as well as insuring sufficient virus was present to allow for selection. Virus was passaged through lungs fifteen times before sequencing and pathogenicity studies were begun. The parent virus (M0), 3 intermediate passages (M3, M6, and M9), and the fifteenth passage (MA) were plaque purified in MDCK cells. Working stocks were then made by growing virus at a multiplicity of infection of 0.1 for 96 hours at 33° so that each intermediate was uniformly prepared. These working stocks were used for all experiments. HA titers were determined by standard methods. Briefly, two fold dilutions of virus containing supernatant from MDCK cells were exposed to 0.5% chicken red blood cells and allowed to incubate for 30 minutes at room temperature. The titer was read as the furthest dilution where hemagglutination by binding of the virus and cross-linking prevented pelleting of red blood cells in U-bottomed 96 well plates and was reported as the reciprocal log2.
Sequencing and Genbank accession numbers
Nucleotide sequencing was done using standard methodologies as described(McCullers, Wang et al., 1999). Briefly, RNA was transcribed to cDNA by using Uni12-primer (AGC AAA AGC AGG) and the cDNA was then amplified using segment-specific primers. RT-PCR products were purified using QIAquick PCR purification kit (Qiagen, Chatsford, California) and sequenced by Taq Dye Terminator chemistry according to manufacturer's instructions (Applied Biosystems, Inc.), then analyzed on an ABI 373 DNA sequencer. The open reading frames of all 10 genes of the eight gene segments of the M0 and the MA viruses were completely sequenced. Portions of the intermediates M3, M6, and M9 were sequenced including all areas where any differences were noted between the parent and the MA virus. Comparisons of nucleotide and amino acid sequences were facilitated by use of the Influenza Sequence Databank (ISD)(Macken, Lu et al., 2001). Sequences for B/Memphis/12/97 have been previously reported(McCullers, Saito et al., 2004), and sequences of B/Memphis/12/97-MA are available in the ISD or in Genbank with the following accession numbers: PB1 (AY260949), PB2 (AY260950), PA (AY260951), HA (AY260952), NP (AY260953), NA (AY260954), M (AY260955), and NS (AY260956).
Generation by reverse genetics of a reassortant virus containing the mouse adapted M1
Viral RNA from the Mem97-MA virus was reverse transcribed and amplified by PCR using segment specific primers for the M segment (segment 7), MDV-B 5’ Bsa1-M (TATTGGTCTCAGGGAGCAGAAGCACGCACTTTCTTAAAATG) and MDV-B 3’ Bsa1-M (ATATGGTCTCGTATTAGTAGAAACAACGCACTTTTTCCAG). This primer pair was based on the primer set used for rescue of an influenza B virus from cloned cDNA plasmids as previously described(Hoffmann, Mahmood et al., 2002), but has recognition sites for the endonuclease Bsa1 (GGTCTC) instead of for that of BsmB1 (CGTCTC), as the latter sequence is present in gene segment 7 and would have created multiple fragments during digestion. The resulting RT-PCR fragment was isolated, digested with Bsa1, and inserted into the BsmB1-digested plasmid pHW2000(Hoffmann, Neumann et al., 2000). The open reading frame and viral non-coding regions of the resulting plasmid were directly sequenced and were found to be identical to the sequences of the open reading frame of the M segment of the MA virus and the consensus viral non-coding regions of this influenza B virus segment(Hoffmann, Mahmood et al., 2002).
The protocol used for rescue of the reassortant influenza B virus was based on the protocol for generation of influenza A virus(Hoffmann, Neumann et al., 2000). Briefly, 293T cells were transiently co-cultured with MDCK cells in six-well plates. Two μg of the newly generated plasmid containing the M segment of the MA virus and 2 μg each of plasmids for the PB1 (pAB251-PB1), PB2 (pAB252-PB2), PA (pAB253-PA), HA (pAB254-HA), NP (pAB255-NP), NA (pAB256-NA), and NS (pAB258-NS) of influenza virus B/Yamanashi/166/98 obtained from MedImmune, Inc. (Gaithersburg, MD), were mixed with 2 μl of TransIT-LT-1 (Mirrus, Madison, WI) per 1 μg of plasmid DNA, incubated at room temperature for 45 minutes, and added to the cells. After 6 hours, the DNA-transfection mixture was replaced by Opti-MEM I (Life Technologies, Rockville, MD). The cells were incubated at 33°C. Fresh media containing 0.1% trypsin-TPCK (Worthington Biochemical Corporation, Lakewood, NJ) was added 24 hours later and virus was harvested at 96 hours and passaged on MDCK cells for stock. The resultant stock was titered on MDCK cells to obtain the TCID50, and the M1 open reading frame was sequenced to confirm that the mutation of interest resulting in a serine at position 221 was present. Limited sequencing of other gene segments including the HA and NA confirmed that the other gene segments were derived from B/Yamanashi/166/98.
Site directed mutagenesis of the M segment of B/Yamanashi/166/98
The M1 region of the M gene of B/Yamanashi/166/98 was specifically mutated such that the asparagine at position 221 became a serine, using primers (For 5’-CTT GGA GCA AGT CAA AAG AGC GGG GAA GGA ATT GCA AAG-3’, Rev 5’CTT TGC AAT TCC TTC CCC GCT CTT TTG ACT TGC TCC AAG-3’) that were synthesized at the Hartwell Center (St. Jude Children's Research Hospital). Site-directed mutagenesis was performed on 25 ng of plasmid DNA using the QuikChange® II site-directed mutagensis kit from Stratagene® (Stratagene, La Jolla, CA). After 16 cycles in a DNA Engine DYAD Peltier Thermal Cycler (MJ Research, Inc., Waltham, MA), parental DNA was digested using the restriction enzyme DpnI (Strategene), and chemically competent DH5-α E. coli (Invitrogen, Carlsbad, CA) cells were transformed with the mutated plasmid DNA. Plasmids obtained from colonies grown on LB (Q-Biogene, Irvine, CA) with 100 μg mL−1 Ampicillin (Sigma, St. Louis, MO) were sequenced, and colonies with the single N221S mutations were maxi-prepped using a Hi-Speed® Plasmid Maxi Kit (Qiagen, Valencia, CA). The 8-plasmid reverse genetics system (Hoffman et al.) was utilized, and a B/Yamanashi/166/98 virus clone containing a single mutation in the M1 region of its M gene (N221S) was rescued from MDCK cells. Viral RNA isolated using the RNeasy® RNA extraction kit (Qiagen) was amplified using the One-Step RT-PCR Kit (Qiagen) with matrix-specific primers. Products were purified using the QIAquick® PCR Purification Kit (Qiagen), and sequenced with matrix-specific primers to confirm the presence of the N221S mutation.
Statistical Analyses
Comparison of survival between groups of mice was done with the Mantel-Cox Chi-Squared test on the Kaplan-Meier survival data. Comparison of viral titers in lungs between groups was done with the Wilcoxon Rank Sum test. Comparisons of weight loss between groups were done using the Student's t-test for pairwise comparisons and one way analysis of variance (ANOVA) followed by Dunn's test for comparisons among multiple groups. A p-value of < 0.05 was considered significant for these comparisons.
Acknowledgements
These studies were supported by the Cancer Center Support Grant (CA-21765) at St. Jude Children's Research Hospital and the American Lebanese Syrian Associated Charities (ALSAC). The authors would like to thank the Pediatric Oncology Education program at St. Jude for support of author A. D. N., Dr. Robert G. Webster for continued encouragement and advice, and Raelene McKeon for excellent technical assistance.
  • Air GM, Gibbs AJ, Laver WG, Webster RG. Evolutionary changes in influenza B are not primarily governed by antibody selection. Proc. Natl. Acad. Sci. U. S A. 1990;87:3884–3888. [PubMed]
  • Briedis DJ, Lamb RA, Choppin PW. Sequence of RNA segment 7 of the influenza B virus genome: partial amino acid homology between the membrane proteins (M1) of influenza A and B viruses and conservation of a second open reading frame. Virology. 1982;116:581–588. [PubMed]
  • Brown EG. Increased virulence of a mouse-adapted variant of influenza A/FM/1/47 virus is controlled by mutations in genome segments 4, 5, 7, and 8. J. Virol. 1990;64:4523–4533. [PMC free article] [PubMed]
  • Brown EG, Bailly JE. Genetic analysis of mouse-adapted influenza A virus identifies roles for the NA, PB1, and PB2 genes in virulence. Virus Res. 1999;61:63–76. [PubMed]
  • Brown EG, Liu H, Kit LC, Baird S, Nesrallah M. Pattern of mutation in the genome of influenza A virus on adaptation to increased virulence in the mouse lung: identification of functional themes. Proc. Natl. Acad. Sci. U. S. A. 2001;98:6883–6888. [PubMed]
  • Bui M, Whittaker G, Helenius A. Effect of M1 protein and low pH on nuclear transport of influenza virus ribonucleoproteins. J. Virol. 1996;70:8391–8401. [PMC free article] [PubMed]
  • Burmeister WP, Baudin F, Cusack S, Ruigrok RW. Comparison of structure and sequence of influenza B/Yamagata and B/Beijing neuraminidases shows a conserved “head” but much greater variability in the “stalk” and NB protein. Virology. 1993;192:683–686. [PubMed]
  • Burmeister WP, Ruigrok RW, Cusack S. The 2.2 A resolution crystal structure of influenza B neuraminidase and its complex with sialic acid. EMBO J. 1992;11:49–56. [PubMed]
  • Fitch WM, Leiter JM, Li XQ, Palese P. Positive Darwinian evolution in human influenza A viruses. Proc. Natl. Acad. Sci. U. S. A. 1991;88:4270–4274. [PubMed]
  • Francis TE. A new type of virus from epidemic influenza. Science. 1940;92:405–406. [PubMed]
  • Frosner GG, Gerth HJ. Changes in temperature-sensitivity of haemagglutinin and neuraminidase during adaptation of influenza virus to mice. Med. Microbiol. Immunol. (Berl) 1973;158:161–163. [PubMed]
  • Gitelman AK, Kaverin NV, Kharitonenkov IG, Rudneva IA, Zhdanov VM. Changes in the antigenic specificity of influenza hemagglutinin in the course of adaptation to mice. Virology. 1984;134:230–232. [PubMed]
  • Govorkova EA, Gambaryan AS, Claas EC, Smirnov YA. Amino acid changes in the hemagglutinin and matrix proteins of influenza a (H2) viruses adapted to mice. Acta Virol. 2000;44:241–248. [PubMed]
  • Hartley CA, Reading PC, Ward AC, Anders EM. Changes in the hemagglutinin molecule of influenza type A (H3N2) virus associated with increased virulence for mice. Arch. Virol. 1997;142:75–88. [PubMed]
  • Hoffmann E, Mahmood K, Yang CF, Webster RG, Greenberg HB, Kemble G. Rescue of influenza B virus from eight plasmids. Proc. Natl. Acad. Sci. U. S. A. 2002;99:11411–11416. [PubMed]
  • Hoffmann E, Neumann G, Kawaoka Y, Hobom G, Webster RG. A DNA transfection system for generation of influenza A virus from eight plasmids. Proc. Natl. Acad. Sci. U. S. A. 2000;97:6108–6113. [PubMed]
  • Kaverin NV, Finskaya NN, Rudneva IA, Gitelman AK, Kharitonenkov IG, Smirnov YA. Studies on the genetic basis of human influenza A virus adaptation to mice: degrees of virulence of reassortants with defined genetic content. Arch Virol. 1989;105:29–37. [PubMed]
  • Krystal M, Young JF, Palese P, Wilson IA, Skehel JJ, Wiley DC. Sequential mutations in hemagglutinins of influenza B virus isolates: Definition of antigenic domains. Proc. Natl. Acad. Sci. U. S A. 1983;80:4527–4531. [PubMed]
  • Lee KH, Youn JW, Kim HJ, Seong BL. Identification and characterization of mutations in the high growth vaccine strain of influenza virus. Arch Virol. 2001;146:369–377. [PubMed]
  • Lindstrom SE, Hiromoto Y, Nerome R, Omoe K, Sugita S, Yamazaki Y, Takahashi T, Nerome K. Phylogenetic analysis of the entire genome of influenza A (H3N2) viruses from Japan: evidence for genetic reassortment of the six internal genes. J Virol. 1998;72:8021–8031. [PMC free article] [PubMed]
  • Lindstrom SE, Hiromoto Y, Nishimura H, Saito T, Nerome R, Nerome K. Comparative analysis of evolutionary mechanisms of the hemagglutinin and three internal protein genes of influenza B virus: multiple cocirculating lineages and frequent reassortment of the NP, M, and NS genes. J. Virol. 1999;73:4413–4426. [PMC free article] [PubMed]
  • Liu T, Muller J, Ye Z. Association of influenza virus matrix protein with ribonucleoproteins may control viral growth and morphology. Virology. 2002;304:89–96. [PubMed]
  • Liu T, Ye Z. Restriction of viral replication by mutation of the influenza virus matrix protein. J. Virol. 2002;76:13055–13061. [PMC free article] [PubMed]
  • Macken C, Lu H, Goodman J, Boykin L. The value of a database in surveillance and vaccine selection. In: Osterhaus ADME, Cox N, Hampson A, editors. Options for the Control of Influenza IV. Elsevier Science; Amsterdam: 2001. pp. 103–106.
  • McCullers JA, Facchini S, Chesney PJ, Webster RG. Influenza B virus encephalitis. Clin. Infect. Dis. 1999;28:898–900. [PubMed]
  • McCullers JA, Saito T, Iverson AR. Multiple genotypes of influenza B virus circulated between 1979 and 2003. J Virol. 2004;78:12817–12828. [PMC free article] [PubMed]
  • McCullers JA, Wang GC, He S, Webster RG. Reassortment and insertion-deletion are strategies for the evolution of influenza B viruses in nature. J. Virol. 1999;73:7343–7348. [PMC free article] [PubMed]
  • Miyazaki C, Nakayama M, Tanaka Y, Kusuhara K, Okada K, Tokugawa K, Ueda K, Shibata R, Nishima S, Yamane N. Immunization of institutionalized asthmatic children and patients with psychomotor retardation using live attenuated cold-adapted reassortment influenza A H1N1, H3N2 and B vaccines. Vaccine. 1993;11:853–858. [PubMed]
  • Nicholson KG. Human influenza. In: Nicholson KG, Webster RG, Hay AJ, editors. Textbook of Influenza. Blackwell Science, Ltd.; London: 1998. pp. 222–223.
  • Rudneva IA, Kaverin NV, Varich NL, Gitelman AK, Makhov AM, Klimenko SM, Zhdanov VM. Studies on the genetic determinants of influenza virus pathogenicity for mice with the use of reassortants between mouse-adapted and non- adapted variants of the same virus strain. Arch Virol. 1986;90:237–248. [PubMed]
  • Scheiblauer H, Kendal AP, Rott R. Pathogenicity of influenza A/Seal/Mass/1/80 virus mutants for mammalian species. Arch Virol. 1995;140:341–348.. Ref Type: Generic. [PubMed]
  • Sha B, Luo M. Structure of a bifunctional membrane-RNA binding protein, influenza virus matrix protein M1. Nat. Struct. Biol. 1997;4:239–244. [PubMed]
  • Shishkov AV, Goldanskii VI, Baratova LA, Fedorova NV, Ksenofontov AL, Zhirnov OP, Galkin AV. The in situ spatial arrangement of the influenza A virus matrix protein M1 assessed by tritium bombardment. Proc. Natl. Acad. Sci. U. S. A. 1999;96:7827–7830. [PubMed]
  • Smeenk CA, Brown EG. The influenza virus variant A/FM/1/47-MA possesses single amino acid replacements in the hemagglutinin, controlling virulence, and in the matrix protein, controlling virulence as well as growth. J. Virol. 1994;68:530–534. [PMC free article] [PubMed]
  • Smeenk CA, Wright KE, Burns BF, Thaker AJ, Brown EG. Mutations in the hemagglutinin and matrix genes of a virulent influenza virus variant, A/FM/1/47-MA, control different stages in pathogenesis. Virus Res. 1996;44:79–95. [PubMed]
  • Smirnov YA, Lipatov AS, van Beek R, Gitelman AK, Osterhaus AD, Claas EC. Characterization of adaptation of an avian influenza A (H5N2) virus to a mammalian host. Acta Virol. 2000;44:1–8. [PubMed]
  • Ward AC. Specific changes in the M1 protein during adaptation of influenza virus to mouse. Arch. Virol. 1995;140:383–389. [PubMed]
  • Ward AC. Virulence of influenza A virus for mouse lung. Virus Genes. 1997;14:187–194. [PubMed]
  • Webster RG, Bean WJ, Gorman OT, Chambers TM, Kawaoka Y. Evolution and ecology of influenza A viruses. Microbiol Rev. 1992;56:152–179. [PMC free article] [PubMed]
  • Webster RG, Laver WG, Air GM, Schild GC. Molecular mechanisms of variation in influenza viruses. Nature. 1982;296:115–121. [PubMed]
  • Yamashita M, Krystal M, Fitch WM, Palese P. Influenza B virus evolution: co-circulating lineages and comparison of evolutionary pattern with those of influenza A and C viruses. Virology. 1988;163:112–122. [PubMed]
  • Ye Z, Liu T, Offringa DP, McInnis J, Levandowski RA. Association of influenza virus matrix protein with ribonucleoproteins. J. Virol. 1999;73:7467–7473. [PMC free article] [PubMed]
  • Ye ZP, Pal R, Fox JW, Wagner RR. Functional and antigenic domains of the matrix (M1) protein of influenza A virus. J. Virol. 1987;61:239–246. [PMC free article] [PubMed]