PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Eur J Cancer. Author manuscript; available in PMC 2010 September 1.
Published in final edited form as:
PMCID: PMC2733789
NIHMSID: NIHMS128830

Positive Association between Nuclear Runx2 and Estrogen-Progesterone Receptor Gene Expression Characterizes a Biological Subtype of Breast Cancer

Abstract

Purpose

The runt-related transcription factor, Runx2 may have an oncogenic role in mediating metastatic events in breast cancer, but whether Runx2 has a role in the early phases of breast cancer development is not clear. We examined the expression of Runx2 and its relationship with estrogen receptor (ER) and progesterone receptor (PR) in breast cancer cell lines and tissues.

Methods

Two human breast cancer cell lines, MCF-7 and MDA-MB-231 were transiently transfected with vectors expressing either Runx2 or ER and the levels of both proteins and mRNA were examined by Western blot analysis and quantitative real-time PCR respectively. Runx2 expression was also examined in tissue microarray sections of 123 breast cancer patients by immunohistochemistry and results were correlated with clinico-pathological characteristics.

Results

Expression of Runx2 and ER was reciprocal in the breast cell culture models and Runx2 suppressed ERβ but ERα not mRNA levels. In contrast, functional expression of Runx2 was evident in the nucleus in 28% of the breast cancer tissues and in both early and late stages of tumor growth. Importantly, Runx2 expression was significantly more frequent in Grade 2 compared to Grade 1 and Grade 3 tumors (48% vs 39% vs 13%) and the expression was significantly associated with ER (p=0.005), PR (p=0.008) expression in Grade 2 & 3 tumors than the Grade 1 tumors.

Conclusion

We propose that Runx2, ER and PR triple positivity in Grade 2 & 3 defines a biological subtype in breast cancer.

Keywords: Runx2, breast cancer, estrogen receptor, progesterone receptor, CerbB2

INTRODUCTION

Breast cancer occurs due to the action of the two main female steroid hormones, estrogen and progesterone and their cognate nuclear receptors (respectively, ER and PR) that are known to be potent mitogenic factors. The pathological roles of both hormone receptors in the etiology of breast cancer have been demonstrated by in vitro and in vivo studies1. Both ER and PR have been implicated in the initiation or promotion of breast cancer by stimulating breast cell proliferation while bypassing cell cycle checkpoints that normally prevent damage DNA in response to genotoxic insult and permitting the incorporation of random genetic mutations2.

The estrogen receptor (ER) exists in two isoforms, ERα and ERβ that are encoded by two distinct genes, ESR1 and ESR2, located in chromosomal loci at 6q25 and 14q23, respectively3. The ratio of ERα and ERβ varie s between tissues and results in different physiological responses to estrogen. Breast cancer shows mostly higher levels of ERαand its expression is associated with more differentiated tumors and a more favorable prognosis, although the potential role of ERβ a s a favorable prognostic indicator has also been suggested4. Progesterone binds to the progesterone receptor and also has two isoforms, PR-A and PR-B that differ in protein sequence and function but are encoded by the same gene. PR-A lacks the N-terminal 164 amino acids of PR-B and has only two of the three activation function domains that are present in PR-B. Thus, PR-B shows a higher transcriptional activity and acts as a more potent transcriptional activator of target genes than PR-A5, 6. Imbalance in the ratio of these two forms of PR may be associated with the development and progression of breast cancer6-8.

The majority of breast cancers are either positive for ER alone or positive for both ER and PR. Patients that are both ER and PR positive have a- good prognosis9 and are most likely to benefit from endocrine therapy10. Other forms of breast cancer such as ER negative/PR negative or triple negative breast cancers that lack ER, PR and human epidermal growth factor receptor 2 (HER-2) also occur, though less frequently. HER-2 is encoded by the CerbB2 gene (abbreviation for ‘v-erb-b2 erythroblastic leukemia viral oncogene homolog 2’) and is also known as the neuro/glioblastoma (c-neu) proto-oncogene that is located on chromosome 17 and encodes a 185kDa transmembrane tyrosine kinase receptor. Mutations in the CerbB2/HER-2 gene predict poor outcome in breast cancer and the encoded protein is over expressed in at least 30% of breast cancers diagnosed11.

Steroid hormones including estrogen action can enhance bone formation by blocking bone resorption by osteoclasts and/or promoting the bone anabolic functions of osteoblasts. Breast cancer that metastasizes to bone is predominantly osteolytic12-16. The Runt-related transcription factor Runx217 is known to mediate the expression of proteins that support breast cancer metastasis18-22. Runx2 is essential for osteogenesis and differentiation of osteoblasts 23-24. Oncogenic properties of Runx2 have also been demonstrated in T-cell lymphomas 25 and prostate cancer 26. Apart from oncogenic functions upon ectopic expression, endogenous expression of Runx2 in osteoblasts is linked to control of cell growth 27-30 and its expression in mammary epithelial cells may support normal breast development 31-32. Other reports have suggested links between steroids and Runx2 25, 33, 34. Steroids such as glucocorticoids alter the expression of genes associated with osteoblast function at low doses 35, while high doses of this adrenal hormone cause bone loss and fractures 36, 37. Glucocorticoids have inhibitory effects on Runx2 function by depleting its nuclear accumulation 38. Runx2 has also been linked with ERα and both were shown to interact through the ERα DNA binding domain. Estrogen enhances Runx2 activity in dose and estrogen receptor-dependent ways. Notably, deletion of the DNA binding domain of ER, eliminates the stimulatory effects of estrogen on Runx2 activity 39. ER and PR serve as the basis for many therapeutic interventions in breast cancer and Runx2 has been implicated as a regulator of early metastatic events in this cancer. However, links between steroid hormone signaling and pathological functions of Runx2 in breast tumorigenesis remain to be explored.

In this study, we investigate the relationship between Runx2 and the two main female hormone receptors, ER and PR, as well as the oncogene CerbB2 (HER-2/c-neu), in a panel of breast cancer clinical samples. Our results show that nuclear presence of Runx2 is significantly and positively correlated with ER-PR positive breast cancer tissues in Grade 2 & 3 tumors. Our results provide direct clinical evidence indicating a biological role of Runx2 in the pathology of steroid hormone related breast cancers.

MATERIALS AND METHODS

Cell Culture and Transfections

Two breast cancer cell lines, MDA-MB-231 and MCF-7 cells and an osteosarcoma cell line, Saos2 (ATCC, Manassas,VA,USA) were cultured in DMEM media supplemented with 10% fetal bovine serum. MDA-MB-231 and MCF-7 cells were transfected either with ER or Runx2 pcDNA3 expression vector using Fugene 6 (Roche, Basel, Switzerland) and Lipofectamine 2000 transfection reagent (Invitrogen Corporation,CA, USA) respectively. The empty vector (pcDNA3) was used as a control in both cases. Three days post transfection, protein and RNA were extracted for Western blot analysis and quantitative real-time PCR respectively.

Western Blotting

All the three cell lines were first checked for the endogenous levels of ER, PR and Runx2. Osteosarcoma cells were used as Runx2 positive controls. Cells were lysed with lysis buffer (2% SDS, 10% glycerol, 5% 2-mercaptoethanol, 0.002% bromophenol blue and 62.6mM Tris HCl, pH 6.8), briefly sonicated and pre-cleared with high speed centrifugation. Supernatants were loaded and proteins separated by 10% SDS-PAGE and transferred to a nitrocellulose membrane. Proteins were probed with anti-Runx2 (MBL International, Woburn, MA, USA), anti-ER, anti-PR and anti-β-actin (Santa Cruz Biotechnology Inc.,CA,USA) primary antibodies followed by appropriate horse radish peroxidase conjugated to anti-rabbit or anti-mouse secondary antibodies and detected with luminol on exposure to X-ray film.

Quantitative PCR

For quantitative PCR measurements, total RNA from the transfected cells (MCF-7 and MDA-MB-231) was extracted and reverse transcribed using High capacity cDNA reverse transcription kit (Applied Biosystems, USA). The cDNA (15ng) from these cells was amplified in an ABI 7300 Prism system using primers of target genes and Fermentas Maxima SYBR Green qPCR Master Mix. Cycling conditions were 10 mins at 95°C followed by 40 cycles of 15 sec at 94°C, 30 sec at 60°C and 20 sec at 72°C. GAPDH was used as an internal control. The sequences of the forward and reverse primers of the genes were as follows: GAPDH_Fwd:5′ GAGTCCACTGGCGTCTTCA 3′ GAPDH_Rev : 5′ GTTCACACCCATGACGAACA 3′ ERα_Fwd : 5′ CCTATCTCAGGGAGGGAAGG 3′ ERα_Rev : 5′ TCTCCAAGTCCCACTCTGCT 3′ ERβ_Fwd : 5′ CACCAACGAGTGCGAGATCA 3′ ERβ_Rev : 5′ TCCCCACTTTGAGGCATTTC 3′ PR_Fwd : 5′ GATTCAGAAGCCAGCCAGAG 3′ PR_Rev : 5′ GACCTTACAGCTCCCACAGG 3′ Runx2_Fwd: 5′ GGAGTGGACGAGGCAAGAGTTT 3′ Runx2_Rev: 5′ AGCTTCTGTCTGTGCCTTCTGG 3′

Patient samples

Tissue microarray (TMA) sections from 123 breast cancer patients (invasive ductal carcinomas representing all grade and stage) and 2 normal breast tissues (controls) were obtained from the department of pathology, National University Hospital, Singapore upon ethics approval (B06/006) by the institutional review board. These were constructed according to previously reported methods 40, representing all grades and stages of the commonest breast cancer (the invasive ductal carcinoma type). The median age of patients was 52 years (range 29-86). The distribution of patients according to the three most common ethnic groups in Singapore showed that they were of Chinese (81%), Malay (15%) or Indian (4%) descent. Histopathological staging of BC was based on the TNM staging system 41 and grading 42 of tumors. Patients that were alive and being followed up in the hospital after initial diagnosis and surgery and at the time of our data analyses were 91/123 (74%), those that did not follow up were 14/123 (11%) and those that died of the disease were 18/123 (15%).

Immunohistochemistry

Immunohistochemistry was performed on breast cancer TMAs constructed and stained according to our protocol described previously with minor modifications 40. Briefly, sections were microwaved at 98 °C for 20 mins in citrate buffer (pH6.0) (DAKO, Denmark) followed by peroxidase blocking for 1 hr at room temperature. Anti-Runx2 mouse mAb 43 at 1: 500 dilution, ER1D5 antibody at 1:1000, for ER detection, NCL-PGR1A6 at 1:1000 for PR and Hercep Test K5204 antibody at 1:500 for CerbB2, (DAKO, Denmark) 44 were used as primary antibodies, incubated for 2hrs at room temperature followed by diaminobenzidine (DAKO, Denmark) staining and detection.

Statistical analysis

Runx2, ER, PR and CerbB2 immunostained TMA sections were visually scored by two independent observers (AG and MST) that were blinded to clinical outcome of the patients. The staining was semi-quantitatively assessed on a scale ranging from 0 to 3 (0-no staining; 1- weak staining, 2- moderate staining and 3- strong staining) following our previously published protocols for Runx family of proteins43 and also ER, PR and CerbB2 proteins44. The status CerbB2 positive and CerbB2 negative in this study is scored by immunohistochemistry following standard practice, with +0 and +1 representing negative staining and +2 and +3 representing positive. In our hands, this scoring method in TMA is equivalent to the scoring in full sections (see reference 44) and also to HER2 status by FISH.

For statistical analyses negative and weak nuclear or cytoplasmic staining were grouped together and termed as ‘negative expression’ of the proteins and moderate and strong nuclear or cytoplasmic staining was termed as ‘positive expression’ of Runx2. Fisher’s exact test was used to test for the association between Runx2 expression and the clinico-pathological parameters of breast cancer. Survival analysis was performed according to Kaplan and Meier method. All statistical analyses were performed using SPSS version 16.0 for Windows (SPSS Inc., Chicago IL). The p values were from two-sided tests and p< 0.05 was considered significant.

RESULTS

Runx2 is inversely correlated to ER status in breast cancer cell lines

We analyzed the relationship between Runx2, ER and PR genes in vitro by selecting two breast cancer cell lines, MCF-7 and the highly metastatic MDA-MB-231. The cell lines were examined for endogenous levels of Runx2 and ER and it was observed that MCF-7 was ER positive and negative for Runx2 while MDA-MB-231 was ER negative and positive for Runx2 expression level (Figure 1A). This finding is consistent with a requirement for ER in early stages of breast cancer2, 4 and the metastatic potential of Runx2 in later stages14,18,19.

Figure 1Figure 1Figure 1
(A) Endogenous protein expression levels of ER and Runx2 in breast cancer cell lines, MCF-7 and MDA-MB-231 [A less aggressive cell line, MCF-7 expressed ER but much lower levels of Runx2. Conversely, a highly metastatic, MDA-MB-231 was ER negative but ...

To assess whether the relationship between ER and Runx2 reflects regulatory coupling, the cells were then transiently transfected with vectors expressing either Runx2 or ER and the levels of both proteins and mRNA were examined by Western blot analysis and quantitative real-time PCR respectively. In the Runx2 negative MCF-7 cell line, transfection of Runx2 suppressed expression of ER (Figure 1B). In contrast, exogenous expression of ER in negative MDA-MB-231 cells appreciably altered the levels of Runx2 protein (Figure 1C). The protein data for Runx2 and ER were confirmed by examination of transcripts level. The endogenous Runx2 mRNA level was low or diminished in ER positive cell lines (MCF-7). In contrast, the ER-negative cell lines (MDA-MB-231) showed high levels of Runx2 mRNA (Figure 2A). Interestingly, exogenous expression of Runx2 in MCF-7 cells exhibited low levels of ERα , ERβ and PR (Figure 2B) indicating that Runx2 effects the expression of the two ER isoforms. Similarly, when MDA-MB-231 cells were over expressed with ERα, the Runx2 mRNA level was suppressed (Figure 2C). Thus, ER and Runx2 expression is inversely correlated in these cell lines, consistent with their respective roles in early and late stages of breast cancer, and Runx2 is capable of attenuating ER levels.

Figure 2Figure 2Figure 2
(A) Endogenous levels of Runx2 mRNA in breast cancer cell lines, MCF-7, MDA-MB-231 [Osteosarcoma cell line, Saos 2 was used as a positive control] (B) Quantitative RT-PCR graph functional consequences of Runx2 up and down regulation in MCF-7 cells [Runx2 ...

Runx2 is localized in the nucleus and cytoplasm of breast tissues

To begin understanding the clinical relationships between steroid hormone responsive breast tumors and Runx2, we performed Runx2 immunostaining and analyzed the localization of the protein in a spectrum of breast tumor clinical samples. Of the 123 tumors , Runx2 nuclear expression was detected in 14 (11%) cases (Figure 3a), cytoplasmic expression in 24 (19%) cases (Figure 3b) and concurrent nuclear and cytoplasmic expression was observed in 20 (16%) cases (Figure 3c). There was no expression of Runx2 in 65 (53%) cases. Two normal tissues that were considered as controls showed weak nuclear expression only, consistent with previous data suggesting a role for Runx2 in specific stages of normal breast epithelial development 31.

Figure 3
Runx2 immunostaining in breast cancer tissues showing (A) nuclear staining (B) cytoplasmic staining and (C) concurrent nuclear and cytoplasmic staining

Based on the known role of Runx2 as a nuclear transcription factor, we propose that nuclear expression of Runx2 reflects a functionally active form of the protein, whereas its cytoplasmic localization indicates loss of function in gene regulation at least in a basal state. We do not exclude the possibilities that cytoplasmic Runx2 may provide a reservoir of sequestered Runx2 that might translocate to the nucleus only upon stimulation, or simply represents an inactive bystander molecule. We interpreted concurrent expression of Runx2 in both nucleus and cytoplasm as indicating that the protein has retained its transcriptional function, and thus is at least in part active in gene regulation.

Runx2 nuclear protein is strongly associated with ER —PR expression in Grade 2 &3 breast cancer

Table 1 shows the correlation of Runx2 nuclear expression with the pathological parameters in the breast tumors. There was no significant correlation between ER, PR and Runx2 nuclear expression in the breast tumors although Runx2 nuclear protein was more evident in CerbB2 negative tumors than the CerbB2 positive tumors (70% vs 30%) that was nearly statistically significant (p=0.092),..

TABLE 1
Relationship of Runx2 nuclear expression and pathologic features of breast cancer

The ER and PR status in the tumors, when compared with pathological grade showed that ER was positive for (95%) grade 1 tumors (G1), positivity was 81% in grade 2 (G2) tumors and 47% in grade 3 (G3) tumors that was statistically significant (p<0.0005) (Figure 4a). Similar relation was also observed between PR and tumor grades (91% vs 76% vs 37%; p<0.0005) (Figure 4b). This inverse relation is consistent with previous studies and consistent with loss of estrogen-responsiveness in late stage breast tumors (44). Expression of CerbB2 (HER-2/c-neu) is elevated in tumors of higher grades (15% vs 40% vs 68%; p<0.0005).

Figure 4Figure 4
ER and PR immunostaining in G2 breast cancer tissues. (A) ER positive staining and (B) PR positive staining

We next examined the expression of Runx2 in different grades of breast cancer. The nuclear expression of Runx2 varied significantly across the three grades of breast cancer with the highest expression in G2 tumors (Figure 5). Of the 31 tumors that showed Runx2 nuclear expression, 48% were G2, 13% were G3 and the remaining 39% represented G1 cancer (Table1). The Runx2 expression was then correlated with ER and PR positivity in different tumor grade and a statistically significant association was observed between them in G2 & G3 tumors compared with G1 tumours (Table 2). However, CerbB2 showed a negative correlation with Runx2 expression in G2 & G3 tumors which was also significant (Table2). In other words, Runx2 was more frequently expressed in CerbB2 negative tumors than the positive ones (39% vs 17%). There were no significant differences between Runx2 expression and different breast cancer stages or with axillary lymphnode metastasis. Runx2 cytoplasmic expression also did not show any significant difference when compared with the pathological parameters. Our statistical analyses did not show any correlation with patient survival. This is fully consistent with the predominant intermediate grade of Runx2 expression in breast cancer.

Figure 5
Runx2 positive expression in G2 breast cancer tissue.
TABLE 2
Correlation between ER, PR and Runx2 nuclear expression in breasttumor grades

DISCUSSION

There are breast cancer conditions as reflected by cell lines in our study that are ER positive and Runx2 negative as observed in MCF-7 and those that are ER negative and Runx2 positive in MDA-MB-231 cell lines. Reciprocal relationship between Runx2 and ER expression was observed at both the mRNA and protein level suggesting that high levels of Runx2 may be may be effecting the expression of ER in MDA-MB-231 cell lines. Because Runx2 and ER can synergize in biological processes (e.g., they are both bone anabolic), one key question is whether there is an in vivo transition in breast cancer in which both factors can co-exist. We tested this by co-staining breast cancer clinical samples for both ER and Runx2 and assessed the biological role of Runx2 in all grades of this disease together with the hormone receptors.

Runx2 and ER expression results were similar to those of the cell lines in G1 tumors and G3 tumors while in G2 tumors, Runx2, ER and PR expression were increased significantly and there was a significant positive association between Runx2 nuclear protein and ER and PR expression. These data suggest that Runx2 is expressed early on during tumor growth and development.

A link between estrogen and Runx2 has been reported through an increase in the number of Runx2 expressing cells 45. Selective ER modulators, raloxifene having different modes of action from estrogen enhanced Runx2 promoter activity 46.To bind to the target gene promoters, nuclear import of transcription factors is an essential element of the molecular pathways and when these proteins are present in the cytoplasm, they are functionally inactive and may act as bystanders or as a reservoir of unstimulated forms. Runx activity is regulated by tissue—specific expression and also those elements that control its subcellular localization. Cytoplasmic and nuclear localization has been shown for Runx3 in gastric cancer 47 and colon cancer 48 and Runx2 in osteosarcoma cells49. Besides nuclear and cytoplasmic expression of Runx2, our study also showed concurrent expression of this protein in the two subcellular components in 16% of the tumors and more frequently in the G2 tumors. This reflects ectopic induction of Runx2 expression during breast cancer progression. Although Runx2 expression was prevalent during tumorigenesis of mammary epithelial cells as evidenced by our breast cancer tissues, only a subset of tumors showed nuclear localization that would enable it to regulate its target genes.

Strikingly, the nuclear staining correlates with “ER positivity” suggesting that both factors synergize to stimulate tumor growth and development at one or more specific stages. Our observation that 32 % of ER+ breast cancer clinical samples express Runx2 (n=88) is consistent with a patho-physiological role of ectopic Runx2 expression. However, because only 28% of breast cancer tissue exhibits nuclear localization of Runx2 (n=123), it appears Runx2 is not actively participating in gene regulatory events, although we cannot exclude the possibility that Runx2 may perturb gene regulatory events by its cytoplasmic localization (e.g., sequestering of key co-factors like Smad and Yap that transduces TGF-beta and Src/Yes related signals respectively).

ER and Runx2 are both known to contribute to carcinogenesis independently. However, both proteins can also synergize at the molecular level in a manner that may reinforce their biological functions in the pathology of breast cancer. The co-expression of ER and Runx2 that we have established in this study suggests that both proteins may have biological synergism that may be further supported by molecular synergy. In vitro studies have shown that the expressions of ER versus Runx2 are inversely correlated50, parallel to what we have observed. But the novelty of our study is that we also found a subset of breast cancer that showed co-existence of ER and Runx2 suggesting the transition from positive to negative or vice versa as a gradual process.

Our results show that the in vivo disease is much more heterogeneous than the perceptions based on cell culture studies, highlighting the importance of analyzing clinical samples to understand the pathological linkages between different classes of transcription factors like ER and Runx2. Indeed, our full analysis showed cases with this reciprocal relation but, in addition, there were three important subclasses of breast cancer: ER+/PR+/Runx2-, ER+/PR+/Runx2+ and ER-/PR-/Runx2+ (in order of disease progression). We propose that ER+/PR+/Runx2+, triple positivity defines a biological subtype in breast cancer.

In summary, our results stress the idea that solid tumors including breast cancer, are not biologically homogenous disease and defining the biological nature of potential subgroups allows a better understanding of the disease. Finally, it is interesting to note that a defining biomarker of metastasis such as Runx2 is predominantly expressed in G2 breast cancers. Further investigation of its relationship with ER& PR may lead to a better understanding of the molecular processes related to breast cancer metastasis.

ACKNOWLEDGEMENTS

We would like to thank Dr Doris Mayer, German Cancer Research Center, Germany for the kind gift of ER expression plasmid. Our study was supported by SCS grants MN05 and MN077 (to MST), NIH grants P01CA82834 (to G.S.S.) and AR049069 (to AJvW.) and Lee Kuan Yew Postdoctoral Fellowship awarded to DTL.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

REFERENCES

1. Henderson BE, Feigelson HS. Hormonal carcinogenesis. Carcinogenesis. 2000;21:427–433. [PubMed]
2. Deroo BJ, Korach KS. Estrogen receptors and human disease. J of Clin Investigation. 2006;116:561–570. [PMC free article] [PubMed]
3. Mueller SO, Korach KS. Estrogen receptors and endocrine diseases: lessons from estrogen receptor knock out mice. Curr Opin Pharmacol. 2001;1:613–619. [PubMed]
4. Herynk MH, Fuqua SA. Estrogen receptor mutations in human disease. Endocr Rev. 2004;25:869–898. [PubMed]
5. Gao X, Nawaz Z. Progesterone receptors-animal models and cell signaling in breast cancer: role of steroid receptor co-activators and co-repressors of progesterone receptors in breast cancer. Breast Cancer Res. 2002;4:182–186. [PMC free article] [PubMed]
6. Conneely OM, Lydon JP. Progesterone receptors in reproduction: functional impact of the A and B isoforms. Steroids. 2000;65:571–577. [PubMed]
7. Fuqua SAW, Cui Y, Lee AV, Osborne CK. Insights into the role of progesterone receptors in breast cancer. J Clin Oncol. 2005;23:931–932. [PubMed]
8. Giangrande PH, Pollio G, McDonnell DP. Mapping and characterization of the functional domains responsible for the differential activity of the A and B isoforms of the human progesterone receptor. J Biol Chem. 1997;272:32889–32900. [PubMed]
9. Clark GM. In: Diseases of the Breast. Harris JLM, Morrow M, Hellman S, editors. Lippincott—Raven; Philadephia: 1996. pp. 461–485.
10. Honig S. In: Diseases of the Breast. Harris JLM, Morrow M, Hellman S, editors. Lippincott—Raven; Philadelphia: 1996. pp. 461–485.
11. Slamon DJ, Godolphin W, Jones LA, Holt JA, Wong SG, Keith DE, Lein WJ, Stuart SG, Udove J, Ullrich A. Studies of the HER-2/neu proto-oncogene in human breast and ovarian cancer. Science. 1989;244:707–12. [PubMed]
12. Coleman RE. Metastatic bone disease: Clinical features, pathophysiology and treatment strategies. Cancer Treat Rev. 2001;27:165–176. [PubMed]
13. Kingsley LA, Fournier PG, Chirgwin JM, Guise TA. Molecular biology of bone metastasis. Mol Cancer Ther. 2007;6:2609–17. [PubMed]
14. Pratap J, Lian JB, Javed A, Barnes GL, van Wijnen AJ, Stein JL, Stein GS. Regulatory roles of Runx2 in metastatic tumor and cancer cell interactions with bone. Cancer Metastasis Rev. 2006 Dec;25(4):589–600. Review. [PubMed]
15. Kakonen SM, Selander KS, Chirgwin JM, Yin JJ, Burns S, Rankin WA, Grubbs BG, Dallas M, Cui Y, Guise TA. Transforming growth factor-beta stimulates parathyroid hormone-related protein and osteolytic metastases via Smad and mitogen-activated protein kinase signaling pathways. J Biol Chem. 2002;277:24571–8. [PubMed]
16. Bendre MS, Margulies AG, Walser B, Akel NS, Bhattacharrya S, Skinner RA, Swain F, Ramani V, Mohammad KS, Wessner LL, Martinez A, Guise TA, et al. Tumor-derived interleukin-8 stimulates osteolysis independent of the receptor activator of nuclear factor-kappaB ligand pathway. Cancer Res. 2005;65:11001–9. [PubMed]
17. van Wijnen AJ, Stein GS, Gergen JP, Groner Y, Hiebert SW, Ito Y, Liu P, Neil JC, Ohki M, Speck N. Nomenclature for Runt-related (RUNX) proteins. Oncogene. 2004;23:4209–4210. [PubMed]
18. Barnes GL, Hebert KE, Kamal M, Javed A, Einhorn TA, Lian JB, Stein GS, Gerstenfeld LC. Fidelity of Runx2 activity in breast cancer cells is required for the generation of metastases- associated osteolytic disease. Cancer Res. 2004;64:4506–13. [PubMed]
19. Barnes GL, Javed A, Waller SM, Kamal MH, Hebert KE, Hassan MQ, Bellahcene A, Van Wijnen AJ, Young MF, Lian JB, Stein GS, Gerstenfeld LC. Osteoblast- related transcription factors Runx2 (Cbfa1/AML3) and MSX2 mediate the expression of bone sialoprotein in human metastatic breast cancer cells. Cancer Res. 2003;63:2631–2637. [PubMed]
20. Shore P. A role for Runx2 in normal mammary gland and breast cancer bone metastasis. J Cell Biochem. 2005;96:484–9. [PubMed]
21. Pratap J, Javed A, Languino LR, van Wijnen AJ, Stein JL, Stein GS, Lian JB. The Runx2 osteogenic transcription factor regulates matrix metalloproteinase 9 in bone metastatic cancer cells and controls cell invasion. Mol Cell Biol. 2005 Oct;25:8581–91. [PMC free article] [PubMed]
22. Javed A, Barnes GL, Pratap J, Antkowiak T, Gerstenfeld LC, van Wijnen AJ, Stein JL, Lian JB, Stein GS. Impaired intranuclear trafficking of Runx2 (AML3/CBFA1) transcription factors in breast cancer cells inhibits osteolysis in vivo. Proc Natl Acad Sci USA. 2005;102:1454–9. [PubMed]
23. Coffman JA. Runx transcription factors and the developmental balance between cell proliferation and differentiation. Cell Biol Int. 2003;27:315–24. [PubMed]
24. Lian JB, Javed A, Zaidi SK, Lengner C, Montecino M, van Wijnen AJ, Stein JL, Stein GS. Regulatory controls for osteoblast growth and differentiation: role of Runx/Cbfa/AML factors. Crit Rev Eukaryot Gene Expr. 2004;14:1–41. Review. [PubMed]
25. Valliant F, Blyth K, Terry A, Bell M, Cameron ER, Neil J, Stewart M. A full-length Cbfa1 gene product perturbs T-cell development and promotes lymphomagenesis in synergy with myc. Oncogene. 1999;18:7124–7134. [PubMed]
26. Brubaker KD, Vessella RL, Brown LG, Corey E. Prostate cancer expression of runt-domain transcription factor Runx2, a key regulator of osteoblast differentiation and function. Prostate. 2003;56:13–22. [PubMed]
27. Nathan SS, Pereira BP, Zhou YF, Gupta A, Dombrowski C, Soong R, Pho RW, Stein GS, Salto-Tellez M, Cool SM, van Wijnen AJ. Elevated expression of Runx2 as a key parameter in the etiology of osteosarcoma. Mol Biol Rep. 2009 Jan;36(1):153–8. [PMC free article] [PubMed]
28. Galindo M, Pratap J, Young DW, Hovhannisyan H, Im HJ, Choi JY, Lian JB, Stein JL, Stein GS, van Wijnen AJ. The bone-specific expression of Runx2 oscillates during the cell cycle to support a G1-related anti-proliferative function in osteoblasts. J Biol Chem. 2005;280:20274–85. [PMC free article] [PubMed]
29. Pratap J, Galindo M, Zaidi SK, Vradii D, Bhat BM, Robinson JA, Choi JY, Komori T, Stein JL, Lian JB, Stein GS, van Wijnen AJ. Cell growth regulatory role of Runx2 during proliferative expansion of preosteoblasts. Cancer Res. 2003;63:5357–62. [PubMed]
30. Teplyuk NM, Galindo M, Teplyuk VI, Pratap J, Young DW, Lapointe D, Javed A, Stein JL, Lian JB, Stein GS, van Wijnen AJ. Runx2 regulates G-protein coupled signaling pathways to control growth of osteoblast progenitors. J Biol Chem. 2008 Oct 10;283(41):27585–97. [PubMed]
31. Inman CK, Shore P. The osteoblast transcription factor Runx2 is expressed in mammary epithelial cells and mediates osteopontin expression. J Biol Chem. 2003;278:48684–9. [PubMed]
32. Inman CK, Li N, Shore P. Oct-1 counteracts auto inhibition of Runx2 DNA binding to form a novel Runx2/Oct-1 complex on the promoter of the mammary gland-specific gene beta-casein. Mol Cell Biol. 2005;25:3182–93. [PMC free article] [PubMed]
33. Viereck V, Siggelkow H, Tauber S, Raddatz D, Schutze N, Hufner M. Differential regulation of Cbfa1/Runx2 and osteocalcin gene expression by vitamin-D3, dexamethasone, and local growth factors in primary human osteoblasts. J Cell Biochem. 2002;86:348–356. [PubMed]
34. Drissi H, Pouliot A, Koolloos C, Stein JL, Lian JB, Stein GS, van Wijnen AJ. 1, 25-(OH)2-vitamin D3 suppresses the bone-related Runx2/Cbfa1 gene promoter. Exp Cell Res. 2002;274(2):323–33. [PubMed]
35. McCarthy TL, Ji C, Chen Y, Kim K, Centrella M. Time and dose-related interactions between glucocorticoid and cyclic adenosine 3′, 5′-monophosphate on CCAAT/enhancer binding protein-dependent insulin-like growth factor I expression by osteoblasts. Endocrinology. 2000;141:127–137. [PubMed]
36. Bijlsma JW. Can we use steroid hormones to immunomodulate rheumatic diseases? Rheumatoid arthritis as an example. Ann N Y Acad Sci. 1999;876:366–376. [PubMed]
37. Nishimura J, Ikuyama S. Glucocorticoid-induced osteoporosis: pathogenesis and management. J Bone Miner Metab. 2000;18:350–352. [PubMed]
38. Chang DJ, Ji C, Kim KK, Casinghino S, McCarthy TL, Centrella M. Reduction in transforming growth factor beta receptor I expression and transcription factor CBFa1 on bone cells by glucocorticoid. J Biol Chem. 1998;273:4892–4896. [PubMed]
39. Mc Carthy TL, Chang WZ, Liu Y, Centrella M. Runx2 integrates estrogen activity in osteoblasts. J Biol Chem. 2003;278:43121–43129. [PubMed]
40. Das K, Omar MF Mohd, Ong CW, Rashid S Bin Abdul, Peh BK, Putti TC, Tan PH, Chia KS, Teh M, Soong R, Salto-Tellez M. TRARESA: a tissue microarray-based hospital system for biomarker validation and discovery. Pathology. 2008;40:441–449. [PubMed]
41. American Joint Committee on Cancer: AJCC Cancer Staging Manual. 6th ed Springer; New York, NY: 2002. Breast; pp. 171–180.
42. Elston CW, Ellis IO. Pathological prognostic factors in breast cancer. The value of histologic grade in breast cancer: experience from a large study with long-term follow-up. Histopathology. 1991;19:403–410. [PubMed]
43. Ito K, Liu Q, Salto-Tellez M, Yano T, Tada K, Ida H, Huang C, Shah N, Inoue M, Rajnakova A, Hiong KC, Peh BK, Han HC, Ito T, Teh M, Yeoh KG, Ito Y. RUNX3, a novel tumor suppressor, is frequently inactivated in gastric cancer by protein mislocalization. Cancer Res. 2005;65:7743–50. [PubMed]
44. Zhang D, Salto-Tellez M, Putti TC, Do E, Koay ES. Reliability of tissue microarrays in detecting protein expression and gene amplification in breast cancer. Mod Pathol. 2003 Jan;16(1):79–84. [PubMed]
45. Plant A, Samuels A, Perry MJ, Colley S, Gibson R, Tobias JH. Estrogen-induced osteogenesis in mice is associated with the appearance of Cbfa1-expressing bone marrow cells. J Cell Biochem. 2002;84:285–94. [PubMed]
46. Taranta A, Brama M, Teti A, De luca V, Scandurra R, Spera G, Agnusdei D, Termine JD, Migliaccio S. The selective estrogen receptor modulator raloxifene regulates osteoclast and osteoblast activity in vitro. Bone. 2002;30:368–76. [PubMed]
47. Lau QC, Raja E, Salto-Tellez M, Liu Q, Ito K, Inoue M, Putti TC, Loh M, Ko TK, Huang C, Bhalla KN, Zhu T, Ito Y, Sukumar S. RUNX3 is frequently inactivated by dual mechanisms of protein mislocalization and promoter hypermethylation in breast cancer. Cancer Res. 2006;66:6512–20. [PubMed]
48. Ito K, Lim AC, Salto-Tellez M, Motoda L, Osato M, Chuang LS, Lee CW, Voon DC, Koo JK, Wang H, Fukamachi H, Ito Y. RUNX3 attenuates beta-Catenin/T cell factors in intestinal tumorigenesis. Cancer Cell. 2008;14:226–37. [PubMed]
49. Pockwinse SM, Rajgopal A, Young DW, Mujeeb KA, Nickerson J, Javed A, Redick S, Lian JB, van Wijnen AJ, Stein JL, Stein GS, Doxsey J. Microtubule-dependent nuclear-cytoplasmic shuttling of Runx2. J Cell Physiol. 2006;206:354–62. [PubMed]
50. Khalid O, Baniwal SK, Purcell DJ, Leclerc N, Gabet Y, Stallcup MR, Coetzee GA, Frenkel B. Modulation of Runx2 activity by Estrogen Receptor {alpha}: Implications for Osteoporosis and Breast Cancer. Endocrinology. 2008;149:5984–5995. [PubMed]