Search tips
Search criteria 


Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Circ Res. Author manuscript; available in PMC 2010 June 19.
Published in final edited form as:
PMCID: PMC2728034

The L-Type Calcium Channel C-terminus Auto-regulates Transcription


Calcium (Ca) homeostasis is critical for cardiac myocyte function and must be tightly regulated. The guiding hypothesis of this study is that a carboxyl-terminal cleavage product of the cardiac L-type calcium channel (CaV1.2) auto-regulates expression. First, we confirmed that the Ca channel C-terminus (CCt) is cleaved in murine cardiac myocytes from mature and developing ventricle. Over-expression of full-length CCt caused a 34±8% decrease of CaV1.2 promoter activity, and truncated CCt caused an 80±3% decrease of CaV1.2 promoter (n= 12). The full-length CCt distributes into cytosol and nucleus. A deletion mutant of CCt has a greater relative affinity for the nucleus than full-length CCt, and this is consistent with increased repression of CaV1.2 promoter activity by truncated CCt. Chromatin immunoprecipitation (ChIP) analysis revealed that CCt interacts with the CaV1.2 promoter in adult ventricular cardiac myocytes at promoter modules containing Nkx2.5/Mef2, C/EBp, and a cis regulatory module. The next hypothesis tested was that CCt contributes to transcriptional signaling associated with cellular hypertrophy. We explored whether fetal cardiac myocyte CaV1.2 was regulated by serum in vitro. We tested ANF promoter activity as a positive control, and measured the serum-response of CaV1.2 promoter, protein, and L-type current (ICa,L) from fetal mouse ventricular myocytes. Serum increased ANF promoter activity and cell size as expected. Serum withdrawal increased CaV1.2 promoter activity, mRNA, and ICa,L. Moreover, serum withdrawal decreased the relative nuclear localization of CCt. A combination of promoter deletion mutant analyses, and the response of promoter mutants to serum withdrawal support the conclusion that CCt, a proteolytic fragment of CaV1.2, auto-regulates CaV1.2 expression in cardiac myocytes. These data support the novel mechanism that a mobile segment of CaV1.2 links Ca handling to nuclear signaling.

Keywords: L-type Ca2+ channels, L-type Ca2+ current, Ca2+ channels, Ca2+ regulation, transcriptional regulation


The beat-to-beat function of the L-type calcium channel (LTCC), CaV1.2, is to provide trigger-Ca for excitation-contraction coupling in cardiac myocytes. Over a longer time-frame, LTCC Ca current (ICa,L) provides Ca that ultimately contributes to cellular Ca homeostasis1. On first principles, CaV1.2 expression and function must be tightly regulated to maintain Ca homeostasis in cardiac myocytes. We recently showed that LTCC block by sustained in vivo pharmacological treatment results in an up-regulation of ICa,L, CaV1.2 protein, and mRNA2, in agreement with earlier studies3-5. There are also precedents for physiological perturbations that alter ICa,L and CaV1.2. LTCC channel levels change in response to Ca6, angiotensin II7, cardiac denervation in heart failure8, or prolonged exposure to catecholamines9. In atrial fibrillation ICa,L10,11 and CaV1.2 decrease12-14. Late stage hypertrophic failing hearts show significant reduction of LTCC density15-20, and this decline can be rescued by left ventricular assist devices21. Thus, cellular hypertrophic signals contribute to CaV1.2 expression levels, and such signals may be reversible. However, we have limited information regarding mechanisms of regulation of CaV1.2 expression. The goal of this study was to test a new mechanism for control of LTCC expression.

CaV1.2 encodes the pore-forming subunit of the LTCC complex at the surface membrane. CaV1.2 is post-translationally processed22 with a functionally important cleavage of its carboxyl terminus23-25. The CaV1.2 C-terminus (CCt) is a ~300 amino acid protein that re-associates with the main body of CaV1.2 at the surface membrane26. In neurons and in heterologous expression systems, fragments of CCt also localize to the nucleus, and display transcriptional activity27. This study tested whether native CCt and CCt fragments show similar nuclear localization in cardiac myocytes. To test for involvement of CCt in CaV1.2 expression we probed for CCt – CaV1.2 promoter interactions. Our data suggest that CCt is a repressor of CaV1.2 promoter activity. Cellular hypertrophy mediated by serum coordinately regulates CCt nuclear localization, CCt repression of CaV1.2 promoter activity and concomitantly, down regulation of CaV1.2 protein and current. Taken together these data show that CCt, a segment of the LTCC, auto-regulates LTCC expression in cardiac myocytes.


Cell Culture

All animal procedures used in this study were approved by the University of Kentucky Institutional Animal Care and Use Committee. Embryonic day 16 mouse (ICR outbred strain, Harlan) hearts were dissected free of connective tissues, and ventricles were separated from conotruncus and sinus venosus. Cells were enzymatically dispersed and cultured as previously described28. Briefly, 10-40 embryos were minced and quickly transferred to nominally Ca-free digestion buffer containing 0.5mg/mL collagenase (type II, Worthington) and 1 mg/mL pancreatin for two 15-minute cycles. Digested tissue yielded a large fraction of single spontaneously beating cells. Cells were cultured in DMEM with or without 10% fetal bovine serum (FBS), 100μg/ml penicillin, 100μg/mL streptomycin, and 2μM L-glutamine.

Adult ventricular myocyte isolation procedures

Single ventricular myocytes were enzymatically isolated following a modified AfCS protocol PP00000125. Briefly, 4-6 month old female ICR mice were anesthetized and hearts were rapidly excised and retrogradely perfused at 3 ml/min at 37°C for 4-8 minutes with a Ca2+ free bicarbonate based perfusion buffer containing (in mM) 113 NaCl, 4.7 KCl, 0.6 KH2PO4, 1.2 MgSO4, 0.6 NaH2PO4, 5.5 glucose, 12 NaHCO3, 10 KHCO3, 10 HEPES, 0.032 phenol red, 10 2,3-butanedione monoxime, and 30 taurine. The perfusion buffer was gassed with 95% O2-5% CO2 for at least 30 min prior to use. Enzymatic digestion began using 0.25 mg/ml liberase blendzyme (Roche) and 12.5 μM CaCl2 added to the perfusion buffer for approximately 13 min until the heart was swollen and pale in color. The heart was then cut from the cannula. Ventricular tissue was placed in a dish with enzyme buffer and gently dissociated for several minutes. After the addition of stop buffer, (perfusion buffer containing 10% FBS and 12.5 μM CaCl2) dissociation continued until large pieces of heart tissue were gently dispersed into the cell suspension. Cells were allowed to sediment by gravity for 10 min followed by centrifugation at 180 rcf for 1 min. Cells were resuspended in perfusion buffer containing 5% FBS and 12.5 μM CaCl2. External Ca2+ was added incrementally back to the solution to 2.0 mM. Only rod-shaped, quiescent myocytes with clear margins were selected for current recording. For the nuclear extraction protocol cells were paced at 1.0Hz (37°C) for six hours in media with or without 10% FBS.

Western blots

Whole cell lysates were prepared from cells isolated from adult hearts. SDS-PAGE (4-15% separating gel, Biorad) and immunoblotting were carried out following routine protocols. Affinity purified L-type calcium channel α-subunit polyclonal antibody (custom designed for LII-III epitope; see reference 2), Pol II(Santa Cruz Biotechnology, Inc), tissue transglutaminase (Developmental Hybridoma Bank), and custom antibodies (ECM Biosciences, Versailles, Ky) for the Ser-1928 phosporylation site on the CaV1.2 C-terminus and for the C-terminal piece that were generated against epitopes as described in Hulme et al.24 Antibody localization was visualized with the appropriate (rabbit or mouse) horseradish peroxidase-conjugated secondary antibody (Chemicon) and Super Signal West Pico Chemiluminescence (Pierce). Each lane contained 60 μg total protein. All Western blot experiments for a given animal were repeated at least 3 times to ensure that experimental observations were reproducible. Loading was confirmed by stripping (Restore Western Blot Stripping Buffer, Pierce) and reprobing blots with GAPDH monoclonal antibody (Ambion). Immunoblots were scanned on an Epson Perfection 1650 and quantified using densitometry (Scion Image, Scion Corporation).

RNA extraction

Isolated cells from embryonic or adult cultures were pelleted and washed with PBS. Cells were then either snap frozen at -80°C or used immediately for RNA isolation. Total RNA was isolated using the RNAqueous -4PCR kit (Ambion) and quantitated spectrophotometrically at 260nm. Contaminating genomic DNA was eliminated by DNase treatment (Ambion). A portion of the resulting RNA (1 μg) was immediately used as a template for cDNA synthesis. Reverse transcription was performed using the SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen). Removal of genomic DNA was confirmed by preparing a no reverse transcription control for each sample. cDNA was then stored at -20°C.

Chromatin immunoprecipitation assay

Isolation of nuclei from transfected E16 and adult heart isolated cells was adapted from a method recently described29. Samples were incubated overnight at 4 °C with the custom CaV1.2 c-terminal antibody (adult) (ECM Biosciences, Versailles, KY) or GFP antibody (E16 transfected cells) (Abcam, Cambridge, MA) or no antibody as a negative control. After clearing, samples were treated with Proteinase K (10mg/mL) and DNA recovered for PCR. Primers (Tm of ~ 60 °C) were designed to amplify ~ 100 bp regions that were identified with in silico analysis (Figure 3A) in the CaV1.2 promoter region using the high fidelity AccuPrime Pfx Taq polymerase (Invitrogen, Carlsbad, CA) for 32-35 cycles. Primer sequences for the amplified regions are as follows (forward and reverse respectively) CRE: GGTGTAACCATTTAGCAACGAACAG, CCCTGTAACTGTGTTAACCTGCA; NKX/MEF2: TGCACTTGCTAGGCAAGCTCTCTA, GGCAAGTTGGTGATTTGGATTCAT; CRM2: CCCAACAGAACCTTTGCATCAGGA, GGCAAGTTGGTGATTTGGATTCAT; C/EBP: CCTCATGGAGATTTATCTGAGGCA, ATCCTTTCCCTCTCCCTGCCTATT; CRM1: TCCAGCTCAAGTTCTCCATGTGGT, GGCATGATGAGTTCTGGTCTTTGT.

Figure 3
(A) Rat CaV1.2 promoter map showing primer sets used to amplify potential interaction sites for CCt. (B) Representative ChIP data showing potential cis binding regions.

Promoter luciferase construct

A 1951 bp fragment of the rat α1c subunit promoter was cloned by PCR using forward and reverse primers designed according to the published sequence (accession number, AF221551). The PCR product was subcloned into the PGL3 basic vector at the HindIII and XHOI sites. Two deletion constructs were made using a similar strategy. All constructs were confirmed by DNA sequencing (Davis Sequencing). The ANF promoter reporter construct was a kind gift from Dr. Ginell Post.

CCT eGFP fusion constructs

The eGFP1906-2171 was a kind gift from Douglas Andres. eGFP1821-2171 was created by amplifying amino acids 1821-2171 from a pEGFP-C1 plasmid containing the rabbit Cav1.2 sequence from amino acid 1507-2171 (D. Andres). 1821-2171 was ligated into the multiple cloning site of pEGFP-C1 and verified by sequencing (Davis Sequencing).

Transfection and luciferase assay

E16 cardiac myocytes were transfected with 0.4 μg PGL3-CaV1.2 promoter DNA and 0.2 μg PRL, (Renilla luciferase expression vector, a control for transfection efficiency, Promega) with Lipofectamine 2000 (Invitrogen). Transfections were also performed with the PGL3 control vector and PGL3 basic vector as both positive and negative controls respectively. 72 hours post-transfection cells were washed with PBS and lysed with 100 ml passive Lysis buffer, Promega. Luciferase activity was measure with the dual luciferase assay kit (Promega) on a Lumat LB 9507 luminometer.

Translocation assay

E16 ventricular cardiomyocytes were isolated, and transfected within 24 hours with eGFP1906-2171 or eGFP1821-2171. Twenty four hours post-transfection cells were treated with serum or serum free media for 24 hours. Cells were fixed with 4% paraformaldehyde, permeabalized with 0.5% triton, and blocked with 1% BSA in PBS. Cardiomyocytes were stained with mouse sarcomeric anti-α-actinin (Sigma) and Alexa Fluor 594 goat anti-mouse IgG1 (Invitrogen) to identify cardiomyocytes and mounted with Vecta Shield with DAPI (Vector Laboratories) to identify nuclei. A LSM 5 Live (Zeiss) was used to obtain confocal images of 1μm thickness focused on the center of the nuclei. Nuclear and cytosolic fluorescence was quantified using ImageJ 1.38w with the LSM Toolbox ver 4.0b. The area within the nucleus and cytosol containing the greatest fluorescent intensity was used to measure the nuclear to cytosolic ratio. Representative images were obtained using a Leica TSP SP5 confocal microscope.

Ca2+ current measurements

Calcium current was recorded from Ca2+-tolerant adult female mouse ventricular cells at 37 °C 1 to 6 hours post-isolation. After establishment of the whole cell configuration the cells were perfused with sodium and potassium free solution containing (in mM): NMDG 140; MgCl2 1.0; CaCl2 2.5; HEPES 10; glucose 10; 4-aminopyridine 5 at pH 7.4. Pipettes had tip resistances of 1-2 MΩ after filling with pipette solution composed of (in mM): CsCl 125; TEACl 10; MgCl2 1.0; EGTA 10; Mg-ATP 5; HEPES 5 (pH 7.2). Current was recorded with an Axopatch-200B amplifier (Axon Instruments). The series resistance was typically 4-8 MΩ before compensation (50-75%). Data were digitized at 20 kHz using an A/D converter (Digidata-1200, Axon Instruments) under software control (pClamp 8.2, Axon Instruments).

Nuclear extracts

Adult cells were paced at 1.0 Hz (IonOptix Cell Pacer) in the presence or absence of serum (37°C) for six hours prior to fractionation. E16 cells were treated with serum or serum-free media for 72 hours prior to fractionation. Isolated, treated cells were pelleted, washed with PBS and snap frozen. Nuclear and cytoplasmic fractions were isolated using the Ne-Per Nuclear and Cytoplasmic Extraction Reagent Kit (Pierce) following standard protocols. A minimum of three separate isolations was performed for each experiment. Western blot analysis confirmed the fractionation method successfully isolated cytoplasmic and nuclear components by using Pol II (nuclear) or TGM2 (tissue trans glutaminase II, cytoplasmic) antibody (Online Figure IA).

Graphing and statistics

Origin 7 was used to create a box plot with the box denoting the 25th and 75th percentiles, the whiskers denoting the 5th and 95th percentiles, and the stars denoting the 1st and 99th percentile. Cell size was determined by drawing a circle around the borders of the cell and measuring total area. Significant differences were determined using Student's t-test.


CCt in murine heart is cleaved

CaV1.2 protein undergoes C-terminal cleavage at residue 182130 which is downstream of the CB/IQ motif but upstream of Ser1928 - a putative phosphorylation substrate for PKA/C modulation. tsA-201 cells transfected with CaV1.2, CaVβ2a and GFP do not process the full length Cav1.2 to generate CCt30. This was confirmed by a custom designed CCt-antibody recognizing only the full length channel (Figure 1). However, Western blotting of tsA-201 cells transfected with HA-CCt and probed with the same CCt antibody detects a ~37kDa CCt band. Figure 1 shows that in murine cardiac myocytes we can only detect the proteolytically cleaved CaV1.2 in the E16 ventricle, and in the adult ventricle.

Figure 1
Representative Western blot of the CaV1.2 CCt in (A) tsA-201 cells transfected with CaV1.2, CaVβ2a, and eGFP; (B) in adult mouse ventricular myocytes; and in (C) embryonic day 16 (E16) mouse ventricular myocytes, or E16 myocytes transfected HA-CCt. ...

Auto-regulation of Transcription

Given the recent identification of CCt as a calcium sensitive transcription cofactor in neurons27, we next tested whether CCt also functioned as a transcriptional regulator in cardiac myocytes. More specifically, we tested the hypothesis that CCt auto-regulates CaV1.2 expression. We utilized eGFP-CCt fusion constructs to explore CCt regulation of the CaV1.2 promoter, and to report sub-cellular localization of CCt in cardiac myocytes. E16 myocytes or tsA-201 cells were co-transfected with the CaV1.2 promoter-reporter construct, and the full-length CCt (1821-2171) or a truncated CCt (1906-2171). Consistent with previous studies31-33, CaV1.2 promoter activity was tissue specific with minimal activity observed in tsA-201 cells. Over-expression of full-length CCt caused a 34±8% decrease of CaV1.2 promoter activity, while truncated CCt caused 80±3% decrease of CaV1.2 promoter (Figure 2A).

Figure 2Figure 2
(A) Relative CaV1.2 promoter luciferase activity in E16 ventricular myocytes over-expressing the promoter construct and eGFP or the truncated CCt (1906) or the full-length CCt (1821). tsA-201 cells transfected with the CaV1.2 promoter construct show minimal ...

The eGFP tag on the CCt piece enabled us to examine the subcellular localization in CCt over-expressing E16 cardiac myocytes. Truncated and full-length CCt pieces showed nuclear and cytosolic localization (Figure 2B). A truncated form of CCt had a greater relative affinity for the nucleus than the full-length CCt (Figure 2C). This data is consistent with increased repression of CaV1.2 promoter activity by truncated CCt (Figure 2A); that is, increased nuclear localization correlates with increased repression of CaV1.2 expression.

The chromatin immunoprecipitation (ChIP) assay is useful for identifying DNA sequences that interact with transcriptional modulators. We designed PCR primers to amplify in silico predicted promoter elements of CaV1.2 including CRE, Nkx2.5, Mef2, CRM2, C/EBp, and CRM1 (Figure 3A). The CRE element served as a positive control - CREB is known to bind to the CRE element. We, therefore, used a commercially available CREB antibody to IP CREB (and bound DNA), and assay for CRE interaction via PCR. The upstream CRE site on the CaV1.2 promoter tested positive for CRE/CREB interaction. To determine whether CCt interacts with CaV1.2 promoter we used a CCt antibody (Figure 1) for IP. The CRE element does not interact with CCt. CCt does interact with modules harboring Nkx and Mef2, C/EBP, and CRM1 (cis regulatory module 1—a region of the promoter with an enriched number of in silico predicted trans factor binding sites; Figure 3B). We repeated the ChIP assay in transfected E16 cardiac myocytes over-expressing the CaV1.2 promoter-reporter construct and CCt (1906-2171). We reasoned that as the truncated CCt, which shows the greatest degree of repression should show the strongest binding to the promoter. CCt (1906-2171) interacted with the Nkx, C/EBP and CRM1 sites (Online Figure IB), supporting our data from the native adult rat.

Serum Regulation

We next explored whether embryonic cardiac myocyte CaV1.2 was regulated by serum as an in vitro model of cardiac myocyte cellular hypertrophy. We used ANF promoter activity as a positive control, and measured the serum-response of CaV1.2 promoter, mRNA, protein, and L-type current (ICa,L) from embryonic mouse ventricular myocytes. As expected, serum increased ANF promoter activity, and cell size. Serum repressed CaV1.2 promoter activity, CaV1.2 message, CaV1.2 protein, and ICa,L (Figure 4A-D).

Figure 4
(A) Relative CaV1.2 promoter luciferase activity in E16 ventricular myocytes in the presence and absence of serum. (B) Real time PCR showing a decrease in CaV1.2 message in the presence of serum (n=3 isolations). (C) Representative Western blot showing ...

Further evidence was garnered from Western blot data showing greater expression of CCt in the nuclear extracts of adult myocytes treated with 10% serum (FBS) for six hours post isolation (Figure 5A). In cells exposed to serum, 31% of the total CCt was found in the nuclear fraction; whereas in myocytes incubated without serum only 14% of the total CCt was located in the nuclear fraction. Serum caused a significant increase of CCt nuclear localization in E16 myocytes exposed as well (Figure 5B).

Figure 5
(A) Representative Western blot of the CaV1.2 CCt in nuclear and cytoplasmic fractions from adult ventricular myocytes in the presence and absence of serum. Densitometry of CaV1.2 CCt showing percent nuclear localization. (n=3; *p≤0.05) (B) Representative ...

We made promoter deletion constructs to evaluate the putative elements responsible for controlling serum-sensitive CaV1.2 promoter activity (Figure 6A). These deletion constructs were transiently transfected into E16 ventricular myocytes. The deletion construct [increment]1 removes the CRE, Nkx2.5 and Mef2 elements. In the presence of serum, [increment]1 promoter activity was significantly reduced compared to the full-length promoter (Figure 6B). In the absence of serum, there was no significant difference between [increment]1 and full-length promoter constructs (Figure 6C). This is consistent with earlier studies demonstrating positive regulation by humoral factors occurs via the CRE module of the CaV1.2 promoter32. A further deletion ([increment]2) reduced promoter activity independently of serum.

Figure 6
(A) Rat CaV1.2 promoter map showing deletion constructs. (B) Relative CaV1.2 promoter luciferase activity in E16 ventricular myocytes over-expressing the full-length promoter construct or a deletion mutant and eGFP or the truncated CCt (1906) or the full-length ...

Next, the effect of CCt over-expression was tested on the deletion mutants. CCt repression of [increment]1 promoter activity was stronger in the presence than in the absence of serum (83.81±7.14% versus 65.74±6.24%; Figure 6B and C). The CCt deletion mutant 1906-2171 caused significantly more repression than full-length CCt from the full-length CaV1.2 promoter (Figure 6B and C).

CCt is known to inhibit ICa,L23,26. This raises the possibility that the promoter response effect of CCt over-expression is secondary to a decrease of Ca signaling. Therefore, we tested the effect of bath Ca-removal. We measured mRNA and protein after 48 hours of Ca-free bath incubation. In contrast, to CCt over-expression, bath-Ca removal resulted in an increase of mRNA and protein (Figure 6D, E). Thus, CCt suppression of transcription, mRNA, and protein cannot be secondary to a CCt-over-expression-induced decrease of Ca-entry, because Ca-entry decrease causes a compensatory up-regulation of CaV1.2 (c.f.2). Taken together these data suggest that CCt repression interacts with serum-stimulated transcription factors to regulate CaV1.2 promoter expression.

Serum triggers hypertrophic signaling pathways in cardiac myocytes. The most noticeable change in phenotype is cellular hypertrophy. To test for a contribution of CCt in causing cellular hypertrophy, we over-expressed CCt in E16 myocytes, and then measured cell size, and ANF expression. A 25% increase in cell size was observed in the presence of serum; however, CCt attenuated the FBS-induced cellular hypertrophy (Figure 7(A-D)). CCt over-expression also attenuated serum-induced increase of ANF expression (Figure 7E).

Figure 7Figure 7
(A-C) Representative images of E16 ventricular myocytes over-expressing: (A) eGFP alone; (B) full-length CCt (1821-2171); or (C) truncated CCt (1906-2171). scale bars = 40 microns. (D) Relative ANF promoter luciferase activity in E16 ventricular myocytes ...


We show that CCt, a proteolytic fragment of CaV1.2, interacts with the CaV1.2 promoter in vivo, and auto-regulates CaV1.2 transcription in cardiac myocytes. CCt repression of CaV1.2 promoter activity suggests a negative feedback loop whereby up-regulated CaV1.2 (hence up-regulated CCt) results in additional repression. The serum response suggests more complex CaV1.2 promoter regulation – CCt antagonizes serum response elements on the distal segment of the CaV1.2 promoter. Finally, serum was shown to promote cellular hypertrophy (manifested as an increase of cell size) which was antagonized by CCt. Taken together, these data suggest that CCt responds to hypertrophic stimuli, and mediates phenotypic changes in response to serum.

In neurons, CCt localizes to the nucleus27,34, and transcriptionally regulates connexin 31.127. Microarray studies suggest that CCt may also down-regulate the Na-Ca exchanger27. This is consistent with the hypothesis that Na-Ca exchanger and ICa,L are coordinately regulated to maintain cellular Ca homeostasis35,36. CaV1.2 C-terminal truncations increase current23, and in heterologous expression systems CCt over-expression inhibits ICa,L26. Given that Na-Ca exchanger is the main plasma membrane Ca efflux pathway in cardiac cells, Ca balance is maintained by a reduced capacity for extrusion with reduced Ca-entry. A rigorous test of this hypothesis will be an important extension of this work.

A major point of the present study was the demonstration that CCt is a transcriptional repressor of CaV1.2. In effect, proteolytically cleaved CCt becomes a de facto auxiliary subunit of the CaV1.2 surface membrane channel complex. DREAM/Calsenilin/KChIP3 analogously interacts with Kv4 channels at the cell surface37, and is a transcriptional repressor, albeit not necessarily auto-regulatory38. However, with respect to Ca homeostasis, DREAM is indirectly regulatory by virtue of its ability to repress Na-Ca exchange expression in neurons39.

We show evidence for CCt interaction with endogenous chromatin of ventricular cardiac myocytes, and for CCt repression of CaV1.2 transcription. CCt repression of CaV1.2 was then superimposed on the effect of serum factors. This interpretation is consistent with the finding that CCt forms transcriptional complexes with other nucleoproteins such as p54/(nrb)/NonO27, and raises the likelihood that multiple factors converge on the CaV1.2 promoter to produce an integrated response. CaV1.2 promoter mutation analysis supports a positive promoter interaction at the distal CRE element32. Previous CaV1.2 promoter deletion analyses are not in complete agreement. Thus, while deletion of distal promoter elements results in a serum-independent decrease of activity in our study, and for human promoter constructs33, rat promoter constructs showed a 1.2 to 1.5 fold increase of activity following deletion of the distal ~800 base pair segment31,32. Differences between these studies may reflect species differences, and the different cell models used for promoter-reporter expression. We chose to use native primary cultured embryonic mouse ventricular myocytes rather than neonatal cultured rat ventricular myocytes (NRVM;31, or genetically modified HL-1 cell line32). We could not reproduce the NRVM experiments because of poor transfection efficiencies. Despite this, our studies qualitatively agree with myocyte specificity for promoter activity, and for deletions >1000 base pairs across species and transfection systems. It will be important in follow-up studies to attempt to elucidate CCt nucleoprotein binding partners to more fully understand CaV1.2 promoter regulation.

We were surprised that N-terminal truncated CCt (1906-2171) showed the strongest degree of nuclear localization, because the data disagrees with a recent study showing that CCt is a neuronal transcriptional regulator27. Our studies were mainly performed in cardiac myocytes, whereas previous studies mainly used HEK cells and neurons. To further examine localization, we over-expressed the eGFP tagged CCt pieces in both E16 ventricular myocytes and tsA-201 cells (data not shown). Truncated CCt showed a greater degree of nuclear localization when compared with the native piece. In contrast, Gomez-Ospina27, using a YFP tagged CCt (rat sequence), found no nuclear localization with a similarly truncated CCt in neurons and HEK cells. Our CCt constructs were based upon the rabbit sequence which might suggest species differences, although, this seems unlikely based upon the high degree of homology (> 80%) across species for the C-terminal portion of the L-type calcium channel. Nonetheless, in the present study, the degree of nuclear localization and the degree of CaV1.2 transcriptional repression were positively correlated.

Sites on the promoter used for PCR amplification in the ChIP assay were selected based upon in silico analysis focusing on regions containing sites for transcription factor binding that are important for determining cardiac development and hypertrophic signaling such as members of the GATA40, NK41, MEF242 and T-box families43,44. Building upon the fact that the truncated CCt showed stronger repression of luciferase activity, and a greater degree of nuclear localization, we co-expressed the eGFP tagged CCt (1906-2171) with the promoter construct in E16 cultured cells and performed a ChIP assay (supplementary data). Similar results to that of the native system were shown with the exception of an absence of binding the C/EBp region and the presence of binding the CRM2 (Cis regulatory module 2). This altered binding pattern may provide an explanation for the increased repression of promoter activity and nuclear localization observed with the truncated form of CCt.

In summary, we report that the C terminus of the L-type calcium channel in ventricular myocytes is cleaved, and in turn functions as a transcription factor regulating CaV1.2 expression. Future studies will evaluate CCt contributions to cellular hypertrophy, and the regulation of CCt nuclear-cytosolic shuttling.

Table 1
Average percent change in cell size compared to serum eGFP transfected (*p<0.04).


This work was supported by HL074091 (J.S.), and an AHA pre-doctoral fellowship (M.B.). JS is an Established Investigator of the AHA. The authors would like to acknowledge Dr. Xiping Xhang for his assistance with the ChIP assay and Dr. John McCarthy for his critical comments and support in preparation of this manuscript.

Sources of Funding: HL074091 (JS), and an AHA Pre-doctoral Fellowship (MB)


Disclosures: None


1. Molkentin JD. Dichotomy of Ca2+ in the heart: contraction versus intracellular signaling. J Clin Invest. 2006;116:623–6. [PMC free article] [PubMed]
2. Schroder E, Magyar J, Burgess D, Andres D, Satin J. Chronic verapamil treatment remodels ICa,L in mouse ventricle. Am J Physiol Heart Circ Physiol. 2007;292:H1906–16. [PubMed]
3. Morgan PE, Aiello EA, Chiappe de Cingolani GE, Mattiazzi AR, Cingolani HE. Chronic administration of nifedipine induces up-regulation of functional calcium channels in rat myocardium. J Mol Cell Cardiol. 1999;31:1873–83. [PubMed]
4. de Cingolani GE, Mosca SM, Moreyra AE, Cingolani HE. Chronic nifedipine treatment diminishes cardiac inotropic response to nifedifine: functional upregulation of dihydropyridine receptors. J Cardiovasc Pharmacol. 1996;27:240–6. [PubMed]
5. Chiappe De Cingolani GE, Mosca SM, Vila Petroff M, Cingolani HE. Chronic administration of nifedipine induces upregulation of dihydropyridine receptors in rabbit heart. Am J Physiol. 1994;267:H1222–6. [PubMed]
6. Davidoff AJ, Maki TM, Ellingsen O, Marsh JD. Expression of calcium channels in adult cardiac myocytes is regulated by calcium. J Mol Cell Cardiol. 1997;29:1791–803. [PubMed]
7. Gassanov N, Brandt MC, Michels G, Lindner M, Er F, Hoppe UC. Angiotensin II-induced changes of calcium sparks and ionic currents in human atrial myocytes: potential role for early remodeling in atrial fibrillation. Cell Calcium. 2006;39:175–86. [PubMed]
8. Yatani A, Shen YT, Yan L, Chen W, Kim SJ, Sano K, Irie K, Vatner SF, Vatner DE. Down regulation of the L-type Ca2+ channel, GRK2, and phosphorylated phospholamban: protective mechanisms for the denervated failing heart. J Mol Cell Cardiol. 2006;40:619–28. [PubMed]
9. Maki T, Gruver EJ, Davidoff AJ, Izzo N, Toupin D, Colucci W, Marks AR, Marsh JD. Regulation of calcium channel expression in neonatal myocytes by catecholamines. J Clin Invest. 1996;97:656–63. [PMC free article] [PubMed]
10. Van Wagoner DR, Pond AL, Lamorgese M, Rossie SS, McCarthy PM, Nerbonne JM. Atrial L-Type Ca2+ Currents and Human Atrial Fibrillation. Circ Res. 1999;85:428–436. [PubMed]
11. Yue L, Melnyk P, Gaspo R, Wang Z, Nattel S. Molecular mechanisms underlying ionic remodeling in a dog model of atrial fibrillation. Circ Res. 1999;84:776–84. [PubMed]
12. Shinagawa K, Shiroshita-Takeshita A, Schram G, Nattel S. Effects of antiarrhythmic drugs on fibrillation in the remodeled atrium: insights into the mechanism of the superior efficacy of amiodarone. Circulation. 2003;107:1440–6. [PubMed]
13. Shiroshita-Takeshita A, Schram G, Lavoie J, Nattel S. Effect of simvastatin and antioxidant vitamins on atrial fibrillation promotion by atrial-tachycardia remodeling in dogs. Circulation. 2004;110:2313–9. [PubMed]
14. Brundel BJ, Van Gelder IC, Henning RH, Tieleman RG, Tuinenburg AE, Wietses M, Grandjean JG, Van Gilst WH, Crijns HJ. Ion channel remodeling is related to intraoperative atrial effective refractory periods in patients with paroxysmal and persistent atrial fibrillation. Circulation. 2001;103:684–90. [PubMed]
15. Mukherjee R, Spinale FG. L-type calcium channel abundance and function with cardiac hypertrophy and failure: a review. J Mol Cell Cardiol. 1998;30:1899–916. [PubMed]
16. Rossner KL. Calcium current in congestive heart failure of hamster cardiomyopathy. Am J Physiol. 1991;260:H1179–86. [PubMed]
17. Nuss HB, Houser SR. Voltage dependence of contraction and calcium current in severely hypertrophied feline ventricular myocytes. J Mol Cell Cardiol. 1991;23:717–26. [PubMed]
18. Ming Z, Nordin C, Siri F, Aronson RS. Reduced calcium current density in single myocytes isolated from hypertrophied failing guinea pig hearts. J Mol Cell Cardiol. 1994;26:1133–43. [PubMed]
19. Kaab S, Nuss HB, Chiamvimonvat N, O'Rourke B, Pak PH, Kass DA, Marban E, Tomaselli GF. Ionic mechanism of action potential prolongation in ventricular myocytes from dogs with pacing-induced heart failure. Circ Res. 1996;78:262–73. [PubMed]
20. He J, Conklin MW, Foell JD, Wolff MR, Haworth RA, Coronado R, Kamp TJ. Reduction in density of transverse tubules and L-type Ca(2+) channels in canine tachycardia-induced heart failure. Cardiovasc Res. 2001;49:298–307. [PubMed]
21. Chen X, Piacentino V, III, Furukawa S, Goldman B, Margulies KB, Houser SR. L-Type Ca2+ Channel Density and Regulation Are Altered in Failing Human Ventricular Myocytes and Recover After Support With Mechanical Assist Devices. Circ Res. 2002;91:517–524. [PubMed]
22. De Jongh KS, Murphy BJ, Colvin AA, Hell JW, Takahashi M, Catterall WA. Specific phosphorylation of a site in the full-length form of the alpha 1 subunit of the cardiac L-type calcium channel by adenosine 3′,5′-cyclic monophosphate-dependent protein kinase. Biochemistry. 1996;35:10392–402. [PubMed]
23. Gao T, Cuadra AE, Ma H, Bunemann M, Gerhardstein BL, Cheng T, Eick RT, Hosey MM. C-terminal Fragments of the alpha 1C (CaV1.2) Subunit Associate with and Regulate L-type Calcium Channels Containing C-terminal-truncated alpha 1C Subunits. J Biol Chem. 2001;276:21089–21097. [PubMed]
24. Hulme JT, Westenbroek RE, Scheuer T, Catterall WA. Phosphorylation of serine 1928 in the distal C-terminal domain of cardiac CaV1.2 channels during {beta}1-adrenergic regulation. Proc Natl Acad Sci U S A. 2006 [PubMed]
25. Hulme JT, Lin TWC, Westenbroek RE, Scheuer T, Catterall WA. {beta}-Adrenergic regulation requires direct anchoring of PKA to cardiac CaV1.2 channels via a leucine zipper interaction with A kinase-anchoring protein 15. PNAS. 2003;100:13093–13098. [PubMed]
26. Hulme JT, Yarov-Yarovoy V, Lin TW, Scheuer T, Catterall WA. Autoinhibitory control of the CaV1.2 channel by its proteolytically processed distal C-terminal domain. J Physiol. 2006;576:87–102. [PubMed]
27. Gomez-Ospina N, Tsuruta F, Barreto-Chang O, Hu L, Dolmetsch R. The C terminus of the L-type voltage-gated calcium channel ca(v)1.2 encodes a transcription factor. Cell. 2006;127:591–606. [PMC free article] [PubMed]
28. Cribbs LL, Martin BL, Schroder EA, Keller BB, Delisle BP, Satin J. Identification of the T-Type Calcium Channel (CaV3.1d) in Developing Mouse Heart. Circ Res. 2001;88:403–407. [PubMed]
29. Ripperger JA, Schibler U. Rhythmic CLOCK-BMAL1 binding to multiple E-box motifs drives circadian Dbp transcription and chromatin transitions. Nat Genet. 2006;38:369–74. [PubMed]
30. Hulme JT, Konoki K, Lin TW, Gritsenko MA, Camp DG, 2nd, Bigelow DJ, Catterall WA. Sites of proteolytic processing and noncovalent association of the distal C-terminal domain of CaV1.1 channels in skeletal muscle. Proc Natl Acad Sci U S A. 2005;102:5274–9. [PubMed]
31. Liu L, Fan QI, El-Zaru MR, Vanderpool K, Hines RN, Marsh JD. Regulation of DHP receptor expression by elements in the 5′-flanking sequence. Am J Physiol Heart Circ Physiol. 2000;278:H1153–62. [PubMed]
32. Tsai CT, Wang DL, Chen WP, Hwang JJ, Hsieh CS, Hsu KL, Tseng CD, Lai LP, Tseng YZ, Chiang FT, Lin JL. Angiotensin II increases expression of alpha1C subunit of L-type calcium channel through a reactive oxygen species and cAMP response element-binding protein-dependent pathway in HL-1 myocytes. Circ Res. 2007;100:1476–85. [PubMed]
33. Pang L, Koren G, Wang Z, Nattel S. Tissue-specific expression of two human Ca(v)1.2 isoforms under the control of distinct 5′ flanking regulatory elements. FEBS Lett. 2003;546:349–54. [PubMed]
34. Kordasiewicz HB, Thompson RM, Clark HB, Gomez CM. C-termini of P/Q-type Ca2+ channel alpha1A subunits translocate to nuclei and promote polyglutamine-mediated toxicity. Hum Mol Genet. 2006;15:1587–99. [PubMed]
35. Lester WC, Schroder EA, Burgess DE, Yozwiak D, Andres DA, Satin J. Steady-state coupling of plasma membrane calcium entry to extrusion revealed by novel L-type calcium channel block. Cell Calcium. 2008 [PMC free article] [PubMed]
36. Pott C, Yip M, Goldhaber JI, Philipson KD. Regulation of cardiac L-type Ca2+ current in Na+-Ca2+ exchanger knockout mice: functional coupling of the Ca2+ channel and the Na+-Ca2+ exchanger. Biophys J. 2007;92:1431–7. [PubMed]
37. Takimoto K, Yang EK, Conforti L. Palmitoylation of KChIP splicing variants is required for efficient cell surface expression of Kv4.3 channels. J Biol Chem. 2002;277:26904–11. [PubMed]
38. Savignac M, Pintado B, Gutierrez-Adan A, Palczewska M, Mellstrom B, Naranjo JR. Transcriptional repressor DREAM regulates T-lymphocyte proliferation and cytokine gene expression. Embo J. 2005;24:3555–64. [PubMed]
39. Gomez-Villafuertes R, Torres B, Barrio J, Savignac M, Gabellini N, Rizzato F, Pintado B, Gutierrez-Adan A, Mellstrom B, Carafoli E, Naranjo JR. Downstream regulatory element antagonist modulator regulates Ca2+ homeostasis and viability in cerebellar neurons. J Neurosci. 2005;25:10822–30. [PubMed]
40. Pikkarainen S, Tokola H, Kerkela R, Ruskoaho H. GATA transcription factors in the developing and adult heart. Cardiovasc Res. 2004;63:196–207. [PubMed]
41. Mably JD, Liew CC. Factors involved in cardiogenesis and the regulation of cardiac-specific gene expression. Circ Res. 1996;79:4–13. [PubMed]
42. van Oort RJ, van Rooij E, Bourajjaj M, Schimmel J, Jansen MA, van der Nagel R, Doevendans PA, Schneider MD, van Echteld CJ, De Windt LJ. MEF2 activates a genetic program promoting chamber dilation and contractile dysfunction in calcineurin-induced heart failure. Circulation. 2006;114:298–308. [PubMed]
43. Nemer M, Horb ME. The KLF family of transcriptional regulators in cardiomyocyte proliferation and differentiation. Cell Cycle. 2007;6:117–21. [PubMed]
44. Christoffels VM, Hoogaars WM, Tessari A, Clout DE, Moorman AF, Campione M. T-box transcription factor Tbx2 represses differentiation and formation of the cardiac chambers. Dev Dyn. 2004;229:763–70. [PubMed]