PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Neurosci. Author manuscript; available in PMC 2009 October 15.
Published in final edited form as:
PMCID: PMC2721059
NIHMSID: NIHMS109788

Connexin32 mutations cause loss of function in Schwann cells and oligodendrocytes leading to PNS and CNS myelination defects

Abstract

The gap junction (GJ) protein connexin32 (Cx32) is expressed by myelinating Schwann cells and oligodendrocytes and is mutated in X-linked Charcot-Marie-Tooth disease (CMT1X). In addition to a demyelinating peripheral neuropathy, some Cx32 mutants are associated with transient or chronic CNS phenotypes. To investigate the molecular basis of these phenotypes, we generated transgenic mice expressing the T55I or the R75W mutation and an IRES-EGFP, driven by the mouse Cnp promoter. The transgene was expressed in oligodendrocytes throughout the CNS and in Schwann cells. Both the T55I and the R75W mutants were localized in the perinuclear cytoplasm, did not form GJ plaques, and did not alter the expression or localization of two other oligodendrocytic GJ proteins, Cx47 and Cx29, or the expression of Cx29 in Schwann cells. On wild type background, the expression of endogenous mCx32 was unaffected by the T55I mutant, but was partly impaired by R75W. Transgenic mice with the R75W mutation and all mutant animals with Gjb1-null background developed a progressive demyelinating peripheral neuropathy along with CNS myelination defects. These findings suggest that Cx32 mutations result in loss of function in myelinated cells without trans-dominant effects on other GJ proteins. Loss of Cx32 function alone in the CNS causes myelination defects.

Keywords: Charcot-Marie-Tooth disease, neuropathy, CMT1X, gap junction, protein trafficking, myelin

Introduction

Gap junctions (GJs) are channels that allow the diffusion of ions and small molecules across apposed cell membranes (Bruzzone et al., 1996). In rodents, there are 20 connexin genes, each of which is expressed in subsets of cell types (Willecke et al., 2002). Rodent oligodendrocytes express connexin32 (Cx32) (Scherer et al., 1995), Cx47 (Menichella et al., 2003; Odermatt et al., 2003), and Cx29 (Altevogt et al., 2002). Cx32 is expressed mostly by white matter oligodendrocytes and is localized in the myelin sheath of large diameter fibers, whereas Cx47 is expressed by both white and grey matter oligodendrocytes and forms GJs on cell bodies and proximal processes. Cx29 (Altevogt and Paul, 2004; Kleopa et al., 2004; Li et al., 2004; Kamasawa et al., 2005) and its human ortholog Cx31.3 (Sargiannidou et al., 2008) appear to be restricted to oligodendrocytes that myelinate small caliber fibers, likely forming hemichannels. Cx32 and Cx29 are also expressed by Schwann cells (Scherer et al., 1995; Altevogt et al., 2002).

Cx32 and Cx47 have partially overlapping functions in oligodendrocytes, because mice deficient for either Cx32 or Cx47 develop minimal CNS pathology, whereas double knockout mice develop severe CNS demyelination (Scherer et al., 1998; Menichella et al., 2003; Odermatt et al., 2003). Both connexins likely mediate GJ coupling of oligodendrocytes to astrocytes through heterotypic coupling - Cx32:Cx30 and Cx47:Cx43 (Nagy et al., 2003; Kamasawa et al., 2005; Orthmann-Murphy et al., 2007b). Cx32 also forms most autologous GJs within the myelin sheath (Rash et al., 2001; Nagy et al., 2003; Altevogt and Paul, 2004; Kamasawa et al., 2005). This network of GJs may serve the spatial buffering of K+ elaborated during the propagation of action potentials (Kamasawa et al., 2005; Menichella et al., 2006). The importance of this network in humans is supported by the finding that recessive mutations in GJC2/GJA12 encoding Cx47 cause Pelizeaus-Merzbacher-like disease, a severe dysmyelinating disorder of the CNS (Uhlenberg et al., 2004; Bugiani et al., 2006; Orthmann-Murphy et al., 2007a).

Hundreds of mutations in GJB1 (encoding Cx32) cause the X-linked form of Charcot-Marie-Tooth disease (CMT1X) (http://www.molgen.ua.ac.be/CMTMutations/default.cfm), a demyelinating peripheral neuropathy (Bergoffen et al., 1993). Evoked potentials demonstrate mild conduction slowing in most patients, indicating subclinical involvement of CNS myelinated axons (Nicholson and Corbett, 1996; Nicholson et al., 1998; Bähr et al., 1999). A subset of Cx32 mutations also cause clinical CNS manifestations including spasticity, hyperactive reflexes, extensor plantar responses, ataxia, or acute reversible encephalopathy (Kleopa et al., 2002; Paulson et al., 2002; Taylor et al., 2003; Kleopa and Scherer, 2006). When expressed in vitro, many of the Cx32 mutants, including all the ones associated with CNS phenotypes, are localized intracellularly in the Golgi or endoplasmic reticulum (ER), with reduced or absent formation of GJ plaques at the cell membrane (Omori et al., 1996; Deschênes et al., 1997; Oh et al., 1997; VanSlyke et al., 2000; Kleopa et al., 2002; Yum et al., 2002; Kleopa et al., 2006). Their intracellular localization raises the possibility of trans-dominant effects on co-expressed GJ proteins, especially Cx47 in oligodendrocytes. However, previously generated Cx32 transgenic mice expressed mutations only in Schwann cells (Huang et al., 2005; Jeng et al., 2006), leaving the cellular mechanisms underlying these CNS phenotypes in CMT1X unclear. Therefore, we generated transgenic mice expressing the T55I and R75W Cx32 mutations in both CNS and PNS. These mutations were chosen because they have been associated with prominent CNS phenotypes preceding the diagnosis of CMT1X (Panas et al., 2001; Taylor et al., 2003), and their in vitro cellular expression is representative of most Cx32 mutants, including ER (T55I) and Golgi (R75W) retention (Kleopa et al., 2002; Yum et al., 2002). Progressive demyelinating neuropathy and mild CNS myelination defects resulted mostly from loss of Cx32 function, and these Cx32 mutants had no discernable effects on either Cx47 or Cx29.

Materials and Methods

Generating transgenic mice

Transgenic Construct

The human T55I and R75W mutations were generated by site-directed mutagenesis using the QuickChange kit (Stratagene, La Jolla, CA) with mutagenic oligonucleotide primers and PfuTurbo DNA polymerase as previously described (Kleopa et al., 2002; Yum et al., 2002). The human GJB1 open reading frame (ORF) sequence (including the T55I or R75W mutants) along with the downstream IRES-EGFP sequence was amplified by PCR from pIRES2-EGFP construct using the primers PSLN-CLA-F (5’-TA GGATGCATATGGCGGCCGCCTGCAGCTGGCGCC-3’) and PSLN-SAL-R (5’-AGCT TGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGT-3’). This fragment was ligated downstream of the mouse 2',3'-cyclic nucleotide phosphodiesterase (CNP) promoter in the pBluescript SK+ vector at the ClaI and SalI sites. The 3.9 kb mouse Cnp promoter (gift from Dr. Vittorio Gallo, Children's National Medical Center, Washington, DC) has been shown to drive expression of lacZ (Gravel et al., 1998) and EGFP (Yuan et al., 2002) both in myelinating Schwann cells and oligodendrocytes. The orientation and the in-frame positioning were confirmed by sequencing analysis. DNA was isolated using Qiagen MaxiPrep kit and the transgene cassette (Fig. 1A) was released from vector sequences by digestion with SalI and AlwNI.

Figure 1
A. The structure of the transgene used to express Cx32 in myelinating cells. The 3.9 kb mouse Cnp promoter is joined upstream of the exon 2 (which contains the ORF) of the human GJB1 gene. The IRES-EGFP sequence was cloned downstream of the GJB1 exon ...

The fragment was isolated, purified and microinjected into the male pronucleus of fertilized oocytes obtained from C57BL/6 mice according to standard protocols. Transgenic progeny was identified by PCR of genomic tail DNA with transgene-specific primers: Cnp1F (5’-TGTGGCTTTGCCCATACATA-3’) and Cx32R (5’-CGCTGTTGCAGCCAGGCTGG-3’) resulting in a 732bp PCR product (94°C × 5 min, 40 cycles of 94°C × 30 sec, 57°C × 30 sec, 72°C × 30 sec and then 72°C × 7 min) (Fig. 1B–I). Potential founders gave rise to transgenic lines, and each line was screened for the expression of EGFP using immunostaining, FACS analysis of trypsinized brain cells, and immunoblot analysis of tissue lysates (Suppl. Fig. 1 and data not shown).

The transgenic lines with best expression for each Cx32 mutation were further expanded for analysis. In addition, in order to generate transgenic mice on Gjb1-null background, male transgenic mice expressing either the T55I or the R75W mutation were bred with female heterozygous Gjb1-null mice (C57BL/6×129) obtained from the European Mouse Mutant Archive, Monterotondo, Italy (originally generated by Prof. Klaus Willecke, University of Bonn). In these mice, the neor gene was inserted in frame into the exon 2 of Gjb1 gene which contains the ORF (Nelles et al., 1996). Genotypes of the offspring were determined using a triple-PCR screening with transgene specific primers (above, Fig. 1B–I), as well as primers for the neor gene (Gjb1- null) (Fig. 1B–II, Exon1F: 5’-GACCACTCCCCCTACACAGA-3’; NeoR2: 5’-CTCGTCCTGCAGTTCATTCA-3’) resulting in a 721 bp PCR product (94°C × 5 min, 35 cycles of 94°C × 30 sec, 56°C × 30 sec, 72°C × 30 sec and then 72°C × 7 min); and primers specific for the wild type (WT) Gjb1 mouse gene (Fig. 1B–III, Exon1F and Cx32R, above).

Reverse transcription-polymerase chain reaction (RT-PCR)

Total RNA was isolated from snap-frozen brains using the TRIZOL reagent (Invitrogen), according the manufacturer’s protocol. DNase I (New England Biolabs) treatment was performed and the RNA was quantified by spectrophotometry. 0.5 µg RNA was used for the synthesis of cDNA by the Taqman Reverse transcription reagents (Applied Biosystems). The cDNA was PCR amplified using primers F (5’-TGAGGCAGGATGAACTGGACAGGT-3’) and R (5’-CACGAAGCAGTCCACTGT-3’) that amplify both endogenous/mouse and transgenic/human Cx32, resulting in a 553 bp PCR product (94°C × 5 min, 40 cycles of 94°C × 30 sec, 60°C × 30 sec, 72°C × 30 sec and then 72°C × 7 min). Digestion of the RT-PCR product with MscI (cuts specifically in the human GJB1 ORF) or HhaI (cuts specifically in the mouse Gjb1 ORF) allowed us to determine the relative mRNA levels of endogenous/mouse and transgenic/human Cx32 (Fig. 1C).

Immunoblot Analysis

Fresh tissues were lysed in ice-cold RIPA buffer (10 mM sodium phosphate pH 7.0, 150 mM NaCl, 2 mM EDTA, 50 mM sodium fluoride, 1% NP-40, 1% sodium deoxycholate, and 0.1% SDS) containing a cocktail of protease inhibitors (Roche, Germany). Proteins (50 µg) from tissue lysates were fractionated by 12% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to a Hybond-C extra membrane (Amersham), using a semi-dry transfer unit (Amersham). Nonspecific sites on the membrane were blocked with 5% non-fat milk in Tris-buffered saline containing 0.1% Tween 20 (TBS-T) for 1 h at RT. Immunoblots were then incubated with either mouse monoclonal anti-Cx32 antibodies (Santa Cruz, diluted 1:500; Zymed, 1:1000; 7C6.C7, 1:10) or with rabbit antisera against Cx32 (#918, diluted 1:10,000; (Ahn et al., 2008), EGFP (Abcam; diluted 1:10,000), Cx47 (1:20,000; (Orthmann-Murphy et al., 2007a), or Cx29 (Zymed, 1:500) in 5% milk-TBS-T, at 4°C overnight. In order to reduce non-specific binding, the rabbit antiserum against Cx32 (#918) was pre-incubated with Gjb1-null tissue lysate. Briefly, brain and liver tissue from Gjb1-null mice was homogenized in RIPA buffer. The homogenate was incubated in acetone and after a spin the pellet was air dried. The Cx32 antiserum was pre-incubated with this powder for 1 h at RT before immunoblotting. After washing, immunoblots were incubated with an anti-mouse or anti-rabbit HRP-conjugated secondary antiserum (Jackson ImmunoResearch, diluted 1:5,000 and 1:10,000 respectively) in 5% milk-TBS-T, for 1 h. The bound antibody was visualized by enhanced chemiluminescence system (ECL Plus, Amersham).

Immunohistochemistry

Four-month old mice from all genotypes were anesthetized with Avertin according to institutionally approved protocols and then transcardially perfused with phosphate-buffered saline (PBS) followed by fresh 4% paraformaldehyde (PFA) in 0.1 M PBS. Tissues were harvested and further fixed for 30 min and then cryoprotected in 20% sucrose in PBS overnight. Ten µm thick sections were thaw-mounted onto glass slides, permeabilized in cold acetone (−20°C for 10 min), and incubated at room temperature (RT) with blocking solution of 5% bovine serum albumin (BSA) containing 0.5% Triton-X for 1 h. The primary antibodies diluted in blocking solution were incubated overnight at 4°C - mouse monoclonal antibodies against Cx32 (Zymed, 1:50), Cx47 (Zymed, 1:500), GFAP (Sigma, 1:200), RIP (Chemicon, 1:1,200), NeuN (Chemicon, 1:400), and MBP (Abcam, 1:500) as well as rabbit antisera against Cx47 (Invitrogen, 1:500), Cx29 (Zymed, 1:300), and EGFP (Invitrogen, 1:2,000). Sections were then washed in PBS and incubated with fluorescein- and rhodamine-conjugated donkey cross-affinity purified secondary antibodies (Jackson ImmunoResearch, 1:100) for 1 h at RT. Cell nuclei were visualized with 4′,6′-diamidino-2-phenylindole (DAPI; Sigma-Aldrich). Slides were mounted with Dako Fluorescent Mounting Medium and images were photographed under a Zeiss fluorescence microscope with a digital camera using the Zeiss Axiovision software (Carl Zeiss MicroImaging, Germany). Where appropriate, we obtained images with comparable exposure times to allow better comparison between different genotypes.

Electron microscopy

Following anesthesia, two-, four- and eight-month old mice from all genotypes as well as WT littermates were transcardially perfused with 2.5% glutaraldehyde in 0.1M PB and the lumbar spinal cords as well as the femoral, sciatic and optic nerves were dissected and further fixed overnight at 4°C, then osmicated, dehydrated, and embedded in Araldite resin. Transverse semi-thin sections (1 µm) were obtained and stained with alkaline toluidine blue. Ultrathin sections (80–100 nm) were counterstained with lead citrate and uranyl acetate before being examined in a JEOL JEM-1010 transmission electron microscope (JEOL Ltd, Tokyo, Japan).

Morphometric Analysis

Semi-thin sections of femoral and sciatic nerves as well as anterior lumbar roots were visualized with 20× and 63× objective lenses and captured with AxioHR camera. Images of whole nerve transverse sections were obtained at a 200× final magnification; a series of partially overlapping fields covering the cross-sectional area of the nerve were captured at a 630x final magnification. Electron micrographs of optic nerve and spinal cord were obtained and scanned, and overlapping images were transferred to a computer and used for analysis. Morphometrical data were collected using ImageJ 1.4 (NIH). The cross-sectional area of approximately 90 myelinated fibers and their axons (randomly picked, irrespective of their size) was measured for each femoral and sciatic nerve. This was achieved by identifying the borders of each myelinated fiber and its respective axon after defining a threshold gray-scale level for axons and myelin profiles. The diameters of each fiber and the respective axon were obtained using the formula: Diameter = 2 × √(area / π). We obtained the g-ratios by dividing the axonal diameter by the fiber diameter. Axons were classified into 3 categories according to their diameters: 1–2.99 µm, small; 3–6.99 µm, medium; ≥7 µm, large.

We also examined the degree of abnormal myelination in transverse semi-thin sections of the femoral nerve in all transgenic lines. All demyelinated, remyelinated, and normally myelinated axons were counted using the following criteria: axons larger than 1 µm without a myelin sheath were considered demyelinated; axons with myelin sheaths that were <10% of the axonal diameter and/or axons that were surrounded by “onion bulbs” (circumferentially arranged Schwann cell processes and extracellular matrix) were considered remyelinated; the other myelinated axons were considered normally myelinated.

Furthermore, we measured the CNS myelin fraction in semi-thin sections of the spinal cord dorsal and ventral funiculus and in ultrathin sections of the optic nerve in each transgenic line using a modified method to estimate the density of myelinated fibers and myelin sheaths (Tang and Nyengaard, 1997; Sutor et al., 2000). Images of semi-thin sections captured at 630x final magnification following the same processing and microscopy settings (above) were imported into Photoshop (Adobe Systems, San Jose, CA) and a transparent counting grid was placed on the image. All intersections of the grid lines hitting white matter, myelinated fibers and myelin sheaths were counted separately. The volume density of the myelinated fibers in the white matter Vv(nf/wm) was estimated with the formula:

equation M1

where ΣP(nf) is the total number of points hitting myelinated fibers in the white matter, and ΣP(wm) is the total number of points hitting white matter. The volume density of the myelin sheaths in the white matter Vv(m/wm) was estimated with the formula:

equation M2

where ΣP(m) is the total number of points hitting the myelin sheaths in the white matter. On average, 392 or more points hitting the white matter (n=2 or 3 different sections) per animal were counted.

Statistical analysis

We compared the proportion of abnormally myelinated fibers in femoral motor nerves from different genotypes as well as the volume density of myelin in the lumbar spinal cord dorsal and ventral funiculi with the Mann-Whitney test (significance level: p=0.05) using the Minitab 15 statistical software.

Results

Generation of Cx32 mutant mice on wild type and Gjb1-null background

We used a mouse Cnp promoter to drive the expression of T55I and R75W mutants in myelinating glia (Gravel et al., 1998; Yuan et al., 2002). Three T55I (24, 30 and 32) and two R75W (3 and 17) lines with stable transmission of the transgene were identified by PCR of genomic DNA (Fig. 1A&B). Because Cx32 antibodies do not distinguish transgenic/human Cx32 protein from endogenous/mouse Cx32, we immunoblotted and immunostained tissues for EGFP, which is expressed from an IRES in the transgene (Suppl. Fig. 1). In all transgenic lines, both Schwann cells and oligodendrocytes expressed EGFP, but expression was higher in the T55I-30 and R75W-3 lines, which were used for all experiments in this report (hereafter designated as T55I and R75W). By immunoblotting, the total level of Cx32 in the T55I and R75W lines on a WT background was only mildly increased compared to WT animals (Fig. 1D), indicating that mutant Cx32 protein was not grossly overexpressed. This was repeated at least 3 times, using both spinal cord and brain samples, with similar results.

We investigated these issues further by crossing transgene-positive (TG+) male mice with Gjb1- knockout (KO) females, producing equal proportions of TG+ and TG male progeny on a KO background (hereafter designated KO T55I and KO R75W). We compared the expression of Cx32 mRNA from adult brains with RT-PCR, combined with restriction enzymes specific for the cDNA derived from the transgenic/human construct or the endogenous/mouse Gjb1 gene (Scherer et al., 2005; Jeng et al., 2006). This analysis showed that transgenic mice had 2-3-fold higher levels of Cx32 mRNA than did WT mice (Fig. 1C). This was performed twice with similar results. No obvious behavioral abnormalities were observed in Cx32 mutant mice either on WT or KO background for up to 18 months old.

Oligodendrocytes and Schwann cells express Cx32 mutants

To determine whether the transgene was specifically expressed in oligodendrocytes, we immunostained different CNS areas (including spinal cord, brainstem, cerebellum, cerebrum, and optic nerve) with antibodies to EGFP, combined with cell markers for oligodendrocytes (RIP), astrocytes (GFAP), and neurons (NeuN). EGFP colocalized with RIP in oligodendrocytes, but was distinct from GFAP- or NeuN-positive cells (Fig. 2A–C and data not shown). To determine the extent of transgene expression, we double labeled sections from the same CNS areas with antibodies to Cx47, which is expressed in the cell bodies of most if not all oligodendrocytes (Menichella et al., 2003; Odermatt et al., 2003; Kleopa et al., 2004). In multiple CNS regions, for both T55I and R75W lines, almost all Cx47-positive cells also expressed EGFP, on both a WT and a KO background (Fig. 2D–F and Suppl. Fig. 2). This was repeated at least 3 times per line, with similar results. EGFP expression was also localized to the perinuclear cytoplasm of myelinating Schwann cells in both T55I and R75W lines (Suppl. Fig. 3). Immunoblot analysis of CNS and sciatic nerve lysates confirmed that EGFP was expressed in transgenic but not in WT or KO mice, and at similar levels between the selected T55I and R75W lines (Fig. 1D), in keeping with the RT-PCR results.

Figure 2
Expression of the transgene in oligodendrocytes of CMT1X mice

T55I and R75W mutants are localized in the perinuclear cytoplasm

The above analysis demonstrated that the transgene was widely expressed. To determine whether the mutant proteins themselves were expressed, we examined their localization in KO T55I and KO R75W mice. In both lines, Cx32-immunoreactivity was detected in the perinuclear cytoplasm of oligodendrocytes throughout the CNS, including the white and gray matter of the spinal cord, brainstem, cerebellum, cerebrum, corpus callosum, and optic nerve (Fig. 3, Suppl. Fig. 4&Suppl. Fig. 5, and data not shown). Thus, like EGFP, almost all oligodendrocytes expressed the mutant Cx32, including a subpopulation that normally lack Cx32-immunoreactivity, such as oligodendrocytes in the corpus callosum and optic nerve (Kleopa et al., 2004). Furthermore, in all of these locations, GJ plaques were not seen, indicating that neither T55I nor R75W traffic properly to the cell membrane, as in transfected cells (Kleopa et al., 2002; Yum et al., 2002). Compared to the T55I mutant, the R75W mutant appeared to have stronger cytoplasmic staining in most CNS areas (Fig. 3&Fig. 4 and data not shown); this was also seen by immunoblot analysis - KO R75W mice had more Cx32 than did KO T55I mice (Fig. 1D and data not shown). Given the comparable levels of Cx32 mRNA expression in the two lines (Fig. 1C), these findings suggest that oligodendrocytes more rapidly degrade the T55I mutant.

Figure 3
Mutant Cx32 does not alter the localization of other gap junction proteins in oligodendrocytes
Figure 4
The R75W mutant but not the T55I mutant alters the expression of endogenous mCx32 on WT background

T55I and R75W mutants do not affect the expression of Cx29 and Cx47

To determine whether T55I and R75W affect the localization of other connexins, we double labeled for Cx32 and Cx47 or Cx29. In all CNS regions we examined, Cx47 formed GJ plaques at the perikarya and proximal processes of all oligodendrocytes comparable to KO or WT mice (Fig. 3, Suppl. Fig. 4 and data not shown). Similarly, Cx29 was normally localized along thinly myelinated fibers in the spinal cord white matter, brainstem, cerebellum, corpus callosum, and optic nerves comparable to KO or WT mice (Fig. 3, Suppl. Fig. 5 and data not shown). Furthermore, immunoblot analysis of CNS tissues showed comparable levels of Cx47 and Cx29 in T55I and R75W mutants, Gjb1- null mice, and WT mice (Fig. 6 and data not shown). These immunostaining and immunoblot experiments were repeated at least 3 times per line, with similar results. Thus, neither mutant appeared to have a trans-dominant effect on other connexins expressed by oligodendrocytes.

Figure 6
Cx32 mutants do not affect the expression of other gap junction proteins in myelinating cells

We also examined these mutations on a WT background to look for possible dominant effects of T55I and R75W on endogenous/mouse Cx32. As previously described (Kleopa et al., 2004), Cx32 immunoreactivity in WT mice was most prominent along large myelinated fibers of the white matter and in gray matter oligodendrocytes - forming GJ plaques in cell bodies and proximal processes (Fig. 4A–E, Suppl. Fig. 6 and data not shown). This expression pattern was also found in the T55I mutant mice (Fig. 4F–J, Suppl. Fig. 6 and data not shown). In contrast, the R75W mutant mice had diminished Cx32-positive GJ plaques in most CNS white matter areas in which Cx32 expression is normally prominent, including the myelinated tracts in the spinal cord, the medial longitudinal fasciculus (MLF), the cerebellar white matter, and the lateral olfactory tract (Fig. 4K–O, Suppl. Fig. 6I–L, and data not shown). Because total Cx32 was not reduced in R75W spinal cord and brain compared to the T55I mutant or WT mice (Fig. 1D and data not shown), these findings suggest that the R75W mutant retains endogenous WT Cx32 in the perinuclear cytoplasm, where R75W is found in KO mice. In contrast, the localization of Cx47 and Cx29 did not appear to be perturbed in the R75W mutant line (Fig. 4, Suppl. Fig. 6, and data not shown), indicating that the R75W mutant may specifically affect the localization of Cx32.

We also examined these issues in myelinating Schwann cells. As in oligodendrocytes, T55I and R75W were localized in the perinuclear cytoplasm in the KO T55I and KO R75W lines and did not form GJ plaques at paranodes and incisures (Fig. 5) – where Cx32 is normally localized (Scherer et al., 1995). As in oligodendrocytes, there appeared to be more perinuclear Cx32-immunoreactivity in the KO R75W than in the KO T55I mutant mice; this was supported by immunoblot analysis, suggesting that the T55I mutant was more rapidly degraded (Fig. 1D and data not shown). In a WT background, R75W (but not T55I) reduced Cx32 immunoreactivity at the paranodes and incisures (Fig. 5F), whereas the total amount of Cx32 in immunoblots of sciatic nerves lysates was unchanged (Fig. 1D), suggesting that, as in oligodendrocytes, the R75W mutant retains endogenous WT Cx32 in the perinuclear cytoplasm. Neither T55I nor R75W appeared to alter the localization of Cx29 in either a KO or a WT background (Fig. 5), and the amount of Cx29 was unchanged (Fig. 6). Thus, as in oligodendrocytes, the R75W but not the T55I mutant has dominant effects on the endogenous Cx32, but neither T55I nor R75W impairs the expression of Cx29.

Figure 5
Cx32 mutants do not affect the expression of Cx29 in Schwann cells but the R75W mutant alters the expression of endogenous Cx32

T55I and R75W mutant mice develop progressive demyelinating neuropathy and a subtle CNS myelin defect

To determine whether T55I or R75W affects myelination, we examined epoxy sections from peripheral nerves (sciatic and femoral), spinal cord, and optic nerves from T55I and R75W mice in a WT and a KO background at 2, 4 and 8 months of age (Fig. 7 and Fig. 8). On a WT background, the R75W but not the T55I mice have more abnormally myelinated femoral motor fibers (either demyelinated or remyelinated) compared to WT mice (Table 1 and Fig. 7G). On a KO background, both KO T55I and KO R75W mutants have more abnormally myelinated fibers than do KO mice (Table 1 and Fig. 7H). While g-ratios were not significantly different between T55I and R75W and WT controls, or KO T55I and KO R75W and KO mice, axon profiles obtained from sciatic nerves at 8 months of age indicated a reduction in the number of large caliber (>7 µm diameter) fibers in nerves from all KO lines as well as in the R75W mutant on WT background (Suppl. Fig. 7 and data not shown). Thus, the T55I and the R75W mutants may have deleterious effects beyond those of a null Gjb1 allele itself, and the R75W mutation appears to have a dominant effect.

Figure 7
Cx32 mutant mice develop a progressive demyelinating peripheral neuropathy
Figure 8
Spinal cord myelination defects in Cx32 mutant mice
Table 1
Quantitative analysis of abnormally myelinated fibers in the femoral motor nerve from different age groups on wild type and cx32-null background

Light and electron microscopic examination of the optic nerve and lumbar spinal cord at 2, 4, and 8 months, did not reveal any abnormalities of CNS myelin (Suppl. Fig. 8A–B and data not shown). Even the g-ratios of 8-month old mice showed no significant differences between genotypes in these two CNS areas (Suppl. Fig. 8C and data not shown). Based on the work of Sutor et al. (2000), we also measured the volume density of myelin in the dorsal and ventral funiculus in sections of lumbar spinal cord from all 8-month old mice in each line. This analysis showed that volume density of myelinated fibers was significantly reduced in KO mice as well as in KO T55I and KO R75W transgenic mice compared to WT mice (Table 2 and Fig. 8). Furthermore, the volume density of R75W mutants on a WT background was significantly reduced compared to WT or T55I mutants on WT background; in the ventral funiculus, this reduction approached that measured in the KO lines. At 4-months, however, there were no statistically significant differences in the myelin volume density between any of these genotypes in the spinal cord (data not shown). Furthermore, we found no significant differences in myelin volume density of the optic nerve (which has low expression of Cx32) between 8-month old mice from all lines either in a WT or a KO background (data not shown). Taken together, these results indicate that a loss of Cx32 in oligodendrocytes results in progressive myelination defects in white matter areas where Cx32 expression is physiologically prominent.

Table 2
Quantitative analysis of spinal cord myelination in 8-month old mice on wild type and cx32-null background

Discussion

We have generated the first transgenic mice that express Cx32 mutants in oligodendrocytes (in addition to Schwann cells), and find pathological changes in both cell types. In myelinating Schwann cells, R75W had dominant effects on endogenous Cx32 resulting in a mild demyelination in a WT background and a more severe demyelinating neuropathy in a KO background. In oligodendrocytes, the R75W but not the T55I mutant had subtle effects on CNS myelin in WT background, and both mutants had no additional effects in a KO background. Like a null allele of Gjb1, neither the T55I nor the R75W mutant appears to affect Cx29 or Cx47. Thus, the loss of Cx32 function appears to be the main effect of the T55I and R75W mutants, in both the PNS and the CNS.

T55I and R75W are mislocalized but do not have trans-dominant interactions with Cx29 or Cx47

We found that T55I and R75W are mislocalized in myelinating Schwann cells and oligodendrocytes. Thus, like the R142W, G280S, and S281x mutants (Huang et al., 2005; Jeng et al., 2006), the localization of T55I and R75W in heterologous cells (Kleopa et al., 2002; Yum et al., 2002) predicts their localization in myelinating Schwann cells, and as we show here (for T55I and R75W), in oligodendrocytes, too. In heterologous cells, many Cx32 mutants appear to be retained in the ER or Golgi (Kleopa et al., 2002; Yum et al., 2002). ER-retained mutants are probably misfolded, and are subsequently degraded by proteosomes (VanSlyke et al., 2000; Kleopa et al., 2002; Thomas et al., 2004). Why some mutants appear to be retained in the Golgi, however, is unknown, as the Golgi is not known to modify Cx32. Cx43 oligomerizes in the trans-Golgi network (Musil and Goodenough, 1993), whereas Cx32 can form hexamers in the ER (Maza et al., 2005). However, Cx32 is also prenylated (Huang et al., 2005), and this posttranslational modification is accomplished on the cytoplasmic surface of the ER and Golgi (Silvius, 2002; Wright and Philips, 2006).

Based on the finding that mice lacking both Cx32 and Cx47 have a much more severe phenotype than mice lacking either one alone (Menichella et al., 2003; Odermatt et al., 2003) we hypothesized that the Cx32 mutants that are associated with transient CNS phenotypes interact directly with Cx47. Further, because these “CNS mutants” appear to be retained in the ER or Golgi (Kleopa et al., 2002; Yum et al., 2002) we thought that they would interact directly with Cx47 and lead to its mislocalization in the ER/Golgi and diminish its localization at GJs. Neither the R75W mutant nor the T55I mutant, however, appeared to impair the expression of Cx29 or Cx47 in oligodendrocytes, or the expression of Cx29 in Schwann cells, extending the previous finding that R142W had no effect on the expression of Cx29 in Schwann cells (Jeng et al., 2006). Furthermore, our recent in vitro studies failed to show dominant effects of the same Cx32 mutants on Cx31.3, the human ortholog of Cx29 (Sargiannidou et al., 2008). Whereas we could show that mostly the R75W had dominant effects on WT Cx32, this effect is not clinically relevant, since only one GJB1 allele is expressed in each cell (Scherer et al., 1998). These results suggest that T55I and R75W cause loss of Cx32 function and do not have trans-dominant effects on Cx47 or Cx31.3.

The lack of trans-dominant effects of Cx32 mutants is in keeping with the evidence that Cx29 and Cx32 are distinctly localized in myelinating glia (Kleopa et al., 2004), and do not appear to interact in vitro (Ahn et al., 2008). Similarly, Cx32 and Cx47 show only partial overlap in oligodendrocytes (Kleopa et al., 2004) and to not appear to interact in vitro (unpublished observations). The lack of interaction between Cx32 and Cx29 is in keeping with the findings that Cx29 is normally localized in Cx32 KO mice (Meier et al., 2004) and Cx32 is normally localized in Cx29 KO (Altevogt and Paul, 2004). Here, we do not find an altered expression of Cx29 or Cx47 in the CNS of Cx32 KO mice, in keeping with previous observations (Nagy et al., 2003).

The best examples of trans-dominant effects between a mutant connexin and a different WT connexin are for those connexins that normally oligomerize to form heteromeric hemichannels, such as Cx31 and Cx30.3 in the skin (Plantard et al., 2003) and Cx26 and Cx30 in the ear (Forge et al., 2003; Marziano et al., 2003; Yum et al., 2007). Trans-dominant selectivity of different Cx26 mutants (Thomas et al., 2004) and the cell-specific pattern of connexin expression (Das Sarma et al., 2001) may account for some of the complicated phenotypes observed with dominant Cx26 mutants associated with hearing loss and various skin disorders. Although there are examples of trans-dominant interactions between compatible connexins forming heteromeric hemichannels, it remains to be shown that a disease results from dominant interactions of a mutant with a different WT connexin that does not normally interact.

Pathological effects of T55I and R75W in the PNS and CNS

A demyelinating neuropathy was the major pathological finding in our transgenic mice. In Schwann cells, its effects were similar to those described in transgenic mice expressing the R142W mutant exclusively in Schwann cells (Jeng et al., 2006) - a demyelinating neuropathy that predominantly affects motor axons, starting after 2 months of age and progressing with time, but always milder than that seen in KO mice (Anzini et al., 1997; Scherer et al., 1998; Scherer et al., 2005). In a KO background, the R75W mutant appeared to be retained in the perinuclear cytoplasm, and did not accumulate in the incisures and paranodes; in a WT background, the R75W resulted in diminished Cx32 (presumably WT Cx32) in the incisures and paranodes. Both of these effects were found for R142W (Jeng et al., 2006).

The CNS myelin defects, in contrast, were subtle. In both the T55I and R75W mutants in a KO background, and to a lesser degree in R75W mutants in WT background, the chief finding was a diminished myelinated fiber and myelin volume density, particularly in white matter areas with prominent Cx32 expression, such as the ventral and dorsal funiculus of the spinal cord (Kleopa et al., 2004). Similar abnormalities were previously described in the neocortex of Cx32 KO mice that were over 6 months old (Sutor et al., 2000). How the loss of Cx32 function leads to these CNS myelination defects remains unknown. They could result from a cell autonomous role of Cx32 in the myelin sheath itself (e.g., transport of metabolites used to synthesize the myelin sheath) or they could depend on astrocyte-oligodendrocyte interactions that are mediated by heterotypic Cx30:Cx32 channels (Nagy et al., 2003; Altevogt and Paul, 2004). We did not detect any frank pathological changes in CNS myelin or g-ratio alterations in our mutant mice, in keeping with previous observations in the neocortex (Sutor et al., 2000) and in the optic nerve (Scherer et al., 1995) of Cx32 KO mice. Reduced myelin density may result from a combination of changes including a shift to smaller diameter axons, mild reduction of myelin thickness, and mild reduction in the number of myelinated axons (Sutor et al., 2000). During development, Cx32 expression in the CNS starts around postnatal day 5–7 and peaks around postnatal day 20 (Dermietzel et al., 1989; Scherer et al., 1995; Nadarajah et al., 1997). This course matches that of oligodendrocyte differentiation and onset of myelination around postnatal day 10 (Parnavelas et al., 1983), suggesting that Cx32 may be involved in the maturation of CNS myelin sheaths. However, we found significant abnormalities in Cx32 KO mice at 8 but not at 4 months of age, which indicates that degenerative mechanisms likely contribute to these CNS myelination defects.

Although less severe, the PNS and CNS alterations caused by the R75W mutant in WT background are similar to those found in KO mice, and indicate that this mutant has dominant-negative effects on WT Cx32. The immunostaining of Cx32 protein in the PNS and CNS directly support this interpretation. The immunoblot analysis indicates that the T55I mutant is degraded to a much higher degree than the R75W mutant, thus the retained R75W mutant is more likely to interact with WT Cx32 and reduce its trafficking to the cell membrane. The exacerbated demyelinating neuropathy found in T55I KO and especially in R75W KO mice, however, cannot be the result of a dominant-negative effect on Cx32. The R142W mutant has similar effects (Jeng et al., 2006), but how R75W and R142W exacerbate demyelination in KO mice remains unknown. Impairment of Golgi dynamics due to retention is unlikely since in the R142W mutants (Jeng et al., 2006) as well as in our mice no obvious effects were detected in the synthesis or trafficking of other proteins, including Cx29. Another consideration is that overexpression of the transgene may have non-physiological toxic effects, and the effects of similarly expressed WT Cx32 in KO oligodendrocytes remain to be determined. Overexpression of WT Cx32 in Schwann cells at levels 12-fold higher than the endogenous expression caused myelin splitting without demyelination, but these changes were not seen in mice with 6- to 7-fold expression levels (Jeng et al., 2006). Thus, it is unlikely that overexpression of the transgene in our mice at levels 2–3 fold of the endogenous could have contributed significantly to the pathology we describe in addition to mutation-specific effects.

Clinical correlations

Our results do not support the idea that dominant-negative effects play a role in the pathogenesis of CMT1X, either in the peripheral nerves or in the CNS. This conclusion is in keeping with results of a large clinical study of CMT1X patients with various mutations, including the deletion of the GJB1 gene, who had a similar phenotype, suggesting that most GJB1 mutations cause neuropathy through loss of normal Cx32 function (Shy et al., 2007). Furthermore, the relative severity of demyelinating or axonal features in peripheral nerve biopsies are not associated with particular GJB1 mutations (Hahn et al., 2000; Nakagawa et al., 2001; Hattori et al., 2003). If GJB1 mutations do not have clinically relevant dominant effects, then treatment for CMT1X may be feasible with gene replacement strategies. The mouse models presented here provide a useful tool to test such therapies.

Supplementary Material

Supp1

Supplementary Figure 1: Analysis of EGFP expression in transgenic lines:

These are images of teased sciatic fibers and sections of spinal cord white matter, from adult WT mice, as well as lines expressing T55I (24, 30, and 22) or R75W (3 and 17), immunostained with a rabbit antiserum against EGFP (A–L; red), as indicated. Cell nuclei are visualized with DAPI (blue). Each line has cytoplasmic EGFP-immunoreactivity, albeit of different intensity, in a subset of CNS cells and in most Schwann cells. The T55I.30 and R75W.3 lines show the strongest reactivity both in CNS and PNS. EGFP-immunoreactivity is absent in WT PNS and CNS. Scale bar: 10 µm. In keeping with the immunostaining results, immunoblots show a ~27 kDa band in the sciatic nerve (M) of T55I.30 and R75W.3 lines, and in the brain (N) of T55I.30 and R75W.3 and R75W.17 lines, but not in other lines, indicating lower expression levels. Coomassie stained gels are shown under the blots.

Supp2

Supplementary Figure 2: Expression of the transgene in oligodendrocytes in different CNS areas of CMT1X mice on WT and Gjb1-null background:

These are images of sections of spinal cord (A, D, G, J), cerebellum (B, E, H, K), and corpus callosum (C, F, I, L), from T55I (T55I.30 line on WT background; A–C), R75W (R75W.3 line on WT background; D–F), KO T55I (T55I.30 line on Gjb1-null background; G–I) and KO R75W (R75W.3 line on Gjb1-null background; J–L) mice, as indicated. Sections were double labeled with antibodies to EGFP (red) and Cx47 (green). Cell nuclei are visualized with DAPI. In each transgenic line, almost all Cx47-positive oligodendrocytes in these regions expressed EGFP. WM: white matter; GCL: granule cell layer. Scale bar: 20 µm.

Supp3

Supplementary Figure 3: Expression of the transgene in peripheral nerves of CMT1X mice:

These are images of teased fibers from adult mice from the indicated transgenic lines (as in Suppl. Fig. 2) as well as WT and Cx32 KO mice, as indicated, labeled with an antiserum against EGFP (red). Schwann cell nuclei are visualized with DAPI (asterisks). EGFP is detected in the perinuclear cytoplasm in the transgenic lines both on WT and on KO background, but not in WT or KO mice. Scale bar: 10 µm.

Supp4

Supplementary Figure 4: Expression of Cx32 mutants on Gjb1-null background does not alter the localization of Cx47 in different CNS regions:

These are images of sections of adult mouse CNS - longitudinal optic nerve (A, D, G), as well as transverse sections of cerebellum (B, E, H) and spinal cord gray matter (C, F, I), from KO mice (A–C) as well as T55I (D–F) and R75W (G–I) mutant mice in a KO background, as indicated. Sections were double labeled with a mouse monoclonal antibody (green) against Cx32 and a rabbit antiserum (red) against Cx47. Cell nuclei are visualized with DAPI (blue). The Cx32-immunoreactivity (which is solely derived from the T55I and R75W mutants; D–I) is localized in the perinuclear cytoplasm of oligodendrocytes (asterisks), whereas Cx47 is localized to the perikarya and proximal processes, where it forms GJ plaques (red carets) as it does in Gjb1-null mice (A–C), in which no Cx32immunoreactivity is detected. GCL: granule cell layer; WM: white matter. Scale bars (including insets): 10 µm.

Supp5

Supplementary Figure 5: Expression of Cx32 mutants on Gjb1-null background does not alter the localization of Cx29 in different CNS regions:

These are images of sections of adult mouse CNS - longitudinal optic nerve (A, D, G), as well as transverse sections of cerebellum (B, E, H) and spinal cord gray matter (C, F, I), from KO mice (A–C) as well as T55I (D–F) and R75W (G–I) mutant mice in a KO background, as indicated. Sections were double labeled with a mouse monoclonal antibody (green) against Cx32 and a rabbit antiserum (red) against Cx29. Cell nuclei are visualized with DAPI (blue). Oligodendrocytes (asterisks) express T55I and R75W mutants (D–I), which are localized in the perinuclear cytoplasm in all CNS regions. In all cases, Cx29 is normally expressed along small myelinated fibers (arrows). GCL: granule cell layer; WM: white matter. Scale bar: 10 µm.

Supp6

Supplementary Figure 6: Expression of Cx32 mutants on WT background does not affect Cx29 expression, but the R75W mutant impairs the localization of endogenous Cx32:

These are images of sections of fixed CNS regions - spinal cord white matter (WM; A, E, I) and gray matter (GM; B, F, J), as well as cerebellum (C, G, K) and longitudinal optic nerve (D, H, L), from WT mice (A–D), as well as T55I (E–H) or R75W (I–L) mutant mice on a WT background. Sections were double labeled with a mouse monoclonal antibody (green) against Cx32 and a rabbit antiserum (red) against Cx29. Cell nuclei are visualized with DAPI (blue). In all CNS areas, the T55I and R75W mutants (E–L) are localized in the perinuclear cytoplasm of oligodendrocytes (asterisks). Compared to WT and T55I mutant mice, the myelinated axons of R75W mutant mice show much reduced Cx32-immunoreactivity, most evident in the spinal cord (I) and cerebellar (K) WM; their oligodendrocytes (asterisks) have fewer Cx32-positive GJ plaques and more Cx32-immunoreactivity. Cx29 is normally expressed along small myelinated fibers (red arrows) in all of these CNS areas; these are distinct from the larger, Cx32-positive fibers. Scale bar: 10 µm.

Supp7

Supplementary Figure 7: Sciatic nerve pathology in Cx32 mutant mice:

A–F: Photomicrographs of semi-thin sections of sciatic nerves from 8-month old WT (A), KO (D), as well as T55I and R75W Cx32 mutant mice on a WT (B–C) or a KO (E–F) background, as indicated. Myelinated axons appear normal in all mice on WT background (A–C), while there are demyelinated (*) and remyelinated axons (r) in all KO lines (D–F). Scale bar: 10 µm. G–L: Results of average gratio calculations (± standard deviation) from sciatic nerves of 8-month old mice including WT, KO, and Cx32 mutants on WT or a KO background. While there are no significant differences in the g-ratios, axon diameter profiles show a reduction in the number of large caliber (>7 µm diameter) axons in nerves from all KO lines as well as in the R75W mutant on WT background.

Supp8

Supplementary Figure 8: Preserved ultrastructure of CNS myelin in Cx32 mutant mice:

Electron microscopic images of ultrathin sections of optic nerve mid portions (A) and lumbar spinal cord dorsal columns (B) from 8-month old WT, KO, or T55I and R75W transgenic mice on WT or KO backgrounds, as indicated. Note normal structure of the myelin sheath without any morphological alterations in transgenic and KO mice. Scale bars: 1 µm. C. Average g-ratios (± standard deviation) measured in ultrathin sections of the optic nerve and dorsal columns from 8-month mice. There are no significant differences between genotypes.

Acknowledgments

This work was supported by the National Multiple Sclerosis Society (USA) (Grant RG3457A2/1 to KAK), the Cyprus Research Promotion Foundation (Grant to KAK), the Cyprus Telethon (Grant to KAK) and the NIH (RO1 NS55284 to SSS). We thank Dr. Vittorio Gallo for the Cnp promoter construct, Prof. Klaus Willecke for Gjb1-knockout mice and Ms. Thalia Michael for technical assistance.

References

  • Ahn M, Lee J, Gustafsson A, Enriquez A, Lancaster E, Sul J, Haydon P, Paul D, Huang Y, Abrams C, Scherer S. Cx29 and Cx32, two connexins expressed by myelinating glia, do not interact and are functionally distinct. J Neurosci Res. 2008;86:992–1006. [PMC free article] [PubMed]
  • Altevogt BM, Paul DL. Four classes of intercellular channels between glial cells in the CNS. J Neurosci. 2004;24:4313–4323. [PubMed]
  • Altevogt BM, Kleopa KA, Postma FR, Scherer SS, Paul DL. Connexin29 is uniquely distributed within myelinating glial cells of the central and peripheral nervous systems. J Neurosci. 2002;22:6458–6470. [PubMed]
  • Anzini P, Neuberg DH-H, Schachner M, Nelles E, Willecke K, Zielasek J, Toyka K, Suter U, Martini R. Structural abnormalities and deficient maintenance of peripheral nerve myelin in mice lacking the gap junction protein connexin32. J Neurosci. 1997;17:4545–4561. [PubMed]
  • Bähr M, Andres F, Timmerman V, Nelis E, Van Broeckhoven C, Dichgans J. Central visual, acoustic, and motor pathway involvement in a Charcot-Marie-Tooth family with an Asn205Ser mutation in the connexin32 gene. J Neurol Neurosurg Psychiat. 1999;66:202–206. [PMC free article] [PubMed]
  • Bergoffen J, Scherer SS, Wang S, Oronzi-Scott M, Bone L, Paul DL, Chen K, Lensch MW, Chance P, Fischbeck K. Connexin mutations in X-linked Charcot-Marie-Tooth disease. Science. 1993;262:2039–2042. [PubMed]
  • Bruzzone R, White TW, Paul DL. Connections with connexins: the molecular basis of direct intercellular signaling. Eur J Biochem. 1996;238:1–27. [PubMed]
  • Bugiani M, Al Shahwan S, Lamantea E, Bizzi A, Bakhsh E, Moroni I, Balestrini M, Uziel G, Zeviani M. GJA12 mutations in children with recessive hypomyelinating leukoencephalopathy. Neurology. 2006;67:273–279. [PubMed]
  • Das Sarma J, Meyer RA, Wang F, Abraham V, Lo CW, Koval M. Multimeric connexin interactions prior to the trans-Golgi network. J Cell Sci. 2001;114:4013–4024. [PubMed]
  • Dermietzel R, Traub O, Hwang TK, Beyer E, Bennett MVL, Spray DC, Willecke K. Differential expression of three gap junction proteins in developing and mature brain tissues. Proc Natl Acad Sci USA. 1989;86:10148–10152. [PubMed]
  • Deschênes SM, Walcott JL, Wexler TL, Scherer SS, Fischbeck KH. Altered trafficking of mutant connexin32. J Neurosci. 1997;17:9077–9084. [PubMed]
  • Forge A, Marziano NK, Casalotti SO, Becker DL, Jagger D. The inner ear contains heteromeric channels composed of cx26 and cx30 and deafness-related mutations in cx26 have a dominant negative effect on cx30. Cell Commun Adhes. 2003;10:341–346. [PubMed]
  • Gravel M, DiPolo A, Valera PB, Braun PE. Four-kilobase sequence of the mouse CNP gene directs spatial and temporal expression of lacZ in transgenic mice. J Neurosci Res. 1998;53:393–404. [PubMed]
  • Hahn AF, Ainsworth PJ, Naus CCG, Mao J, Bolton CF. Clinical and pathological observations in men lacking the gap junction protein connexin 32. Muscle Nerve. 2000:S39–S48. [PubMed]
  • Hattori N, Yamamoto M, Yoshihara T, Koike H, Nakagawa M, Yoshikawa H, Ohnishi A, Hayasaka K, Onodera O, Baba M, Yasuda H, Saito T, Nakashima K, Kira J, Kaji R, Oka N, Sobue G. Japan. SGfHNi. Demyelinating and axonal features of Charcot-Marie-Tooth disease with mutations of myelin-related proteins (PMP22, MPZ and Cx32): a clinicopathological study of 205 Japanese patients. Brain. 2003;126:134–151. [PubMed]
  • Huang Y, Sirkowski EE, Stickney JT, Scherer SS. Prenylation-defective human connexin32 mutants are normally localized and function equivalently to wild-type connexin32 in myelinating Schwann cells. J Neurosci. 2005;25:7111–7120. [PubMed]
  • Jeng LJ, Balice-Gordon RJ, Messing A, Fischbeck KH, Scherer SS. The effects of a dominant connexin32 mutant in myelinating Schwann cells. Mol Cell Neurosci. 2006;32:283–298. [PubMed]
  • Kamasawa N, Sik A, Morita M, Yasumura T, Davidson K, Nagy J, Rash J. Connexin-47 and connexin-32 in gap junctions of oligodendrocyte somata, myelin sheaths, paranodal loops and Schmidt-Lanterman incisures: Implications for ionic homeostasis and potassium siphoning. Neuroscience. 2005;136:65–86. [PMC free article] [PubMed]
  • Kleopa KA, Scherer SS. Molecular genetics of X-linked Charcot-Marie-Tooth disease. Neuromolecular Med. 2006;8:107–122. [PubMed]
  • Kleopa KA, Yum SW, Scherer SS. Cellular mechanisms of connexin32 mutations associated with CNS manifestations. J Neurosci Res. 2002;68:522–534. [PubMed]
  • Kleopa KA, Orthmann JL, Enriquez A, Paul DL, Scherer SS. Unique distribution of gap junction proteins connexin29, connexin32, and connexin47 in oligodendrocytes. Glia. 2004;47:346–357. [PubMed]
  • Kleopa KA, Zamba-Papanicolaou E, Alevra X, Nicolaou P, Georgiou D-M, Hadjisavvas A, Kyriakides T, Christodoulou K. Phenotypic and cellular expression of two novel connexin32 mutations causing CMT1X. Neurology. 2006;66:396–402. [PubMed]
  • Li X, Ionescu AV, Lynn BD, Lu S, Kamasawa N, Morita M, Davidson KGV, Yasumura T, Rash JE, Nagy JI. Connexin47, connexin29 and connexin32 co-expression in oligodendrocytes and Cx47 association with zonula occludens-1 (ZO-1) in mouse brain. Neuroscience. 2004;126:611–630. [PMC free article] [PubMed]
  • Marziano NK, Casalotti SO, Portelli AE, Becker DL, Forge A. Mutations in the gene for connexin 26 (GJB2) that cause hearing loss have a dominant negative effect on connexin 30. Hum Mol Genet. 2003;12:805–812. [PubMed]
  • Maza J, Das Sarma J, Koval M. Defining a minimal motif required to prevent connexin oligomerization in the endoplasmic reticulum. J Biol Chem. 2005;280:21115–21121. [PubMed]
  • Meier C, Dermietzel R, Davidson KG, Yasumura T, Rash JE. Connexin32-containing gap junctions in Schwann cells at the internodal zone of partial myelin compaction and in Schmidt-Lanterman incisures. J Neurosci. 2004;24:3186–3198. [PMC free article] [PubMed]
  • Menichella DM, Goodenough DA, Sirkowski E, Scherer SS, Paul DL. Connexins are critical for normal myelination in the CNS. J Neurosci. 2003;23:5963–5973. [PubMed]
  • Menichella DM, Majdan M, Awatramani R, Goodenough DA, Sirkowski E, Scherer SS, Paul DL. Genetic and physiological evidence that oligodendrocyte gap junctions contribute to spatial buffering of potassium released during neuronal activity. J Neurosci. 2006;26:10984–10991. [PubMed]
  • Musil LS, Goodenough DA. Multisubunit assembly of an integral plasma membrane channel protein, gap junction connexin43, occures after exit from the ER. Cell. 1993;74:1075–1077. [PubMed]
  • Nadarajah B, Jones AM, Evans WH, Parnavelas JG. Differential expression of connexins during neocortical development and neuronal circuit formation. J Neurosci. 1997;17:3096–3111. [PubMed]
  • Nagy JI, Ionescu AV, Lynn BD, Rash JE. Coupling of astrocyte connexins Cx26, Cx30, Cx43 to oligodendrocyte Cx29, Cx32, Cx47: Implications from normal and connexin32 knockout mice. Glia. 2003;44:205–218. [PMC free article] [PubMed]
  • Nakagawa M, Takashima H, Umehara F, Arimura K, Miyashita F, Takenouchi N, Matsuyama W, Osame M. Clinical phenotype in X-linked Charcot-Marie-Tooth disease with an entire deletion of the connexin 32 coding sequence. J Neurol Sci. 2001;185:31–36. [PubMed]
  • Nelles E, Butzler C, Jung D, Temme A, Gabriel H-D, Dahl U, Traub O, Stumpel F, Jungermann K, Zielasek J, Toyka KV, Dermietzel R, Willecke K. Defective propagation of signals generated by sympathetic nerve stimulation in the liver of connexin32-deficient mice. Proc Natl Acad Sci USA. 1996;93:9565–9570. [PubMed]
  • Nicholson G, Corbett A. Slowing of central conduction in X-linked Charcot-Marie-Tooth neuropathy shown by brain auditory evoked responses. J Neurol Neurosurg Psychiatry. 1996;61:43–46. [PMC free article] [PubMed]
  • Nicholson GA, Yeung L, Corbett A. Efficient neurophysiological selection of X-linked Charcot-Marie-Tooth families. Neurology. 1998;51:1412–1416. [PubMed]
  • Odermatt B, Wellershaus K, Wallraff A, Seifert G, Degen J, Euwens C, Fuss B, Bussow H, Schilling K, Steinhauser C, Willecke K. Connexin 47 (Cx47)-deficient mice with enhanced green fluorescent protein reporter gene reveal predominant oligodendrocytic expression of Cx47 and display vacuolized myelin in the CNS. J Neurosci. 2003;23:4549–4559. [PubMed]
  • Oh S, Ri Y, Bennett MVL, Trexler EB, Verselis VK, Bargiello TA. Changes in permeability caused by connexin 32 mutations underlie X-linked Charcot-Marie-Tooth disease. Neuron. 1997;19:927–938. [PubMed]
  • Omori Y, Mesnil M, Yamasaki H. Connexin 32 mutations from X-linked Charcot-Marie-Tooth disease patients: functional defects and dominant negative effects. Mol Biol Cell. 1996;7:907–916. [PMC free article] [PubMed]
  • Orthmann-Murphy JL, Enriquez AD, Abrams CK, Scherer SS. Loss-of-function connexin47 mutations cause Pelizaeus-Merzbacher-like disease. Mol Cell Neurosci. 2007a;34:629–641. [PMC free article] [PubMed]
  • Orthmann-Murphy JL, Freidin M, Fischer E, Scherer SS, Abrams CK. Two distinct heterotypic channels mediate gap junction coupling between astrocyte and oligodendrocyte connexins. J Neurosci. 2007b;27:13949–13957. [PubMed]
  • Panas M, Kalfakis N, Karadimas C, Vassilopoulos D. Episodes of generalized weakness in two sibs with the C164T mutation of the connexin 32 gene. Neurology. 2001;57:1906–1908. [PubMed]
  • Parnavelas JG, Luder R, Pollard SG, Sullivan K, Lieberman AR. A qualitative and quantitative ultrastructural study of glial cells in the developing visual cortex of the rat. Philos Trans R Soc Lond B Biol Sci. 1983;301:55–84. [PubMed]
  • Paulson HL, Garbern JY, Hoban TF, Krajewski KM, Lewis RA, Fischbeck KH, Grossman RI, Lenkinski R, Kamholz JA, Shy ME. Transient central nervous system white matter abnormality in X-linked Charcot-Marie-Tooth disease. Ann Neurol. 2002;52:429–434. [PubMed]
  • Plantard L, Huber M, Macari F, Meda P, Hohl D. Molecular interaction of connexin 30.3 and connexin 31 suggests a dominant-negative mechanism associated with erythrokeratodermia variabilis. Hum Mol Genet. 2003;12:3287–3294. [PubMed]
  • Rash JE, Yasumura T, Dudek FE, Nagy JI. Cell-specific expression of connexins and evidence of restricted gap junctional coupling between glial cells and between neurons. J Neurosci. 2001;21:1983–2000. [PMC free article] [PubMed]
  • Sargiannidou I, Ahn M, Enriquez AD, Peinado A, Reynolds R, Abrams CK, Scherer SS, Kleopa KA. Human oligodendrocytes express Cx31.3: function and interactions with Cx32 mutants. Neurobiol Dis. 2008;30:221–233. [PMC free article] [PubMed]
  • Scherer SS, Deschênes SM, Xu Y-T, Grinspan JB, Fischbeck KH, Paul DL. Connexin32 is a myelin-related protein in the PNS and CNS. J Neurosci. 1995;15:8281–8294. [PubMed]
  • Scherer SS, Xu Y-T, Nelles E, Fischbeck K, Willecke K, Bone LJ. Connexin32-null mice develop a demyelinating peripheral neuropathy. Glia. 1998;24:8–20. [PubMed]
  • Scherer SS, Xu YT, Messing A, Willecke K, Fischbeck KH, Jeng LJ. Transgenic expression of human connexin32 in myelinating Schwann cells prevents demyelination in connexin32-null mice. J Neurosci. 2005;25:1550–1559. [PubMed]
  • Shy ME, Siskind C, Swan ER, Krajewski KM, Doherty T, Fuerst DR, Ainsworth PJ, Lewis RA, Scherer SS, Hahn AF. CMT1X phenotypes represent loss of GJB1 gene function. Neurology. 2007;68:849–855. [PubMed]
  • Silvius JR. Mechanisms of Ras protein targeting in mammalian cells. J Membr Biol. 2002;190:83–92. [PubMed]
  • Sutor B, Schmolke C, Teubner B, Schirmer C, Willecke K. Myelination defects and neuronal hyperexcitability in the neocortex of connexin 32-deficient mice. Cereb Cortex. 2000;10:684–697. [PubMed]
  • Tang Y, Nyengaard JR. A stereological method for estimating the total length and size of myelin fibers in human brain white matter. J Neurosci Methods. 1997;73:193–200. [PubMed]
  • Taylor RA, Simon EM, Marks HG, Scherer SS. The CNS phenotype of X-linked Charcot-Marie-Tooth disease: more than a peripheral problem. Neurology. 2003;61:1475–1478. [PubMed]
  • Thomas T, Telford D, Laird DW. Functional domain mapping and selective trans-dominant effects exhibited by Cx26 disease-causing mutations. J Biol Chem. 2004;279:19157–19168. [PubMed]
  • Uhlenberg B, Schuelke M, Ruschendorf F, Ruf N, Kaindl AM, Henneke M, Thiele H, Stoltenburg-Didinger G, Aksu F, Topaloglu H, Nurnberg P, Hubner C, Weschke B, Gartner J. Mutations in the gene encoding gap junction protein alpha 12 (Connexin 46.6) cause Pelizaeus-Merzbacher-like disease. Am J Hum Genet. 2004;75:251–260. [PubMed]
  • VanSlyke JK, Deschênes SM, Musil LS. Intracellular transport, assembly, and degradation of wild-type and disease-linked mutant gap junction proteins. Mol Biol Cell. 2000;11:1933–1946. [PMC free article] [PubMed]
  • Willecke K, Eiberger J, Degen J, Eckardt D, Romualdi A, Guldenagel M, Deutsch U, Sohl G. Structural and functional diversity of connexin genes in the mouse and human genome. Biol Chem. 2002;383:725–737. [PubMed]
  • Wright LP, Philips MR. Thematic review series: lipid posttranslational modifications. CAAX modification and membrane targeting of Ras. J Lipid Res. 2006;47:883–891. [PubMed]
  • Yuan X, Chittajallu R, Belachew S, Anderson S, McBain CJ, Gallo V. Expression of the green fluorescent protein in the oligodendrocyte lineage: a transgenic mouse for developmental and physiological studies. J Neurosci Res. 2002;70:529–545. [PubMed]
  • Yum SW, Kleopa KA, Shumas S, Scherer SS. Diverse trafficking abnormalities of Connexin32 mutants causing CMTX. Neurobiol Dis. 2002;11:43–52. [PubMed]
  • Yum SW, Zhang J, Valiunas V, Kanaporis G, Brink PR, White TW, Scherer SS. Human connexin26 and connexin30 form functional heteromeric and heterotypic channels. Am J Physiol Cell Physiol. 2007;293:1032–1048. [PubMed]