PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Cancer Res. Author manuscript; available in PMC 2009 October 15.
Published in final edited form as:
PMCID: PMC2718575
NIHMSID: NIHMS67087
A Subset of Host B-Lymphocytes Control Melanoma Metastasis Through a MCAM/MUC18-dependent Interaction: Evidence from Mice and Humans
Fernanda I. Staquicini,1 Anita Tandle,2 Steven K. Libutti,2 Jessica Sun,1 Maya Zigler,1 Menashe Bar-Eli,1 Fabiana Aliperti,3 Elizabeth C. Pérez,3 Jeffrey E. Gershenwald,1 Mario Mariano,3 Renata Pasqualini,1* Wadih Arap,1* and José D. Lopes3*
1The University of Texas M. D. Anderson Cancer Center, Houston, TX 77030, USA
2National Cancer Institute (NCI), Surgery Branch, Bethesda, MD 20892, USA
3São Paulo Federal University, São Paulo, Brazil
Requests for reprints: Wadih Arap and Renata Pasqualini, The University of Texas M.D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX 77030 USA. Phone: 713-792-3873; Fax: 713-745-2999; E-mail: warap/at/mdanderson.org and ; rpasqual/at/mdanderson.org. José Daniel Lopes, Federal University of São Paulo, Rua Botucatu 862, São Paulo, 04023-062, Brazil. Phone: +55 011 5576 4532; Fax: +55 011 5571 1095; E-mail: jdlopes/at/unifesp.br.
Host immunity affects tumor metastasis but the corresponding cellular and molecular mechanisms are not entirely clear. Here we show that a subset of B-lymphocytes (termed B-1 population) -- but not other lymphocytes -- have pro-metastatic effects on melanoma cells in vivo through a direct heterotypic cell-cell interaction. In the classic B16 mouse melanoma model, one mechanism underlying this phenomenon is a specific upregulation and subsequent homophilic interaction mediated by the cell surface glycoprotein MUC18 (also known as melanoma cell adhesion molecule; MCAM). Presence of B-1 lymphocytes in a panel of tumor samples from melanoma patients directly correlates with MUC18 expression in melanoma cells, indicating that the same protein interaction exists in humans. These results suggest a new but as yet unrecognized functional role for host B-1 lymphocytes in tumor metastasis and establish a biochemical basis for such observations. Our findings support the counterintuitive central hypothesis in which a primitive layer of the immune system actually contributes to tumor progression and metastasis in a mouse model and in melanoma patients. Given that monoclonal antibodies against MUC18 are in pre-clinical development but the reason for their anti-tumor activity is not well understood, these translational results are relevant in the setting of human melanoma, and perhaps of other cancers.
Keywords: Melanoma, B-lymphocytes, MCAM/MUC18, Phage display
Studies addressing the role of the immune system in tumor growth and metastasis have yielded conflicting and often counterintuitive results. Over the 1970's, Prehn and colleagues proposed that the immune response mediated by lymphoid cells could paradoxically lead to tumor cell stimulation (1-3). To date, the interplay of immunity, inflammation, and cancer is still not entirely understood (4, 5). To add a further level of complexity--depending on the experimental model used--it is evident that host immunity can actually lead to enhancement, suppression, or even no effect at all on the metastatic potential of tumor cells, so that no global generalizations can be easily made (6).
Specifically in the B16 mouse melanoma model, previous reports demonstrate that melanoma cells can be stimulated by lymphocytes (7) and that melanoma progression can indeed be delayed if tumor-bearing mice are rendered immunossuppressed (8). However, the basis for these intriguing experimental observations remains elusive. In particular, the relevance of cell subpopulations from the more primitive layers of the immune system such as B-1 lymphocytes (9 - 12) on tumor phenotype has not been fully elucidated, although clues for such a role have recently emerged (13, 14).
Here we have evaluated the cellular and molecular crosstalk by which B-1 lymphocytes affect melanoma growth and metastasis. First, we used the classic B16 mouse melanoma model to show that one mechanism accounting for this observation is the upregulation and subsequent homophilic interaction of the cell-surface glycoprotein MUC18 (also known as melanoma cell adhesion molecule; MCAM). Next, we show that B-1 lymphocytes are also present in human tumors and directly correlate with MUC18 expression in melanoma cells, indicating that the same functional mechanism is conserved across species and likely active in human disease. Together, our results strongly suggest an important role for host B-1 lymphocytes in melanoma-derived metastasis and its corresponding biochemical basis in tumor-bearing mice and in patients.
Animals
Female mice were purchased and housed in the animal facilities of the University of Texas M. D. Anderson Cancer Center, Federal University of São Paulo, or University of Campinas. All animal procedures were approved by the respective IACUCs (Institutional Animal Care and Use Committee).
Human specimens
Incidental human melanoma samples were obtained, through written informed consent, from patients treated at the Surgery Branch of the National Cancer Institute (NCI) or at The University of Texas M. D. Anderson Cancer Center (MDACC).
Reagents
Anti-MUC18 (mouse and human) antibodies were purchased from Santa Cruz Biotechnology and Zymed. Anti-bacteriophage (SIGMA); FITC-conjugated anti-human IgM, APC-conjugated anti-human CD5 and PE-conjugated anti-human MUC18 (BD Biosciences) were commercially obtained. MART-1 antibody was purchased from BioGenex and labeled with FITC by using EZ-label FITC protein labeling kit (Pierce) and Zeba desalt spin columns (Pierce). HRP-conjugated anti-rabbit, PE-conjugated anti-mouse (Pharmingen), Cy-3-conjugated anti-rabbit antibodies were purchased from Jackson ImmunoResearch Laboratories. Keyhole limpet hemocyanin (KLH)-conjugated peptide and synthetic peptide were synthesized and conjugated to our specifications (AnaSpec).
Cell culture and co-culture of B-1 lymphocytes and B16 melanoma cells
B16-derived melanoma cells (The Jackson Laboratory) were cultured in RPMI 1640 media (SIGMA) containing 10% of fetal bovine serum (FBS; Cultilab), antibiotics and supplements. Purified B-1 lymphocytes were obtained as described (15). Only samples showing >95% purity were used.
Tumor growth and experimental metastasis assays
We used a standard model (16 - 17) to deplete B-1 lymphocytes in mice. Untreated, radiated, or reconstituted cohorts of C57BL/6 mice received B16 cells intravenously (105 cells per mouse). Mice were sacrificed and the number of colonies on the surface of lungs determined on day 15 post administration. Primary tumor growth into the mouse footpad was measured daily.
Phage display screening and binding assays
We used a random phage library displaying the insert CX7C (C, cysteine; X, any residue) for selection of peptides binding to melanoma cells post co-culture with B-1 lymphocytes (18). As a pre-clearing step, 106 B16 cells without exposure to B-1 lymphocytes were detached, washed and resuspended in RPMI containing 2% BSA plus 109 transducing units (TU) of unselected phage library. Cells and phage were transferred to the top of a non-miscible organic lower phase (dibutyl phthalate: cyclohexane, 9:1 [v: v]) and centrifuged at 10,000g for 10 min. The unbound phage population remaining in the aqueous upper phase (pre-cleared library) was collected into a fresh eppendorf tube and incubated with 106 B16 cells isolated post co-culture with B-1 lymphocytes. Phage in the organic lower phase were recovered from the cell pellet by bacterial host infection (19 - 24).
For phage binding assays to B16 melanoma, 106 cells pre and post co-culture with B-1 lymphocytes were incubated with each specific phage clone (109 TU) or negative controls. Melanoma cells and phage were centrifuged through the organic phase and the cell-bound phage clones were recovered by bacterial infection (18).
Immunocapture assays
Immunocapture experiments were with anti-MUC18 or IgG control antibodies, as described (19). ELISA with anti-IgG confirmed equal molar concentration of IgG on each of the wells. After blocking with PBS containing 3% BSA, 30 μg of protein from cell membrane extracts were added onto the wells for overnight incubation. Following washes, phage (2×109 TU) were added to each well. Bound phage were recovered by bacterial infection.
In vivo phage display
Homing of phage to subcutaneous tumors was performed as described (25). Animals received 1 × 1010 TU of phage diluted in DMEM. Tumors and control organs were collected after 6h of circulation. Bound phage were recovered by bacterial infection (25).
Immunofluorescence and flow cytometry
B16 melanoma cells pre- and post co-culture with B-1 lymphocytes were seeded in an 8-chamber slide (Nalge Nunc International) and incubated with phage (109 TU). Cells were washed, fixed and incubated with an anti-bacteriophage antibody followed by secondary antibody. For flow cytometry, melanoma cells or purified B-1 lymphocytes were incubated with primary antibody anti-MUC18 followed by PE-conjugated secondary antibody. To investigate the presence of B-1 lymphocytes in human melanoma samples, cells were isolated, washed, fixed and permeabilized with BD Cytofix/Cytoperm (BD Biosciences). Cells were stained either with isotype control or with specific antibody. Cells were analyzed with a FACS Calibur machine (BD Biosciences) equipped with Cell Quest software.
Immunofluorescence and immunohistochemical staining for MUC18 detection in tissue specimens
Tissue specimens were sectioned, mounted, and air-dried for 24 h. Antigen retrieval was performed with 0.1 M Citrate buffer (pH 6). Sections were stained with the UltraVision Plus Detection System, Anti-Polyvalent, HRP/AEC kit (LabVision Corp.) and counterstained with Gill's hematoxylin (SIGMA). For immunofluorescence, sections were washed, blocked and incubated with specific antibodies and Cy3-conjugated secondary antibodies.
Western blot and immunoprecipitation assays
Cells were lysed by using PBS containing 250 mM sucrose, 50 mM octylglucoside, 1 mM EDTA and protease inhibitors, resolved in a 4-20% gradient SDS-PAGE gel, transferred to nitrocellulose membranes and developed with the Enhanced Chemiluminescence (ECL) reagent (Amersham-Pharmacia). For detection of phosphorylated ERK1/2, total proteins were extracted as described (14)
RT-PCR
RNA was purified by using the Perfect RNA® Mini kit extraction method (Eppendorf). First-strand cDNA synthesis was performed by using the Superscript II Reverse Transcriptase kit (Invitrogen). For the mouse MUC18 transcript amplification, we used the primers 5′GGATCCTTGGCTTGCGCCCTCCGTCGG3′ and 5′CTAATGCCTCAGATCGATGTATTTCTCTCC3′ under the same conditions for template denaturation and elongation but with the annealing temperature of 60 °C. As a loading control, we used primers for the mouse glyceraldehyde 3′-phosphosphate dehydrogenase (GAPDH): 5′CGCCTGGTCACCAGGGCTGC3′ and 5′CACCACCCTGTTGCTGTAGCC3′.
Design of small hairpin RNA and lentivirus production
Mouse MUC18 siRNA sequences 5′ GGAGAGAAATACATCGATC 3′ and 5′GATCGATGTATTTCTCTCC 3′ were obtained from Dharmacon (On- Target Plus, NM_023061). Nonspecific control siRNA (nontargeting shRNA) sequences were 5′-TAAGGCTATGAAGAGATAC-3′ and 5′ GTATCTCTTCATAGCCTTA-3′. shRNA sequences for both targeting and non-targeting were ligated into a lentiviral vector pLVTHM which drives the expression of the green fluorescent protein (GFP) (26) (a gift from Dr. Didier Trono, University of Geneva, Switzerland). The restriction enzymes Cla1 and Mlu1 were used. The lentiviruses were produced by infecting human embryonic kidney cells (293FT) with the sequence-verified pLVTHM, the packing plasmid (MD2G) and the envelope plasmid (PAX2), required for viral production. GFP-positive cells were enriched to 100% by fluorescence-activated cell sorting.
Statistical analysis
Graphical analyses (Balloon plots) were used to depict protein expression levels based on flow cytometry results. Spearman's rank correlation test was used to analyze the correlation between number of B-1 lymphocytes and MUC18 expression profile on patients. Statistical analysis of in vivo experiments was carried out by using Student's t-tests as indicated.
B-1 lymphocytes influence malignant melanoma metastasis in vivo
We first evaluated the role of B-1 lymphocytes in melanoma growth and metastasis in vivo, by selectively depleting the predominantly B-1 lymphocyte population from peritoneal and pleural surfaces of mice (11, 12, 15, 27). We used external beam ionizing radiation to deplete B-1 lymphocytes with no detectable effect on other cell types (16, 17). We confirmed the depletion by flow cytometric analysis of cell surface markers: we observed a severe reduction in the B-1 lymphocyte population (typically over 80% cell depletion) by using this procedure (Supplementary Figs. S1 and S2). Next, we compared subcutaneous melanoma growth and experimental metastasis in radiated versus non-radiated (control) mice (Fig. 1A). In the radiated cohorts, we observed tumor growth suppression (Fig. 1A - left panel) and marked reduction in melanoma metastasis (Fig. 1A – right panels). In either case, reconstitution with total peritoneal cells reverted tumor growth and metastasis to levels undistinguishable from those observed in control non-radiated mice. To evaluate which depleted cell population mediates this phenomenon, we reconstituted radiated mice with either B-1 lymphocytes (Fig. 1B) or all other resident peritoneal cells but B-1 lymphocytes (Fig. 1C). We show that B-1 lymphocytes are necessary and sufficient to revert the radiation-induced metastasis suppression of melanoma. Finally, by using an unrelated genetic model of immunosuppression (X-linked immunodeficiency, Xid), we also observed melanoma metastasis inhibition when mutant mice (constitutively B-1 lymphocyte-deficient (28, 29)) were compared to their otherwise isogenic wild-type counterparts (Fig. 1D). These observations in Xid mutant mice are consistent with the results obtained from radiation-induced B-1 lymphocyte depletion. Together, these data from two independent experimental systems confirm that B-1 lymphocytes can control experimental metastasis derived from B16 melanoma cells.
Figure 1
Figure 1
Effects of B-1 lymphocytes in B16 melanoma progression. A, Left panel: effect of radiation-induced B-1 lymphocyte depletion on primary tumor growth. Right panel: Effect of radiation-induced B-1 lymphocyte depletion on metastases. Representative lungs (more ...)
Next, we cultured melanoma cells either in a Transwell® system or with B-1 lymphocytes in co-culture. Surprisingly, co-culture enhanced melanoma metastasis. No effects on melanoma metastatic potential were observed when cells were cultured in shared media (13, 14). Moreover, we observed cell clusters forming between B16 melanoma cells and B-1 lymphocytes by 48-72 hours of co-culture but not before; such heterotypic cell clusters contained one B16 melanoma cell plus five-to-ten B-1 lymphocytes (Supplementary Fig. S3A - C). We confirmed an intimate physical membrane interaction between the two cell types by transmission electron microscopy (13). In sum, these data show that a direct and “prolonged” (defined as 72 hours) cell-cell contact between B-1 lymphocytes and B16 melanoma cells renders the tumor cells more metastatic.
A MUC18-MUC18 homophilic interaction mediates the physical contact between melanoma cells and B-1 lymphocytes
We hypothesized that adhesion molecules expressed on B16 melanoma cell surfaces after contact with host B-1 lymphocytes would mediate the cell-cell interaction. In order to identify such molecules, we used a phage display-based combinatorial approach (18). We designed a two-step aqueous-to-organic phase separation strategy to select ligands to melanoma cells with enhanced metastatic potential. First, we pre-cleared the phage library on B16 melanoma cells prior to co-culture with B-1 lymphocytes. Next, we selected the unbound bulk phage population (pre-cleared library) on isolated B16 melanoma cells after 72 hours of co-culture with B-1 lymphocytes and obtained strong serial enrichment (Fig. 2A). We then proceeded to evaluate the binding of phage selected from the enriched population and found that 7 out of 10 individual clones tested (70%) preferentially bound to melanoma cells after co-culture with B-1 lymphocytes (range, 2- to 7-fold; median, 3-fold) relative to an insertless phage that served as negative control. Protein similarity searches revealed that several peptides displayed by the phage showing preferential binding to melanoma post co-culture were reminiscent of the sequence of the glycoprotein MUC18 (30, 31).
Figure 2
Figure 2
Screening of a phage display random peptide library on B16 melanoma cells post co-culture with B-1 lymphocytes yields MUC18 as a candidate target molecule. A, Enrichment of phage binding to malignant melanoma cells after co-culture with B-1 lymphocytes. (more ...)
We then searched whether additional selected ligand peptides had homologous sequences to that protein. In total, we found 48 motifs sharing sequence homology to the extracellular domain of MUC18 (Supplementary Fig. S4). Of these, we evaluated a panel of phage clones displaying peptides with homology to MUC18. We found that 10 out of 15 individual clones (67%) bound preferentially to B16 melanoma cells post co-culture with B-1 lymphocytes (range, 2.5- to 20-fold; median 4-fold). In particular, phage displaying the cyclic peptide CLFMRLAWC which contains an embedded MUC18-like motif in reverse (sequence Arg-Met-Phe-Leu present in the extracellular portion of IgG1 domain; mouse MUC18 residues R114-L117) showed marked enrichment in phage binding relative to the negative control insertless phage (Fig. 2B). We then set out to functionally characterize the CLFMRLAWC-displaying phage and the corresponding homologous region within MUC18. We developed antibodies against the melanoma-targeting CLFMRLAWC peptide to evaluate whether they recognize MUC18. Proteins from cell membrane extracts of melanoma cells co-cultured with or without B-1 lymphocytes were then probed with anti-MUC18 or anti-CLFMRLAWC peptide antibodies. Both antibodies against the native mouse MUC18 or against the CLFMRLAWC synthetic peptide detected undistinguishable protein bands by Western blot (Fig. 2C) suggesting that both recognize MUC18; reciprocal co-immunoprecipitation experiments were also consistent with such interpretation (Fig. 2D). Western blotting (Fig. 2C), immunofluorescence (Fig. 3A) and flow cytometry (Fig. 4B) analysis showed an increase in MUC18 expression in melanoma cells post co-culture with B-1 lymphocytes which directly correlated with the increase in MUC18-targeting.
Figure 3
Figure 3
Figure 3
MUC18-derived phage binds to MUC18. A, Binding of MUC18-derived phage on melanoma cells pre and post co-culture with B-1 lymphocytes. Left panel: a phage clone displaying a mouse MUC18-derived peptide (H111-S120) targets B16 malignant melanoma cells relative (more ...)
Figure 4
Figure 4
A and B, FACS analysis shows that B-1 lymphocytes express high levels of cell surface MUC18. In contrast to B16 melanoma cells (B), we observed lack of MUC18 up-regulation on B-1 lymphocytes after co-culture with malignant melanoma cells. (A) The black (more ...)
Based on the experiments described above, we predicted that the native MUC18 protein sequence would recapitulate the phage binding mediated by the peptide CLFMRLAWC. To experimentally test such prediction, we designed and constructed a phage clone displaying a peptide that encompass the corresponding native MUC18 protein sequence (residues H111-S120) for use in binding assays on melanoma cells pre and post co-culture with B-1 lymphocytes. Consistent with our hypothesis, we observed that the display of a MUC18-derived (H111-S120) peptide sequence on phage promotes preferential binding to the surface of B16 melanoma cells after co-culture with B-1 lymphocytes (2.5-fold relative to the baseline binding to malignant melanoma cells pre co-culture with B-1 lymphocytes); in contrast, several negative controls (a series of phage clones engineered to display scrambled versions of the peptide insert) had their binding to melanoma cells abolished to background levels regardless of co-culture with B-1 lymphocytes (Fig. 3A – left panel). Moreover, to evaluate whether MUC18 might indeed be responsible for the differential phage binding, we compared the magnitude of phage binding to cell membrane expression of that molecule (Fig. 3A – right panel). We observed (i) that MUC18 expression increases after co-culture with B-1 lymphocytes and (ii) that there is a direct correlation between targeted phage binding and cell surface expression of MUC18 relative to controls. Together, these data not only show that a MUC18-derived ligand peptide mediates binding to B16 melanoma cells but also establish the overexpression of the cell surface receptor MUC18 itself in the melanoma cells after B-1 lymphocyte co-culture.
To confirm that the H111-S120 peptide can functionally behave as MUC18 in the phage context as well, we evaluated the binding of H111-S120 phage to immunocaptured MUC18. We show that H111-S120 phage but not negative controls (including insertless or scrambled insert phage) bind to immunocaptured MUC18; no binding was observed when immunocapture was carried out by using an irrelevant IgG isotype control (Fig. 3B – left panel). We also show that anti-MUC18 antibodies specifically inhibit phage binding mediated by the MUC18-derived peptide H111-S120 relative to controls (Supplementary Figs. S5A and B). Furthermore, to study the specificity of the MUC18 targeted-phage in vivo, we evaluated phage homing in mice subcutaneously implanted with melanoma cells before and after co-culture with B-1 lymphocytes (Fig. 3B). We observed marked binding of MUC18 targeted-phage to tumors derived from melanoma post co-culture with B-1 lymphocytes compared to melanoma and control organ (Fig. 3B – right panel). Phage binding is accompanied by increased expression of MUC18 in tumors from melanoma co-cultured with B-1 lymphocytes (Fig. 3C).
Next, we used shRNA to silence the expression of MUC18 in melanoma cells and to determine whether presence of MUC18 on the cell surface is required for the biological phenomenon to occur. Decrease in expression of MUC18 was confirmed by immunoblotting (Fig. 3D). MUC18-depleted cells were co-cultured with B-1 lymphocytes for 72 h and injected intravenously into mice. We used B16 and B16 transduced with non-targeting shRNA as controls. As previously observed, co-culture of MUC18-expressing melanoma cells (parental B16 or B16 transduced with non-targeting shRNA) with B-1 lymphocytes increases melanoma metastasis. However, such pro-metastatic effect is abrogated when MUC18-negative cells are used, a result consistent with our hypothesis that a MUC18-MUC18-mediated cell interaction renders melanoma cells more metastatic. Furthermore, a marked decrease in the number of lung colonies was observed in animals inoculated with MUC18-negative cells, again supporting the importance of this molecule in metastasis.
Taken together, these results confirm the specificity of the interaction and support the concept that a MUC18-MUC18 homophilic interaction mediates the physical contact between B16 cells and B-1 lymphocytes. To gain insight into the molecular basis of such interaction, we generated a panel of phage to combine alanine scanning site-directed mutagenesis and binding assays. Compared to wild-type H111-S120 phage, we identified four key residues (Arg114, Cys118, Lys119, and Ser120) in MUC18 whose mutation abolished phage binding to melanoma cells regardless of co-culture with B-1 lymphocytes (Supplementary Fig. S5C). Results of these mutational studies again indicate binding specificity.
B-1 lymphocytes express MUC18
Given that phage selected to mimic a ligand expressed on the surface of B-1 lymphocytes resembled MUC18 and bound specifically to MUC18 on the surface of melanoma cells, we evaluated whether B-1 lymphocytes would also express MUC18 on their own cell surfaces as well. Flow cytometric analysis revealed cell surface expression of MUC18 in B-1 lymphocytes (Fig. 4A). However, in contrast to the MUC18 overexpression clearly observed in B16 melanoma cells post co-culture with B-1 lymphocytes (Fig. 4B), no change in MUC18 expression was detected on the cell surfaces of B-1 lymphocytes themselves after co-culture. We next used RT-PCR analysis to confirm changes in MUC18 expression after cell-cell contact. Consistent with the previous findings, we again observed an upregulation of MUC18 transcripts in melanoma cells (but not in B-1 lymphocytes) post co-culture (Fig. 4C), suggesting that MUC18 transcriptional control is differentially regulated in each cell type. Indeed, binding of B-1 lymphocytes to melanoma cells in vitro induce activation of the MAP kinase signaling pathway only in melanoma cells, while ERK1/2 phosphorylation appears to be constitutive in B-1 lymphocytes (14). Thus, in order to further investigate the role of MUC18 in this cell-cell interaction, we evaluated the effect of MUC18-like peptide in the activation of the MAP kinase pathway in melanoma cells. Cells were treated with MUC18-like synthetic peptide and protein phosphorylation was analyzed by immunoblotting (Fig. 4D). We show phosphorylation of ERK1/2 at 2.5 min after cell activation. In contrast, an unrelated control peptide did not induce ERK1/2 phosphorylation. Collectively, these data suggest (i) that MUC18 is expressed in both cell types but differentially regulated and (ii) that a homophilic MUC18-MUC18 ligand-receptor system on the cell surface of B16 melanoma cells and B-1 lymphocytes mediates a heterotypic cell-cell interaction that ultimately leads to ERK1/2 phosphorylation and increase in melanoma metastasis.
A potential functional role for B-1 lymphocytes in human malignant melanoma
To investigate the relevance of our findings in human disease, we first evaluated the expression of MUC18 in patient-derived melanoma primary tumors and metastases: immunohistochemical analysis of MUC18 expressions in skin, “in-transit”, and in lymph nodes (Fig. 5A) showed marked MUC18 expression in both melanoma cells and vascular endothelial cells, consistent with other descriptive reports (32, 33). Of note, only melanoma cells but not lymphocytes stained positive for MUC18 within lymph nodes, a result again consistent with our observation that B-1 lymphocytes are the only MUC18-expressing B cells in both mice and humans. Moreover, we also examined the binding capacity of the MUC18-targeted phage to a panel of 8 well-established human melanoma cell lines (Fig. 5B). We observed specific binding of the H111-S120 phage to all cell lines relative to negative controls.
Figure 5
Figure 5
Expression of MUC18 in human melanoma. A, Samples of skin, in transit and lymph node metastases were immunostained with anti-human MUC18 antibody. Arrows point to MUC18–expressing melanoma cells in the epidermis (top left), dermis and exocrine (more ...)
Next, we asked (i) whether the human counterpart (34, 35) of murine B-1 lymphocytes (heretofore termed “human B-1 lymphocytes”) are present in sites of human melanoma metastasis and (ii) whether this B cell population would recapitulate the functional behavior of mouse B-1 lymphocytes in the context of malignant melanoma. We used flow cytometric analysis to evaluate patient-derived samples (obtained from surgically removed metastatic melanoma cases; n=16) for the presence of human B-1 lymphocytes (Fig. 6A). B-1 cells were distinguished among other lymphocytes by CD5/IgM double-expression while human MUC18-expressing tumor cells were identified within MART-1+ melanoma cells. Expression of surface markers was graphically represented as a “balloon plot” (Fig. 6A). We observed a direct correlation between increasing number of human B-1 lymphocytes within the tumors and increasing expression of MUC18 on melanoma cells (r= 0.6, p<0.05). Histological analysis of representative melanomas with mild (Patients #1 and 3), moderate (Patients #8 and 9), and marked (Patient #13) levels of MUC18 expression on melanoma cells illustrates differential expression of the protein (Fig. 6B). Together, these results establish that human B-1 lymphocytes are present in melanoma metastases and that such presence accounts for increased expression of MUC18 in human melanoma cells. As such, the MUC18 homophilic mechanism of heterotypic cell interaction appears clearly preserved across species and it is likely functional in human melanoma as well.
Figure 6
Figure 6
Correlation between number of B-1 lymphocytes and MUC18 expression in human melanoma. A, Flow cytometric analysis of melanoma samples is graphically represented as a balloon plot. A positive correlation is observed between increasing number of B-1 lymphocytes (more ...)
It is often assumed that host immunity assembles its components to curb disease; however, the functional relationship between cellular immune system and tumor cells is far from clear. In mice, B-1 lymphocytes arise very early during the ontogeny of the immune system compared to the more evolved layers. Such cell lineage share several features with primitive B lymphocytes such as neonatal development, limited antibody repertoire, self-renewal capacity and regulatory feedback in adults. B-1 lymphocytes can be readily identified by their cell surface phenotype (IgMhigh, IgDlow, CD23, B220low, CD11b+) and can be further subdivided in B-1a (CD5+) and B-1b (CD5-) subsets (9 - 12).
We evaluated whether B-1 lymphocytes influence tumor progression in the well-established B16 melanoma mouse model. We found that B-1 lymphocyte depletion markedly decreases lung metastasis from melanoma cells. B-1 lymphocyte reconstitution specifically inhibits this phenomenon and restores metastasis to baseline levels. These results show that B-1 lymphocytes have a key role in melanoma growth and metastasis.
Given that B-1 lymphocytes are known to produce and release high amounts of cytokines, we originally designed experiments to evaluate whether a soluble factor such as, for instance, interleukin-10 (36) might account for the observed metastasis enhancement. Unexpectedly, we found instead that a direct physical interaction between B-1 lymphocytes and melanoma cells, is needed for metastasis. These findings led to the hypothesis that cell surface molecules are likely to mediate the phenomenon.
To gain insight into the molecular mechanism of this cell-cell interaction and the resulting biological effects, we attempted to identify the functionally active molecules expressed at the surface of each cell type. To that end, we selected a combinatorial peptide library on melanoma cells after co-culture with B-1 lymphocytes. By comparing sequences of selected peptides with those available in protein databases, we found that ligand motifs were similar to the cell surface glycoprotein MUC18. Because MUC18 is an adhesion molecule that correlates with tumor growth and metastasis (32, 37, 38), we next evaluated whether a MUC18-dependent cell interaction would influence melanoma metastasis. First, we established that MUC18 serves as the partner on the surface of B16 melanoma cells (“receptor”). Because MUC18-like peptides also bind to MUC18 itself, we reasoned that MUC18 could also serve as the partner on the surface of B-1 lymphocytes (“ligand”). If so, one would predict that the ligand-receptor system affecting B16 melanoma cells through B-1 lymphocytes is actually a MUC18-MUC18 interaction. Our data show that this is indeed the case because (i) MUC18-like peptides enhance phage binding to melanoma cells post co-culture, (ii) antibodies against MUC18 specifically inhibit phage targeting and (iii) MUC18 is also abundant on the surface of B-1 lymphocytes. Together, our findings indicate that an unrecognized biochemical interaction between MUC18 expressed on the surface of B16 melanoma cells and B-1 lymphocytes regulates metastatic potential. While the identification of a MUC18-like motif “in reverse” may originally have suggested an anti-parallel MUC18-MUC18 interaction, in vitro and in vivo experiments performed with a phage clone designed to display the corresponding native MUC18 sequence indicates that this particular molecular mimicry is not affected by peptide orientation. However, the same may not necessarily be true for the native MUC18 protein itself (due to potential steric hindrance). Therefore, whether this protein-protein interaction is influenced by orientation of the native protein expressed on the surface of melanoma and B-1 cells remains uncertain; a full understanding of the structural requirements for protein-protein or protein-peptide will likely have to wait for the elucidation of the X-ray crystal structures of MUC18-MUC18 and of MUC18-CLFMRLAWC complexes
To evaluate whether these observations are relevant in human disease, we investigated the distribution of B-1 lymphocytes in patients with melanoma. While the origin and characteristics of the “human B-1 lymphocyte” counterpart are still poorly defined, a considerable proportion of IgM+ B cells in the human peritoneal cavity are CD5+, a phenotypic hallmark of mouse B-1 lymphocytes (48). Mice and human B-1 lymphocytes are both largely responsible for the production of auto-reactive IgM antibodies in patients with certain autoimmune diseases (34, 35).
We detected IgM+/CD5+ B cells, presumably human B-1 lymphocytes, in 100% of the analyzed samples from a cohort of patients with metastatic melanoma (n=16) suggesting that B-1 lymphocytes likely play a functional role in human cancer. Importantly, the presence of B-1 lymphocytes within tumors directly correlates with increased expression of MUC18 in melanoma cells (38), again supporting the relevance of a functional and active MUC18-dependent cross-talk between human B-1 lymphocytes and melanoma.
Notably, disruption of MUC18-dependent cell interactions may be of therapeutic value. In fact, (i) anti-MUC18 antibodies have shown promise in pre-clinical models (37, 39) and (ii) overexpression of MUC18 occurs in human melanoma among other tumor types (40, 41). One might speculate that if a MUC18-dependent interaction accounts for malignant melanoma homing to lung vasculature for instance, then anti-MUC18 antibodies and/or MUC18-based peptidomimetics might simultaneously block the functional protein-protein interaction from both partners. Considering that re-attachment of circulating tumor cells is a rate-limiting step in metastasis, our observations might help explain the difference of magnitude of effect we observed between the (mild-to-moderate) B16 tumor growth suppression relative to lung (marked) metastasis inhibition in B-1 lymphocyte-deficient mice.
In summary, we show that human and mouse melanoma cells can subvert a putatively defensive function of the immune system through a heterotypic cell-cell interaction with primitive B cells, and that this molecular crosstalk can influence tumor progression with adverse net effects to the host. New mechanism-based strategies such as physical elimination or functional modulation of human B-1 lymphocytes (through radiation or specific antibodies) may be considered as an experimental therapy against human melanomas; also, blocking MUC18 with antibodies or targeting MUC18 for ligand-directed delivery of agents in patients with melanoma may have translational potential.
Supplementary Material
CAN-08-1242
Acknowledgments
We thank Dr. Richmond Prehn for critical reading of the manuscript, Dr. Renato Mortara for confocal microscopy assistance, Dr. Alexander Lazar for immunohistochemistry and Dr. Didier Trono for providing reagents. We also thank Dr. John Wunderlich from the TIL Laboratory (NCI Surgery Branch) for human melanoma samples.
This work was supported by grants from FAPESP (to JDL), Department of Defense (to FS, RP, and WA) and National Cancer Institute (to RP and WA) and by awards from the Gillson-Longenbaugh Foundation and AngelWorks. FIS received a predoctoral fellowship from the FAPESP.
Non-standard abbreviations used
AP-2activator protein-2
BSAbovine serum albumin
CREBcAMP-responsive element binding protein
FBSfetal bovine serum
GAPDHglyceraldehyde 3′-phosphosphate dehydrogenase
MMP-2matrix metalloproteinase 2
PBSphosphate-buffered saline
PFAparaformaldehyde
TUtransducing units

1. Prehn RT. Perspectives on oncogenesis: does immunity stimulate or inhibit neoplasia? J Reticuloendothel Soc. 1971;10:1–16. [PubMed]
2. Prehn RT. The immune reaction as a stimulator of tumor growth. Science. 1972;176:170–1. [PubMed]
3. Wexler H, Sindelar WF, Ketcham AS. The role of immune factors in the survival of circulating tumor cells. Cancer. 1976;37:1701–6. [PubMed]
4. Coussens LM, Werb Z. Inflammation and cancer. Nature. 2002;420:860–7. [PMC free article] [PubMed]
5. de Visser KE, Korets LV, Coussens LM. De novo carcinogenesis promoted by chronic inflammation is B lymphocyte dependent. Cancer Cell. 2005;7:411–23. [PubMed]
6. Fidler IJ. Molecular Biology of Cancer: Invasion and Metastasis. In: Vincent T J, Devita Md., Samuel, Hellman MD, Steven A, Rosenberg MD, editors. Cancer: Principles & Practice of Oncology. Vol. 1. Lippincott-Raven publishers; New York: 1997. pp. 135–52.
7. Bartholomaeus WN, Bray AE, Papadimitriou JM, Keast D. Immune response to a transplantable malignant melanoma in mice. J Natl Cancer Inst. 1974;53:1065–72. [PubMed]
8. Fidler IJ, Gersten DM. Effect of syngeneic lymphocytes on the vascularity, growth and induced metastasis of the B16 melanoma. In: Crispen RG, editor. Neoplasm Immunity: Experimental and Clinical. Vol. 3. Elsevier North Holland; Amsterdam: 1980. pp. 3–15.
9. Berland R, Wortis HH. Origins and functions of B-1 cells with notes on the role of CD5. Annu Rev Immunol. 2002;20:253–300. [PubMed]
10. Hardy RR, Hayakawa K. Development and physiology of Ly-1 B and its human homolog, Leu-1 B. Immunol Rev. 1986;93:53–79. [PubMed]
11. Kantor AB, Herzenberg LA. Origin of murine B cell lineages. Annu Rev Immunol. 1993;11:501–38. [PubMed]
12. Fagarasan S, Watanabe N, Honjo T. Generation, expansion, migration and activation of mouse B1 cells. Immunol Rev. 2000;176:205–15. [PubMed]
13. Staquicini FI. B-1 lymphocytes modulate the metastatic potential of murine melanoma through a specific interaction mediated by MUC18. Federal University of Sao Paulo; 2004. Ph.D. dissertation.
14. Pérez EC, Machado J, Jr, Aliperti F, Freymüller E, Mariano M, Lopes JD. B-1 lymphocytes increase metastatic behavior of melanoma cells through the extracellular signal-regulated kinase pathway. Cancer Sci. 2008;99:920–8. [PubMed]
15. Almeida SR, Aroeira LS, Freymuller E, et al. Mouse B-1 cell-derived mononuclear phagocyte, a novel cellular component of acute non-specific inflammatory exudate. Int Immunol. 2001;13:1193–201. [PubMed]
16. e Brito RR, De Lorenzo BH, Xander P, Godoy LC, Lopes JD, da Silva NP, Sampaio SC, Mariano M. Role of distinct immune components in the radiation-induced abrogation of systemic lupus erythematosus development in mice. Lupus. 2007;16:947–54. [PubMed]
17. Popi AF, Lopes JD, Mariano M. Interleukin-10 secreted by B-1 cells modulates the phagocytic activity of murine macrophages in vitro. Immunology. 2004;113:348–54. [PubMed]
18. Giordano RJ, Cardó-Vila M, Lahdenranta J, Pasqualini R, Arap W. Biopanning and rapid analysis of selective interactive ligands. Nat Med. 2001;7:1249–53. [PubMed]
19. Pasqualini R, Koivunen E, Kain R, et al. Aminopeptidase N is a receptor for tumor-homing peptides and a target for inhibiting angiogenesis. Cancer Res. 2000;60:722–27. [PubMed]
20. Cardó-Vila M, Arap W, Pasqualini R. Alpha v beta 5 integrin-dependent programmed cell death triggered by a peptide mimic of annexin V. Mol Cell. 2003;11:1151–62. [PubMed]
21. Marchiò S, Lahdenranta J, Schlingemann RO, et al. Aminopeptidase A is a functional target in angiogenic blood vessels. Cancer Cell. 2004;5:151–62. [PubMed]
22. Kolonin MG, Saha PK, Chan L, Pasqualini R, Arap W. Reversal of obesity by targeted ablation of adipose tissue. Nat Med. 2004;10:625–32. [PubMed]
23. Arap MA, Lahdenranta J, Mintz PJ, et al. Cell surface expression of the stress response chaperone GRP78 enables tumor targeting by circulating ligands. Cancer Cell. 2004;6:275–84. [PubMed]
24. Hajitou A, Trepel M, Lilley CE, et al. A hybrid vector for ligand-directed tumor targeting and molecular imaging. Cell. 2006;125:385–98. [PubMed]
25. Pasqualini R, Ruoslahti E. Organ targeting in vivo using phage display peptide libraries. Nature. 1996;380:364–6. [PubMed]
26. Wiznerowicz M, Trono D. Conditional suppression of cellular genes: lentivirus vector-mediated drug-inducible RNA interference. J Virol. 2003;77:8957–61. [PMC free article] [PubMed]
27. Kantor AB. The development and repertoire of B-1 cells (CD5 B cells) Immunol Today. 1991;12:389–91. [PubMed]
28. Khan WN, Alt FW, Gerstein RM, et al. Defective B cell development and function in Btk-deficient mice. Immunity. 1995;3:283–99. [PubMed]
29. Santos-Lima EC, Vasconcellos R, Reina-San-Martin B, et al. Significant association between the skewed natural antibody repertoire of Xid mice and resistance to Trypanosoma cruzi infection. Eur J Immunol. 2001;31:634–45. [PubMed]
30. Shih IM. The role of CD146 (Mel-CAM) in biology and pathology. J Pathol. 1999;189:4–11. [PubMed]
31. Yang H, Wang S, Liu Z, et al. Isolation and characterization of mouse MUC18 cDNA gene, and correlation of MUC18 expression in mouse melanoma cell lines with metastatic ability. Gene. 2001;265:133–45. [PubMed]
32. Jean D, Gershenwald JE, Huang S, et al. Loss of AP-2 results in up-regulation of MCAM/MUC18 and an increase in tumor growth and metastasis of human melanoma cells. J Biol Chem. 1998;273:16501–8. [PubMed]
33. Luca M, Hunt B, Bucana CD, Johnson JP, Fidler IJ, Bar-Eli M. Direct correlation between MUC18 expression and metastatic potential of human melanoma cells. Melanoma Res. 1993;3:35–41. [PubMed]
34. Casali P, Burastero SE, Nakamura M, Inghirami G, Notkins AL. Human lymphocytes making rheumatoid factor and antibody to ssDNA belong to Leu-1+ B-cell subset. Science. 1987;236:77–81. [PubMed]
35. Hardy RR, Hayakawa K, Shimizu M, Yamasaki K, Kishimoto T. Rheumatoid factor secretion from human Leu-1+ B cells. Science. 1987;236:81–3. [PubMed]
36. Gieni RS, Umetsu DT, DeKruyff RH. Ly1- (CD5−) B cells produce interleukin (IL)-10. Cell Immunol. 1997;175:164–70. [PubMed]
37. McGary EC, Heimberger A, Mills L, et al. A fully human antimelanoma cellular adhesion molecule/MUC18 antibody inhibits spontaneous pulmonary metastasis of osteosarcoma cells in vivo. Clin Cancer Res. 2003;9:6560–6. [PubMed]
38. McGary EC, Lev DC, Bar-Eli M. Cellular adhesion pathways and metastatic potential of human melanoma. Cancer Biol Ther. 2002;1:459–65. [PubMed]
39. Mills L, Tellez C, Huang S, et al. Fully human antibodies to MCAM/MUC18 inhibit tumor growth and metastasis of human melanoma. Cancer Res. 2002;62:5106–14. [PubMed]
40. Filshie RJ, Zannettino AC, Makrynikola V, et al. MUC18, a member of the immunoglobulin superfamily, is expressed on bone marrow fibroblasts and a subset of hematological malignancies. Leukemia. 1998;12:414–21. [PubMed]
41. Wu GJ, Fu P, Chiang CF, et al. Increased expression of MUC18 correlates with the metastatic progression of mouse prostate adenocarcinoma in the TRAMP model. J Urol. 2005;173:1778–83. [PubMed]
42. Minoprio P, el Cheikh MC, Murphy E, et al. Xid-associated resistance to experimental Chagas' disease is IFN-gamma dependent. J Immunol. 1993;151:4200–8. [PubMed]
43. Ghosn EE, Russo M, Almeida SR. Nitric oxide-dependent killing of Cryptococcus neoformans by B-1-derived mononuclear phagocyte. J Leukoc Biol. 2006;80:36–44. [PubMed]
44. Haas KM, Poe JC, Steeber DA, Tedder TF. B-1a and B-1b cells exhibit distinct developmental requirements and have unique functional roles in innate and adaptive immunity to S. pneumoniae. Immunity. 2005;23:7–18. [PubMed]