PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jcoHomeThis ArticleSearchSubmitASCO JCO Homepage
 
J Clin Oncol. 2009 July 1; 27(19): 3198–3204.
Published online 2009 May 18. doi:  10.1200/JCO.2008.20.6110
PMCID: PMC2716941

Prognostic Importance of MN1 Transcript Levels, and Biologic Insights From MN1-Associated Gene and MicroRNA Expression Signatures in Cytogenetically Normal Acute Myeloid Leukemia: A Cancer and Leukemia Group B Study

Abstract

Purpose

To determine the prognostic importance of the meningioma 1 (MN1) gene expression levels in the context of other predictive molecular markers, and to derive MN1 associated gene– and microRNA–expression profiles in cytogenetically normal acute myeloid leukemia (CN-AML).

Patients and Methods

MN1 expression was measured in 119 untreated primary CN-AML adults younger than 60 years by real-time reverse-transcriptase polymerase chain reaction. Patients were also tested for FLT3, NPM1, CEBPA, and WT1 mutations, MLL partial tandem duplications, and BAALC and ERG expression. Gene- and microRNA-expression profiles were attained by performing genome-wide microarray assays. Patients were intensively treated on two first-line Cancer and Leukemia Group B clinical trials.

Results

Higher MN1 expression associated with NPM1 wild-type (P < .001), increased BAALC expression (P = .004), and less extramedullary involvement (P = .01). In multivariable analyses, higher MN1 expression associated with a lower complete remission rate (P = .005) after adjustment for WBC; shorter disease-free survival (P = .01) after adjustment for WT1 mutations, FLT3 internal tandem duplications (FLT3-ITD), and high ERG expression; and shorter survival (P = .04) after adjustment for WT1 and NPM1 mutations, FLT3-ITD, and WBC. Gene- and microRNA-expression profiles suggested that high MN1 expressers share features with high BAALC expressers and patients with wild-type NPM1. Higher MN1 expression also appears to be associated with genes and microRNAs that are active in aberrant macrophage/monocytoid function and differentiation.

Conclusion

MN1 expression independently predicts outcome in CN-AML patients. The MN1 gene- and microRNA-expression signatures suggest biologic features that could be exploited as therapeutic targets.

INTRODUCTION

Nonrandom cytogenetic abnormalities are among the most important prognostic factors in acute myeloid leukemia (AML).14 However, approximately 45% of adults younger than 60 years of age with primary AML have cytogenetically normal (CN) disease at diagnosis and thus lack informative chromosome markers for risk stratification.14 Recently, this large cytogenetic group was shown to be composed of subsets differing for the presence of distinct submicroscopic genetic alterations.5

The meningioma 1 (MN1) gene is located at chromosome band 22q12 and encodes a protein that participates in a gene transcription regulator complex with the nuclear receptor RAR-RXR or the vitamin D receptor.6,7 The involvement of this gene in human neoplasia was initially discovered in a case of meningioma carrying t(4;22)8 and also found in myeloid malignancies with t(12;22).9 High levels of MN1 expression were recently associated with inv16 AML,10 and shown, in a mouse model, to cooperate with CBFB-MYH11 gene fusion in the development of AML.11 However, the mechanisms through which aberrant expression of MN1 contributes to malignant transformation remain to be elucidated.12,13

Recently, Heuser et al14 reported that overexpression of MN1 predicted worse outcome in CN-AML patients. To date, however, these results have not been independently corroborated or tested in the context of several other established prognostic markers in CN-AML. Thus, to validate MN1 expression's prognostic importance in CN-AML, we measured the MN1 expression in diagnostic bone marrow (BM) samples from younger adult CN-AML patients that were also comprehensively characterized for other molecular markers associated with outcome. Furthermore, to gain insight into MN1-mediated leukemogenesis, we derived gene- and microRNA-expression signatures associated with changes in MN1 expression levels.

PATIENTS AND METHODS

Patients, Treatment, Cytogenetic, and Molecular Analyses

One hundred nineteen adults younger than 60 years of age with untreated, primary CN-AML with material available for analyses were included. Patients were treated similarly on Cancer and Leukemia Group B (CALGB) protocols 9621 (n = 38) and 19808 (n = 81) with intensive induction chemotherapy and consolidation with autologous peripheral blood stem cell transplantation (SCT; Appendix, online only).15,16 No differences in outcome (complete remission rate [CR], P = .86; disease-free survival [DFS], P = .37; overall survival [OS], P = .33) were observed between the patients studied for MN1 expression and the remaining CN-AML patients not included (n = 121).

Pretreatment BM cytogenetic analyses were performed by CALGB-approved institutional cytogenetic laboratories on CALGB 8461, a prospective cytogenetic companion, and centrally reviewed.17 MN1 copy numbers normalized to ABL copy numbers were measured in BM samples by real-time reverse transcriptase polymerase chain reaction quantification (Appendix). The presence or absence of additional molecular markers such as FLT3 internal tandem duplication (FLT3-ITD),18,19 FLT3 tyrosine kinase domain mutations (FLT3-TKD),20,21 mutations in the NPM1,22 CEBPA,23 and WT124 genes, MLL partial tandem duplication (MLL-PTD),25,26 and ERG27,28 and BAALC29,30 expression levels were assessed centrally. All patients gave informed consent for the research use of their specimens, in accordance with the Declaration of Helsinki.

Gene-Expression and MicroRNA-Expression Profiling

RNA samples from 75 of 81 patients studied for MN1 expression enrolled on CALGB 19808 were analyzed for genome-wide gene expression using Affymetrix U133 plus 2.0 GeneChips (Affymetrix, Santa Clara, CA), as previously reported (Appendix).10,31

Of the 75 samples analyzed for genome-wide gene expression, 73 were also analyzed for genome-wide microRNA expression. Biotinylated first strand cDNA from total RNA extracted from pretreatment BM or blood mononuclear cell samples was synthesized using biotin-labeled random octamer primers and was hybridized onto microRNA microarray chips, as previously reported.32 Images of the microRNA microarrays were acquired as previously reported.33

Statistical Methods

The main objective was to evaluate the impact of MN1 expression on clinical outcome. We defined CR as BM cellularity ≥ 20% and fewer than 5% blasts, and recovery of leukocyte (≥ 1,500/μL) and platelet (> 100,000/μL) counts; relapse as ≥ 5% of BM, leukemic blasts, circulating blasts, or extramedullary leukemia; DFS as the interval from CR achievement until relapse or death, regardless of cause; OS as the date on study until death. Patients alive at last follow-up were censored for both DFS and OS. MN1 expression values were calculated as the natural log transformation of the normalized MN1 copy numbers; this continuous variable was used for all statistical analyses. Pretreatment CNS, spleen, liver, skin, nodes, gum, or mediastinal mass involvement constituted extramedullary disease.

The associations of MN1 expression with baseline clinical, demographic, and molecular features, and achievement of CR were analyzed using one-way analysis of variance. Kaplan-Meier plots were generated for each time-to-event outcome measure (DFS and OS) using MN1 expression quartiles. The corresponding tests for trend were calculated for each survival end point.34 Comparisons between cases analyzed for MN1 v those not analyzed were tested using the Fisher's exact test for CR rates and the log-rank test for the OS and DFS end points.

Multivariable logistic regression models were constructed to analyze factors related to the probability of achieving CR and multivariable Cox proportional hazards models were constructed to analyze factors important for the survival end points, OS and DFS. Factors examined for model inclusion were MN1 expression, FLT3-ITD, FLT3-TKD, NPM1 and WT1 mutational status, age, hemoglobin, platelet count, WBC, percentages of BM and blood blasts, sex, race, and extramedullary involvement, and for survival end points only, MLL-PTD, CEBPA mutational status, and ERG and BAALC expression levels. For the multivariable Cox models, the proportional hazards assumption was checked for each variable individually. If the proportional hazards assumption was not met for a particular variable for a given end point, an artificial time-dependent covariate was included in the model for that end point. Variables considered for inclusion in the logistic and Cox multivariable models were those significant at α = .20 from the univariable models. All models were constructed using a limited backwards selection procedure. Variables remaining in the final models were significant at α = .05. For achievement of CR, estimated odds ratios (OR), and for survival end points, hazard ratios (HR) with their corresponding 95% CIs were obtained for each significant prognostic factor.

For microarray analyses, summary measures of gene and microRNA expression were computed, normalized, and filtered (Appendix).35 Pearson correlation coefficients were computed between the resulting expression values of 24,183 Affymetrix probe sets and the natural log transformation of MN1 expression, and between the resulting expression values of 305 microRNA probes and the natural log transformation of MN1 expression values; significant Affymetrix probe sets (P < .001) and microRNA probes (P < .005) comprised the MN1 gene- and microRNA-expression signatures, respectively. GenMAPP version 2.1 and MAPPFinder version 2.136 (Gladstone Institutes, the University of California, San Francisco, CA; http://www.genmapp.org/) were used to assess over-represented gene ontology (GO) terms within the identified gene-expression signature (Appendix).

All statistical analyses were performed by the CALGB Statistical Center.

RESULTS

Association of MN1 Expression With Molecular and Clinical Characteristics and Outcome

At diagnosis, higher MN1 expression (MN1/ABL copy number range, 0.007 to 7.317) was associated with lower frequency of NPM1 mutations (P < .001) and higher BAALC expression (P = .004) and less extramedullary disease (P = .01; Table 1; Fig 1). No other molecular or clinical characteristics were significantly associated with MN1 expression.

Table 1.
Relationship of Clinical and Molecular Characteristics With MN1 Expression Levels in Patients With Cytogenetically Normal Acute Myeloid Leukemia at Diagnosis (N = 119)
Fig 1.
Clinical and molecular variables significantly associated with the meningioma 1 (MN1) gene expression. The direction of the correlation is shown by displaying the mean values and corresponding 95% CIs of MN1 expression for each category of the clinical ...

The overall CR rate of the patients analyzed for MN1 expression was 83%. Patients who failed to achieve CR had higher MN1 levels (P = .006; Fig 2A). No interaction between MN1 levels and induction treatment (ie, with or without PSC-833) was found for CR achievement. On multivariable analysis, patients with higher MN1 expression were less likely to achieve CR (P = .005) after adjustment for WBC (P = .005; Table 2).

Fig 2.
Outcome of cytogenetically normal acute myeloid leukemia (CN-AML) patients according to the meningioma 1 (MN1) gene expression levels. (A) Comparison of MN1 expression in patients who achieved a complete remission (CR) compared with patients who did not ...
Table 2.
Multivariable Analyses for Clinical Outcome

The median follow-up for patients with no event (ie, failure to achieve CR, relapse, or death) was 5.1 years (range, 2.7 to 9.9 years). Higher MN1 expression was associated with shorter DFS (P < .001) and OS (P < .001). An interaction between MN1 levels and variations in the consolidation or maintenance treatments could not be evaluated because of sample size limitations. In multivariable models, higher MN1 expression was associated with shorter DFS (P = .01) after adjusting for WT1 mutations (P = .01), FLT3-ITD (P = .02), and high ERG expression (P = .04). Likewise, shorter OS (P = .04) was associated with higher MN1 expression when controlling for WT1 (P < .001) and NPM1 mutations (P = .04), FLT3-ITD (P = .01), and WBC (P < .001; Table 2). Similar results were observed when the FLT3-ITD/FLT3 wild-type allelic ratio (no FLT3-ITD v FLT3-ITD/FLT3 wild-type < .7 v FLT3-ITD/FLT3 wild-type ≥ .7) rather than presence compared with absence of FLT3-ITD, was utilized as a factor in the multivariable models.

To graphically display the relationship between MN1 expression and clinical outcome, patients were divided into four groups corresponding to the quartile (Q) values of MN1 expression (Figs 2B, B,2C).2C). The 5-year DFS and OS estimates were progressively lower from Q1 (ie, patients with the lowest 25% of MN1 expression values) to Q4 (ie, patients with the highest 25% of MN1 expression values; P < .001, test for trend for both DFS and OS). Patients in Q1 had remarkably favorable outcomes, with expected 5-year DFS and OS rates of 74% and 80%, respectively, compared with only 36% and 40%, respectively, for the remaining patients.

Biologic Insights

To gain insight into leukemogenic mechanisms associated with changes in MN1 expression, we derived both gene- and microRNA-expression signatures using microarray assays. The MN1-associated gene-expression signature consisted of 555 probes (Appendix Table A1, online only; Fig 3). Expression of 261 probe sets positively correlated with MN1 expression levels, and expression of 294 probe sets negatively correlated with MN1 expression levels. The probe set for MN1 had the highest positive coefficient of correlation (r = .87), corroborating the quantification of MN1 expression obtained by real-time RT-PCR. Furthermore, we found MN1 expression levels to be directly correlated with BAALC expression levels and with the expression of genes recently reported as associated with a BAALC expression signature,30 specifically, PROM1, CD34, FZD6, CRYGD, CD200, and ABCB1 (MDR1). MN1 expression levels were negatively associated with expression of HOX genes (ie, HOXA2, HOXA3, HOXA4, HOXA5, and MEIS1) that have also been reported to be expressed at lower levels in NPM1 wild-type patients.37 Thus, the microarray data were consistent with the association between higher MN1 levels and high BAALC expresser and NPM1 wild-type status observed at diagnosis in our patients (Table 1; Fig 1).

Fig 3.
Heat map of gene probe sets that correlated significantly with the meningioma 1 (MN1) gene expression. Expression values of the probe sets are represented by color, with green indicating expression below and red expression above the median value for the ...

Using GO (www.geneontology.org), a project that groups together genes (referred to as members) participating in specific biologic processes (referred to as terms), we tested separately which terms were over-represented among the genes positively and negatively correlated with MN1 expression levels. An over-represented term is one for which more members assigned to that term are found in the microarray signature than expected by chance. Thus, over-represented terms may provide insight into the biologic functions of the gene-expression signature associated with MN1 expression changes. Sixteen GO terms were over-represented among the 261 gene probes positively correlated with MN1 expression (Appendix Table A2, online only). Most of the 16 GO terms were related to the macrophage immune function of antigen processing and presentation.38 Twenty-nine GO terms were over-represented among the 294 probe sets that negatively correlated with MN1 expression (Appendix Table A2). Among those 29 GO terms, most were related to DNA, chromatin or chromosome organization, and tissue and organ development.

We derived an MN1-associated microRNA-expression signature comprising 15 microRNAs (Appendix Table A3, online only; Fig 4). Of the 15 microRNA probes, expression of 8 was positively and expression of 7 negatively correlated with MN1 expression. Five of 8 microRNA probes positively associated with MN1 expression corresponded to the hsa-miR-126 family (including both hsa-miR-126 and hsa-miR-126*). This microRNA family was recently reported to enhance the proangiogenic activity of VEGF and regulate new blood vessel formation.39,40 We also noted upregulation of hsa-miR-424, a regulator of monocyte and macrophage differentiation.41 Among the microRNA probes negatively correlated with MN1, we found microRNAs involved in apoptosis (ie, hsa-miR-16)42 or malignant transformation (ie, hsa-miR-19a and hsa-miR-20a members of the miR-17-92 polycistron)43,44 in addition to other microRNAs with unknown gene targets (ie, hsa-miR-100 and hsa-miR-196a).

Fig 4.
Heat map of microRNA probes that correlated significantly with the meningioma 1 (MN1) gene expression. Expression values of the probes are represented by color, with green indicating expression below and red expression above the median value for the given ...

DISCUSSION

High levels of MN1 expression were recently reported to negatively impact on outcome of CN-AML patients.14 To our knowledge, these results have not yet been independently validated. Thus, we tested the prognostic value of MN1 expression levels in younger CN-AML patients enrolled on similar CALGB first-line treatment protocols. We showed that the levels of MN1 expression directly correlated with the risk of failing remission induction chemotherapy, relapse, and/or death, and predicted outcome independently of other clinical and molecular variables, thereby confirming the initial observation by Heuser et al.14 All patients survived ≥ 30 days and were assessable for disease response after treatment. Therefore, the value of MN1 expression to predict treatment-related mortality was not assessed.

The two studies presented several methodologic differences. We analyzed exclusively patients diagnosed with primary AML, whereas Heuser et al14 also included patients with secondary AML. The patients in our study were similarly treated on two CALGB protocols that included consolidation treatment with autologous SCT (ASCT) or, in those few cases where ASCT was not possible, intensive consolidation chemotherapy. Patients who underwent allogeneic SCT in first CR were excluded. The German study included patients who underwent allogeneic SCT in addition to those receiving consolidation with ASCT or intensive chemotherapy.14 In the German study,14 MN1 expression levels were measured using both BM and blood samples, and comparison of outcome was performed between higher and lower MN1 expressers, dichotomized at the median value of MN1 expression. In our study, only BM samples were analyzed, and we considered MN1 expression as a continuous variable to avoid the need to adjust for different tissue types and eliminate the necessity of choosing arbitrary cutoff values to define groups of patients for comparison. Finally, Heuser et al14 analyzed patients only for FLT3-ITD, FLT3-TKD, MLL-PTD, and NPM1 mutations along with MN1 expression. In addition to these molecular markers, we also analyzed WT1 and CEBPA mutations, and ERG and BAALC expression levels. Despite these differences, the two studies were remarkably similar in their conclusions regarding the association of higher MN1 levels with wild-type NPM1 and poor outcome. However, while Heuser et al14 showed that MN1 expression was the only molecular marker that remained predictive of outcome in the final bivariable and multivariable models, we found that MN1 expression provided prognostic information additional to that provided by FLT3-ITD and WT1 mutations (for DFS and OS), high ERG expression (for DFS), and NPM1 mutations (for OS).

Previous studies reported MN1 as a fusion partner in the MN1/ETV6 chimeric gene in t(12;22), and to be overexpressed in inv16 AML.11,12 MN1 overexpression was shown to confer resistance to the differentiation activity of all-trans-retinoic acid (ATRA) in AML.13 Although murine models have in part recapitulated the ATRA-resistant phenotype of human MN1-associated AML, little is known about the mechanism through which aberrant expression of MN1 drives myeloid leukemogenesis.11,13 Thus, to gain insight into the functional significance of MN1 expression in AML, we derived gene and microRNA profiles that correlated with MN1 expression levels.

The gene-expression signature associated with MN1 expression comprised 555 probes. Notably, BAALC was among genes that correlated most strongly with MN1 expression. At diagnosis, high BAALC expressers indeed had higher levels of MN1 expression (Table 1; Fig 1). Consistent with this finding, we observed similarities between a signature associated with BAALC expression that we recently reported30 and the signature associated with MN1 expression. Associated with higher MN1 and BAALC expression were PROM1, CD34, FZD6, and CRYGD (genes expressed in noncommitted hematopoietic precursors), CD200 (associated with poor outcome in AML), and ABCB1 (involved in chemoresistance). Furthermore, in a comparative GO analysis (not shown), eight GO terms related to DNA, chromatin, and chromosome assembly, and organization were over-represented among the genes downregulated in both the BAALC and MN1 gene-expression signatures. These findings suggest a potential functional interplay between MN1 and BAALC in their contribution to myeloid leukemogenesis.

Despite the aforementioned similarities, the leukemogenic mechanisms associated with aberrant expression of MN1 and BAALC are unlikely to be identical. Using GO analysis, we showed that genes involved in antigen processing and presentation were positively associated with the MN1, but not BAALC, gene-expression signature. Among those, there were genes encoding both MHC class I and class II proteins and CD74 that are central to the mechanisms of antigen processing and presentation for T-cell activation by macrophage and dendritic cells.38 Interestingly, higher MN1 expression was also associated with higher expression of hsa-miR-424, which is transactivated by SPI1 (PU.1) and upregulated during monocyte/macrophage differentiation.41 We have recently published data suggesting that overexpression of certain microRNAs that potentially target genes encoding Toll-like receptors and IL1B, which also participate in macrophage and dendritic cell activation, are associated with worse prognosis.33 Altogether, these data suggest that aberrant activation of mechanisms involved in both native and acquired immunologic response may play a role in sustaining myeloblast proliferation and survival.

Among the eight microRNA probes whose higher expression was associated with higher MN1 expression, five corresponded to miR-126 family members. hsa-miR-126 and hsa-miR-126* are generated from the splicing and processing of intron 7 of the EGFL7 gene.40,45 Consistent with these data, we observed that MN1 expression positively correlated with expression of both EGFL7 and hsa-miR-126. A leukemogenic role for hsa-miR-126 has hitherto not been reported. However, two recent studies have shown that hsa-miR-126 regulates vascular integrity and angiogenesis by repressing negative regulators of the VEGF pathways.39,40 Whether aberrant activation of these mechanisms can contribute to leukemogenesis and impact the treatment response and outcome of CN-AML patients remains to be determined. Finally, since hsa-miR-16 targets the antiapoptotic BCL2 gene and is downregulated in cancer patients with poor outcome,42 it is not surprising that lower hsa-miR-16 expression was associated with higher MN1 expression predicting treatment resistance and worse outcome. It was somewhat surprising, however, that lower expression levels of hsa-miR-19a and hsa-miR-20, both part of the hsa-miR17-92 cluster, were associated with higher MN1 levels as this cluster was previously reported to be overexpressed in aggressive neoplasms (ie, B-cell lymphoma and lung cancer) and function as an oncogene.43,44

In summary, we show that higher MN1 expression is associated with wild-type NPM1, higher BAALC expression and worse outcome in CN-AML independent of other prognostic molecular markers. Patients with higher MN1 expression appear to share biologic features with patients with higher BAALC expression, namely upregulation of genes involved in chemoresistance in noncommitted hematopoietic precursors, and/or those with wild-type NPM1 (ie, lower expression of HOX genes). Aberrant MN1 expression seemingly contributes to leukemogenesis by affecting mechanisms of monocytic/macrophage function and differentiation. Validation of these findings in preclinical models and larger clinical studies may lead to the designing of novel therapies targeting activation of these potentially leukemogenic mechanisms by MN1 overexpression.

Supplementary Material

[Data Supplement]

Appendix

The following Cancer and Leukemia Group B institutions, principal investigators, and cytogeneticists participated in this study: The Ohio State University Medical Center, Columbus, OH: Clara D. Bloomfield, Karl S. Theil, and Nyla A. Heerema (grant no. CA77658); North Shore–Long Island Jewish Health System, Manhasset, NY: Daniel R. Budman and Prasad R.K. Koduru (grant no. CA35279); Wake Forest University School of Medicine, Winston-Salem, NC: David D. Hurd, Wendy L. Flejter, and Mark J. Pettenati (grant no. CA03927); Washington University School of Medicine, St Louis, MO: Nancy L. Bartlett, Michael S. Watson, and Jaime Garcia-Heras (grant no. CA77440); University of Massachusetts Medical Center, Worcester, MA: William W. Walsh, Vikram Jaswaney, Michael J. Mitchell, and Patricia Miron (grant no. CA37135); Roswell Park Cancer Institute, Buffalo, NY: Ellis G. Levine and AnneMarie W. Block (grant no. CA02599); Eastern Maine Medical Center, Bangor, ME: Harvey M. Segal and Laurent J. Beauregard (grant no. CA35406); University of Puerto Rico School of Medicine, San Juan, Puerto Rico: Eileen I. Pacheco, Leonard L. Atkins, Cynthia C. Morton, and Paola Dal Cin; Dana-Farber Cancer Institute, Boston, MA: Eric P. Winer, Paola Dal Cin, and Cynthia C. Morton (grant no. CA32291); Dartmouth Medical School, Lebanon, NH: Marc S. Ernstoff and Thuluvancheri K. Mohandas (grant no. CA04326); Duke University Medical Center, Durham, NC: Jeffrey Crawford and Mazin B. Qumsiyeh (grant no. CA47577); University of Chicago Medical Center, Chicago, IL: Gini Fleming, Diane Roulston, Katrin M. Carlson, Yanming Zhang, and Michelle M. Le Beau (grant no. CA41287); University of Iowa Hospitals, Iowa City, IA: Gerald H. Clamon and Shivanand R. Patil (grant no. CA47642); University of North Carolina, Chapel Hill, NC: Thomas C. Shea and Kathleen W. Rao (grant no. CA47559); University of California at San Diego: Barbara A. Parker, Renée Bernstein, and Marie L. Dell'Aquila (grant no. CA11789); Christiana Care Health Services Inc, Newark, DE: Stephen S. Grubbs and Jeanne M. Meck (grant no. CA45418); Ft Wayne Medical Oncology/Hematology, Ft Wayne, IN: Sreenivasa Nattam and Patricia I. Bader; Georgetown University Medical Center, Washington, DC: Minnetta C. Liu and Jeanne M. Meck (grant no. CA77597); Massachusetts General Hospital, Boston, MA: Jeffrey W. Clark, Paola Dal Cin, and Cynthia C. Morton (grant no. CA 12,449); Rhode Island Hospital, Providence, RI: William Sikov, Shelly L. Kerman, and Aurelia Meloni-Ehrig (grant no. CA08025); State University of New York Upstate Medical University, Syracuse, NY: Stephen L. Graziano and Constance K. Stein (grant no. CA21060); Virginia Commonwealth University Minority Based Community Clinical Oncology Program, Richmond, VA: John D. Roberts and Colleen Jackson-Cook (grant no. CA52784); Weill Medical College of Cornell University, New York, NY: John Leonard, Prasad R.K. Koduru, and Andrew J. Carroll (grant no. CA07968); Western Pennsylvania Hospital, Pittsburgh, PA: John Lister and Gerard R. Diggans; Vermont Cancer Center, Burlington, VT: Hyman B. Muss and Mary Tang (grant no. CA77406); Long Island Jewish Medical Center CCOP, Lake Success, NY: Kanti R. Rai and Prasad R.K. Koduru (grant no. CA11028); Medical University of South Carolina, Charleston, SC: Mark R. Green and G. Shashidhar Pai (grant no. CA03927); Minneapolis VA Medical Center, Minneapolis, MN: Vicki A. Morrison and Sugandhi A. Tharapel (grant no. CA47555); Mount Sinai School of Medicine, New York, NY: Lewis R. Silverman and Vesna Najfeld (grant no. CA04457); Nevada Cancer Research Foundation CCOP, Las Vegas, NV: John A. Ellerton and Marie L. Dell'Aquila (grant no. CA35421); University of California at San Francisco: Charles J. Ryan and Kathleen E. Richkind (grant no. CA60138); University of Illinois at Chicago: David J. Peace and Maureen M. McCorquodale (grant no. CA74811); University of Minnesota, Minneapolis, MN: Bruce A. Peterson and Betsy A. Hirsch (grant no. CA16450); University of Nebraska Medical Center, Omaha, NE: Anne Kessinger and Warren G. Sanger (grant no. CA77298); Walter Reed Army Medical Center, Washington, DC: Brendan M. Weiss and Digamber S. Borgaonkar (grant no. CA26806).

Treatment

Patients enrolled in Cancer and Leukemia Group B (CALGB) study 19808 were randomly assigned to receive induction chemotherapy with cytarabine, daunorubicin, and etoposide with or without PSC-833 (valspodar), a multidrug resistance protein inhibitor (Kolitz JE, George SL, Marcucci G, et al: Blood 106:122a-123a, 2005 [abstr 407]). On achievement of complete remission (CR), patients were assigned to intensification with high-dose cytarabine and etoposide for stem cell mobilization followed by myeloablative treatment with busulfan and etoposide supported by autologous peripheral blood stem cell transplantation. Patients enrolled in CALGB 9621 were treated similarly to those in CALGB 19808, as previously reported (Kolitz JE, George SL, Dodge RK, et al: J Clin Oncol 22:4290-4301, 2004). The only difference was that CALGB 9621 tested dose escalation of daunorubicin and etoposide during induction treatment, whereas the doses of these drugs were the same for all patients enrolled onto CALGB 19808. In addition, all patients on CALGB 9621 who achieved CR were assigned to receive interleukin-2, whereas on CALGB 19808, patients were randomly assigned to either receive interleukin-2 or observation.

Criteria for Response, Relapse, and Definition of Clinical End Points

CR was defined by bone marrow (BM) cellularity of at least 20%, lower than 5% leukemic blasts, no Auer rods, and maturation in all cell lineages and blood recovery of leukocyte (≥ 1,500/μL) and platelet (> 100,000/μL) counts. Relapse was defined as reoccurrence of ≥ 5% of leukemic blasts in BM, reappearance of circulating blasts, or the development of extramedullary leukemia. Disease-free survival was defined as the interval from the date of CR until removal from study due to relapse or death from any cause, censoring for patients alive at last follow-up. Overall survival was defined as the date on study until death, censoring for patients alive at last follow-up.

Clinical Outcome

The CR rate for the 119 cases analyzed for the meningioma 1 (MN1) gene expression was not different from those 121 that were not analyzed (83% v 84%; P = .86). Likewise, the time to event end points were similar between the two groups (3 year DFS: 47% v 46%; P = .37; 3 years OS: 54% v 49%; P = .33).

MN1 Analysis

Mononuclear cells from pretreatment BM were enriched by Ficoll-Hypaque gradient and cryopreserved in liquid nitrogen until they were thawed at 37°C for this analysis. Total RNA extraction was performed using Trizol reagent (Invitrogen, Carlsbad, CA), and cDNA was synthesized using MMLV reverse transcriptase (Invitrogen) and random hexamers. Quantitative real-time RT-PCR assays were carried out in a final reaction volume of 10 μL using 1 μL of cDNA, 1x universal master mix (Applied Biosystems, Foster City, CA) and 250 nmol MN1 probe (5′-FAM AACAGCAAAGAAGCCCACGACCTCC-TAMRA) with 900 nmol MN1 forward (5′-GAAGGCCAAACCCCAGAAC) and reverse (5′-GATGCTGAGGCCTTGTTTGC) primers. Primers and probe were designed using Primer Express software v2.0 (Applied Biosystems). For ABL, used here as an internal control, the previously described primers and probes were used (Beillard E, Pallisgaard N, van der Velden VHJ, et al: Leukemia 17:2474-2486, 2003). Samples were tested in duplicates on the 7900HT Fast Real-Time PCR System (Applied Biosystems). Positive controls (cDNA from the MN1 expressing cell line KG1a), negative controls (water control of the cDNA synthesis), and standard curves (serial dilutions of plasmids containing MN1 or ABL cloned fragments) were included in each run. MN1 copy numbers were measured and normalized to the copy numbers of ABL using standard curves constructed as reported previously (Marcucci G, Caligiuri MA, Döhner H, et al: Leukemia 15:1072-1080, 2001).

The independent prognostic value of MN1 expression was evaluated in the context of other prognostic clinical and molecular markers, as detailed in the statistical section of the article. For the statistical analyses, we did not impute missing data. Patients with available data on all variables were used in each step of the multivariable analyses.

Microarray Data Analysis

RNA samples from patients enrolled on CALGB 19808 and studied for MN1 expression were analyzed for genome-wide gene expression using Affymetrix U133 plus 2.0 GeneChips (Affymetrix). Double-stranded cDNA was prepared (Invitrogen, Carlsbad, CA) from total RNA using T7-Oligo(dT) primer (Affymetrix). In vitro transcription was performed with the BioArray HighYield RNA Transcript Labeling Kit (T7) (Enzo Life Science, Farmingdale, NY). Fragmented, biotinylated RNA samples were hybridized to the U133 plus 2.0 GeneChip for 16 hours at 45°C. Scanned images were converted to CEL files using GCOS software (Affymetrix).

For the gene expression microarrays, summary measures of the expression levels were computed for each probe set using the robust multichip average method, which incorporates quantile normalization of arrays (Irizarry RA, Bolstad BM, Collin F, et al: Nucleic Acids Res 31:e15, 2003). Expression values were logged (base 2) before analysis. A filtering step was performed to remove probe sets that did not display significant variation in expression across arrays. In this procedure, a χ2 test was used to test whether the observed variance in expression of a probe set was significantly larger than the median observed variance in expression for all probe sets using α = .01 as the significance level. A total of 24,183 probe sets passed the filtering criterion and were included in subsequent analyses.

RNA samples from patients enrolled on CALGB 19808 and studied for MN1 expression were also analyzed for genome-wide microRNA expression with microRNA microarray chips as previously reported (Marcucci G, Radmacher MD, Maharry K, et al: N Engl J Med 358:1919-1928, 2008). For microRNA microarrays, the signal intensity was calculated for each spot without adjusting for local background. Spots with a low signal-to-noise ratio were considered as missing values. Intensities were log-transformed and log-intensities from replicate spots were averaged. A median-centering normalization was performed based on all human microRNA probes represented on the array. MicroRNA probes with a low signal-to-noise ratio on 50% or more of arrays were excluded from subsequent analyses, reducing the number of examined human microRNA probes in the training set to 305. For each microRNA probe, an adjustment was made for batch effects (ie, differences in expression related to the batch in which arrays were hybridized). The batch adjustment was made by fitting a linear model for the expression values of each microRNA probe with array batch as the factor. A correction to the expression values was then made for the measured batch effects.

Microarray expression analyses were performed using BRB-ArrayTools version 3.7.0 (R. Simon, A.P. Lam, National Cancer Institute, Bethesda, MD) and using the R version 2.5.1 (R Foundation for Statistical Computing, Vienna, Austria; http://www.r-project.org/).

Gene Ontology Analysis

We tested separately which gene ontology terms for biologic processes were over-represented among the genes that positively and negatively correlated with MN1 expression levels. An over-represented term is one for which more members assigned to that term are found in the microarray signature than would be expected by chance. In our analysis, we only considered gene ontology terms for biologic processes for which at least 5 members (ie, genes) of the term were included in our microarray analysis. GenMAPP version 2.1 and MAPPFinder version 2.1 (Dahlquist KD, Salomonis N, Vranizan K, et al: Nat Genet 31:19-20, 2002) were used to assess over-represented gene ontologies among the genes comprising the identified signature. MAPPFinder uses a permutation procedure to determine the over-represented gene ontologies; a permutation P value of < .005 was considered significant.

Table A1.

Signature of 555 Affymetrix Probe Sets Significantly Correlated With MN1 Expression Level, Grouped by Direction of Correlation and Ordered Alphabetically by Gene Symbol

Probe SetGene SymbolNamePearson CorrelationP
Positively correlated with MN1 expression
    209993_atABCB1ATP-binding cassette, sub-family B (MDR/TAP), member 10.4682.29E-05
    209994_s_atABCB1ATP-binding cassette, sub-family B (MDR/TAP), member 10.4583.66E-05
    243951_atABCB1ATP-binding cassette, sub-family B (MDR/TAP), member 10.4466.14E-05
    202850_atABCD3ATP-binding cassette, sub-family D (ALD), member 30.373.000987
    232081_atABCG1ATP-binding cassette, sub-family G (WHITE), member 10.4917.70E-06
    204567_s_atABCG1ATP-binding cassette, sub-family G (WHITE), member 10.381.000755
    1570432_atABCG1ATP-binding cassette, sub-family G (WHITE), member 10.373.000968
    204638_atACP5Acid phosphatase 5, tartrate resistant0.4534.49E-05
    1554974_atACY3Aspartoacylase (aminocyclase) 30.412.00024
    230481_atACY3Aspartoacylase (aminocyclase) 30.375.000912
    209321_s_atADCY3Adenylate cyclase 30.4632.84E-05
    209320_atADCY3Adenylate cyclase 30.378.000833
    221718_s_atAKAP13A kinase (PRKA) anchor protein 130.432.000108
    224884_atAKAP13A kinase (PRKA) anchor protein 130.388.000585
    208325_s_atAKAP13A kinase (PRKA) anchor protein 130.380.000786
    200602_atAPPAmyloid beta (A4) precursor protein (peptidase nexin-II, Alzheimer disease)0.410.000258
    237571_atAPPAmyloid beta (A4) precursor protein (peptidase nexin-II, Alzheimer disease)0.385.000639
    239567_atARHGAP10Rho GTPase activating protein 100.4505.13E-05
    225166_atARHGAP18Rho GTPase activating protein 180.4702.09E-05
    222780_s_atBAALCBrain and acute leukemia, cytoplasmic0.5691E-07
    218899_s_atBAALCBrain and acute leukemia, cytoplasmic0.5612E-07
    210201_x_atBIN1Bridging integrator 10.382.00073
    214439_x_atBIN1Bridging integrator 10.379.000801
    229801_atC10orf47Chromosome 10 open reading frame 470.4398.08E-05
    230051_atC10orf47Chromosome 10 open reading frame 470.416.000207
    233138_atC18orf1Chromosome 18 open reading frame 10.4398.10E-05
    242551_atC18orf1Chromosome 18 open reading frame 10.4388.64E-05
    210785_s_atC1orf38Chromosome 1 open reading frame 380.4554.10E-05
    207571_x_atC1orf38Chromosome 1 open reading frame 380.4514.83E-05
    223039_atC22orf13Chromosome 22 open reading frame 130.418.000187
    221823_atC5orf30Chromosome 5 open reading frame 300.378.000814
    1554486_a_atC6orf114Chromosome 6 open reading frame 1140.378.000839
    223075_s_atC9orf58Chromosome 9 open reading frame 580.403.000337
    209583_s_atCD200CD200 molecule0.5142.40E-06
    209582_s_atCD200CD200 molecule0.4702.08E-05
    203593_atCD2APCD2-associated protein0.4662.55E-05
    209933_s_atCD300ACD300a molecule0.4427.18E-05
    217078_s_atCD300ACD300a molecule0.392.000511
    209543_s_atCD34CD34 molecule0.431.000114
    209619_atCD74CD74 molecule, major histocompatibility complex, class II invariant chain0.389.00057
    218451_atCDCP1CUB domain containing protein 10.387.000611
    239317_atCEACAM21Carcinoembryonic antigen-related cell adhesion molecule 210.5631E-07
    213618_atCENTD1Centaurin, delta 10.4446.55E-05
    206210_s_atCETPCholesteryl ester transfer protein, plasma0.4369.35E-05
    219161_s_atCKLFChemokine-like factor0.4831.15E-05
    221058_s_atCKLFChemokine-like factor0.433.000104
    231219_atCKLFChemokine-like factor0.415.000216
    1556209_atCLEC2BC-type lectin domain family 2, member B0.5444.00E-07
    209732_atCLEC2BC-type lectin domain family 2, member B0.4446.50E-05
    226425_atCLIP4CAP-GLY domain containing linker protein family, member 40.399.000399
    229967_atCMTM2CKLF-like MARVEL transmembrane domain containing 20.387.000608
    225009_atCMTM4CKLF-like MARVEL transmembrane domain containing 40.415.000212
    227953_atCMTM6CKLF-like MARVEL transmembrane domain containing 60.417.000199
    203642_s_atCOBLL1COBL-like 10.5367.00E-07
    203641_s_atCOBLL1COBL-like 10.4378.88E-05
    202119_s_atCPNE3Copine III0.422.000163
    202118_s_atCPNE3Copine III0.400.000381
    205984_atCRHBPCorticotropin releasing hormone binding protein0.5271.20E-06
    201380_atCRTAPCartilage associated protein0.391.00053
    207532_atCRYGDCrystallin, gamma D0.387.000599
    207030_s_atCSRP2Cysteine and glycine-rich protein 20.4593.42E-05
    211126_s_atCSRP2Cysteine and glycine-rich protein 20.4427.08E-05
    215785_s_atCYFIP2Cytoplasmic FMR1 interacting protein 20.385.000642
    222134_atDDOD-aspartate oxidase0.411.000246
    1558742_atDEXIDexamethasone-induced transcript0.382.000731
    202481_atDHRS3Dehydrogenase/reductase (SDR family) member 30.429.00012
    212888_atDICER1Dicer1, Dcr-1 homolog (Drosophila)0.373.000995
    232252_atDUSP27Dual specificity phosphatase 27 (putative)0.379.000802
    239574_atECHDC3Enoyl Coenzyme A hydratase domain containing 30.424.000153
    218825_atEGFL7EGF-like-domain, multiple 70.4534.55E-05
    225159_s_atELK4ELK4, ETS-domain protein (SRF accessory protein 1)0.376.000881
    201325_s_atEMP1Epithelial membrane protein 10.4702.13E-05
    201324_atEMP1Epithelial membrane protein 10.4436.85E-05
    228256_s_atEPB41L4AErythrocyte membrane protein band 4.1 like 4A0.393.000482
    202609_atEPS8Epidermal growth factor receptor pathway substrate 80.381.00076
    32259_atEZH1Enhancer of zeste homolog 1 (Drosophila)0.4721.87E-05
    213506_atF2RL1Coagulation factor II (thrombin) receptor-like 10.602< 1e-07
    206429_atF2RL1Coagulation factor II (thrombin) receptor-like 10.5132.60E-06
    228678_atFAM116BFamily with sequence similarity 116, member B0.395.000454
    217967_s_atFAM129AFamily with sequence similarity 129, member A0.4975.80E-06
    217966_s_atFAM129AFamily with sequence similarity 129, member A0.4841.08E-05
    208229_atFGFR2Fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome)0.411.000246
    1562433_atFLJ10489Hypothetical protein FLJ104890.582< 1e-07
    1555486_a_atFLJ14213Hypothetical protein FLJ142130.5241.40E-06
    219383_atFLJ14213Hypothetical protein FLJ142130.5181.90E-06
    233379_atFLJ14213Hypothetical protein FLJ142130.5014.80E-06
    236322_atFLJ31951Hypothetical protein FLJ319510.4349.83E-05
    238949_atFLJ31951Hypothetical protein FLJ319510.398.000406
    226077_atFLJ31951Hypothetical protein FLJ319510.379.000788
    215330_atFLJ43663Hypothetical protein FLJ436630.4573.72E-05
    228702_atFLJ43663Hypothetical protein FLJ436630.4475.84E-05
    242768_atFLJ43663Hypothetical protein FLJ436630.4359.60E-05
    239901_atFLJ43663Hypothetical protein FLJ436630.398.000411
    238619_atFLJ43663Hypothetical protein FLJ436630.385.000647
    218084_x_atFXYD5FXYD domain containing ion transport regulator 50.413.000233
    224252_s_atFXYD5FXYD domain containing ion transport regulator 50.412.000238
    203987_atFZD6Frizzled homolog 6 (Drosophila)0.5122.60E-06
    1557030_atGAB1GRB2-associated binding protein 10.415.000216
    227428_atGABPAGA binding protein transcription factor, alpha subunit 60kDa0.397.000422
    203765_atGCAGrancalcin, EF-hand calcium binding protein0.422.000164
    228376_atGGTA1Glycoprotein, alpha-galactosyltransferase 10.405.000309
    209276_s_atGLRXGlutaredoxin (thioltransferase)0.407.00029
    207987_s_atGNRH1Gonadotropin-releasing hormone 1 (luteinizing-releasing hormone)0.617< 1e-07
    235540_atGNRH1Gonadotropin-releasing hormone 1 (luteinizing-releasing hormone)0.4731.79E-05
    219313_atGRAMD1CGRAM domain containing 1C0.381.000759
    200696_s_atGSNGelsolin (amyloidosis, Finnish type)0.396.000439
    1557915_s_atGSTO1Glutathione S-transferase omega 10.4534.43E-05
    201470_atGSTO1Glutathione S-transferase omega 10.4495.40E-05
    217436_x_atHLA-AMajor histocompatibility complex, class I, A0.4378.74E-05
    211911_x_atHLA-BMajor histocompatibility complex, class I, B0.431.000111
    209140_x_atHLA-BMajor histocompatibility complex, class I, B0.414.000223
    208729_x_atHLA-BMajor histocompatibility complex, class I, B0.405.000317
    208812_x_atHLA-CMajor histocompatibility complex, class I, C0.4544.23E-05
    214459_x_atHLA-CMajor histocompatibility complex, class I, C0.426.000137
    211799_x_atHLA-CMajor histocompatibility complex, class I, C0.403.000342
    216526_x_atHLA-CMajor histocompatibility complex, class I, C0.400.000384
    217478_s_atHLA-DMAMajor histocompatibility complex, class II, DM alpha0.4524.77E-05
    226878_atHLA-DOAMajor histocompatibility complex, class II, DO alpha0.400.000375
    211991_s_atHLA-DPA1Major histocompatibility complex, class II, DP alpha 10.4388.49E-05
    211990_atHLA-DPA1Major histocompatibility complex, class II, DP alpha 10.426.000139
    201137_s_atHLA-DPB1Major histocompatibility complex, class II, DP beta 10.4801.29E-05
    244485_atHLA-DPB1Major histocompatibility complex, class II, DP beta 10.4692.21E-05
    208894_atHLA-DRAMajor histocompatibility complex, class II, DR alpha0.425.000145
    210982_s_atHLA-DRAMajor histocompatibility complex, class II, DR alpha0.411.000245
    209312_x_atHLA-DRB1Major histocompatibility complex, class II, DR beta 10.420.000179
    215193_x_atHLA-DRB1Major histocompatibility complex, class II, DR beta 10.415.000212
    208306_x_atHLA-DRB4Major histocompatibility complex, class II, DR beta 40.421.000167
    204670_x_atHLA-DRB5Major histocompatibility complex, class II, DR beta 50.431.000114
    217362_x_atHLA-DRB6Major histocompatibility complex, class II, DR beta 6 (pseudogene)0.423.000157
    200904_atHLA-EMajor histocompatibility complex, class I, E0.391.000533
    217456_x_atHLA-EMajor histocompatibility complex, class I, E0.377.000845
    204806_x_atHLA-FMajor histocompatibility complex, class I, F0.400.000375
    221875_x_atHLA-FMajor histocompatibility complex, class I, F0.379.000798
    211529_x_atHLA-GHLA-G histocompatibility antigen, class I, G0.4652.69E-05
    210514_x_atHLA-GHLA-G histocompatibility antigen, class I, G0.4623.03E-05
    211530_x_atHLA-GHLA-G histocompatibility antigen, class I, G0.4544.39E-05
    211528_x_atHLA-GHLA-G histocompatibility antigen, class I, G0.4349.96E-05
    211597_s_atHOPHomeodomain-only protein0.375.00093
    210253_atHTATIP2HIV-1 Tat interactive protein 2, 30kDa0.4975.70E-06
    239704_atIBRDC2IBR domain containing 20.4975.60E-06
    228153_atIBRDC2IBR domain containing 20.376.000879
    208966_x_atIFI16Interferon, gamma-inducible protein 160.4388.43E-05
    208965_s_atIFI16Interferon, gamma-inducible protein 160.432.000107
    206332_s_atIFI16Interferon, gamma-inducible protein 160.423.000154
    204439_atIFI44LInterferon-induced protein 44-like0.380.000786
    226267_atJDP2Jun dimerization protein 20.4879.40E-06
    239835_atKBTBD8Kelch repeat and BTB (POZ) domain containing 80.401.000369
    224316_atKCTD9Potassium channel tetramerisation domain containing 90.4711.96E-05
    218823_s_atKCTD9Potassium channel tetramerisation domain containing 90.4369.22E-05
    229878_atKIAA1731KIAA17310.427.000133
    221221_s_atKLHL3Kelch-like 3 (Drosophila)0.4378.77E-05
    200650_s_atLDHALactate dehydrogenase A0.379.000809
    212658_atLHFPL2Lipoma HMGIC fusion partner-like 20.406.000301
    219541_atLIME1Lck interacting transmembrane adaptor 10.374.000937
    223925_s_atLOC767558Myeloproliferative disease-associated SEREX antigen0.424.000151
    210102_atLOH11CR2ALoss of heterozygosity, 11, chromosomal region 2, gene A0.4662.54E-05
    205011_atLOH11CR2ALoss of heterozygosity, 11, chromosomal region 2, gene A0.4613.15E-05
    240338_atLRAPLeukocyte-derived arginine aminopeptidase0.383.000694
    203523_atLSP1Lymphocyte-specific protein 10.4427.25E-05
    202145_atLY6ELymphocyte antigen 6 complex, locus E0.398.000403
    224480_s_atMAG1Lung cancer metastasis-associated protein0.420.000178
    1569136_atMGAT4AMannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A0.5396.00E-07
    1558166_atMGC16275Hypothetical protein MGC162750.406.000297
    206247_atMICBMHC class I polypeptide-related sequence B0.394.000477
    239272_atMMP28Matrix metallopeptidase 280.5014.80E-06
    205330_atMN1Meningioma (disrupted in balanced translocation) 10.866< 1e-07
    219648_atMREGMelanoregulin0.4995.30E-06
    218027_atMRPL15Mitochondrial ribosomal protein L150.374.000931
    219363_s_atMTERFD1MTERF domain containing 10.403.000336
    225111_s_atNAPBN-ethylmaleimide-sensitive factor attachment protein, beta0.399.000395
    243246_atNAT12N-acetyltransferase 120.422.000161
    236197_atNCBP1Nuclear cap binding protein subunit 1, 80kDa0.4917.70E-06
    240824_atOBFC1Oligonucleotide/oligosaccharide-binding fold containing 10.4937.10E-06
    223259_atORMDL3ORM1-like 3 (S. cerevisiae)0.402.000345
    228966_atPANK2Pantothenate kinase 2 (Hallervorden-Spatz syndrome)0.423.000158
    232140_atPGM5P1Phosphoglucomutase 5 pseudogene 10.393.000494
    235389_atPHF20PHD finger protein 200.393.000486
    209780_atPHTF2Putative homeodomain transcription factor 20.400.000382
    206370_atPIK3CGPhosphoinositide-3-kinase, catalytic, gamma polypeptide0.395.000447
    235230_atPLCXD2Phosphatidylinositol-specific phospholipase C, X domain containing 20.396.000443
    201136_atPLP2Proteolipid protein 2 (colonic epithelium-enriched)0.384.000684
    213241_atPLXNC1Plexin C10.4603.34E-05
    206470_atPLXNC1Plexin C10.418.000188
    206471_s_atPLXNC1Plexin C10.414.000223
    209799_atPRKAA1Protein kinase, AMP-activated, alpha 1 catalytic subunit0.426.00014
    222582_atPRKAG2Protein kinase, AMP-activated, gamma 2 non-catalytic subunit0.389.000555
    214203_s_atPRODHProline dehydrogenase (oxidase) 10.422.000163
    204304_s_atPROM1Prominin 10.406.000301
    241133_atPRSS1Protease, serine, 1 (trypsin 1)0.431.000113
    240766_atPRSS1Protease, serine, 1 (trypsin 1)0.399.000388
    209040_s_atPSMB8Proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7)0.4702.05E-05
    204279_atPSMB9Proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional peptidase 2)0.406.000298
    201087_atPXNPaxillin0.4466.01E-05
    230405_atRAD50RAD50 homolog (S. cerevisiae)0.4672.42E-05
    232253_atRAD50RAD50 homolog (S. cerevisiae)0.415.000211
    235846_atRAD54BRAD54 homolog B (S. cerevisiae)0.413.000234
    204070_atRARRES3Retinoic acid receptor responder (tazarotene induced) 30.4652.62E-05
    221827_atRBCK1RanBP-type and C3HC4-type zinc finger containing 10.401.000362
    218117_atRBX1Ring-box 10.384.000682
    227425_atREPS2RALBP1 associated Eps domain containing 20.4495.39E-05
    242571_atREPS2RALBP1 associated Eps domain containing 20.430.000117
    220570_atRETNResistin0.404.000323
    214000_s_atRGS10Regulator of G-protein signalling 100.425.000144
    204319_s_atRGS10Regulator of G-protein signalling 100.411.000247
    219045_atRHOFras homolog gene family, member F (in filopodia)0.414.000219
    243178_atRNF149Ring finger protein 1490.373.000989
    229543_atRP1-93H18.5Hypothetical protein LOC4411680.5612E-07
    228362_s_atRP1-93H18.5Hypothetical protein LOC4411680.5435.00E-07
    229391_s_atRP1-93H18.5Hypothetical protein LOC4411680.5251.30E-06
    229390_atRP1-93H18.5Hypothetical protein LOC4411680.5241.40E-06
    226335_atRPS6KA3Ribosomal protein S6 kinase, 90kDa, polypeptide 30.428.000127
    1554876_a_atS100ZS100 calcium binding protein Z0.4721.89E-05
    226169_atSBF2SET binding factor 20.4702.08E-05
    242935_atSBF2SET binding factor 20.4407.88E-05
    233914_s_atSBF2SET binding factor 20.421.000171
    206995_x_atSCARF1Scavenger receptor class F, member 10.374.000935
    41220_atSEPT9Septin 90.382.000723
    211474_s_atSERPINB6Serpin peptidase inhibitor, clade B (ovalbumin), member 60.4583.54E-05
    1556950_s_atSERPINB6Serpin peptidase inhibitor, clade B (ovalbumin), member 60.416.000202
    209723_atSERPINB9Serpin peptidase inhibitor, clade B (ovalbumin), member 90.4534.53E-05
    242814_atSERPINB9Serpin peptidase inhibitor, clade B (ovalbumin), member 90.402.000354
    218346_s_atSESN1Sestrin 10.384.000662
    241245_atSFRS4Splicing factor, arginine/serine-rich 40.406.000297
    201811_x_atSH3BP5SH3-domain binding protein 5 (BTK-associated)0.377.000868
    219256_s_atSH3TC1SH3 domain and tetratricopeptide repeats 10.386.000622
    203124_s_atSLC11A2Solute carrier family 11 (proton-coupled divalent metal ion transporters), member 20.374.000951
    226601_atSLC30A7Solute carrier family 30 (zinc transporter), member 70.377.000859
    212944_atSLC5A3Solute carrier family 5 (inositol transporters), member 30.405.00031
    206543_atSMARCA2SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 20.388.000586
    219109_atSPAG16Sperm associated antigen 160.4407.87E-05
    212667_atSPARCSecreted protein, acidic, cysteine-rich (osteonectin)0.4761.57E-05
    200665_s_atSPARCSecreted protein, acidic, cysteine-rich (osteonectin)0.4603.30E-05
    213820_s_atSTARD5START domain containing 50.404.000323
    201061_s_atSTOMStomatin0.4613.23E-05
    201060_x_atSTOMStomatin0.393.000489
    226117_atTIFATRAF-interacting protein with a forkhead-associated domain0.431.000112
    241844_x_atTMEM156Transmembrane protein 1560.376.000893
    231775_atTNFRSF10ATumor necrosis factor receptor superfamily, member 10a0.426.00014
    209354_atTNFRSF14Tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)0.373.000972
    214581_x_atTNFRSF21Tumor necrosis factor receptor superfamily, member 210.413.00023
    218856_atTNFRSF21Tumor necrosis factor receptor superfamily, member 210.403.000335
    235973_atTRIP11Thyroid hormone receptor interactor 110.431.000114
    225775_atTSPAN33Tetraspanin 330.5152.30E-06
    213172_atTTC9Tetratricopeptide repeat domain 90.388.00059
    1553183_atUMODL1Uromodulin-like 10.4446.73E-05
    208844_atVDAC3Voltage-dependent anion channel 30.394.000477
    205672_atXPAXeroderma pigmentosum, complementation group A0.4563.93E-05
    230913_at0.4965.90E-06
    226550_at0.4821.19E-05
    239184_at0.4781.44E-05
    240153_at0.4771.49E-05
    1558105_a_at0.4524.74E-05
    231431_s_at0.4465.99E-05
    237315_at0.4359.54E-05
    210824_at0.422.000159
    233867_at0.415.000213
    229380_at0.393.000481
    232227_at0.387.000606
    229011_at0.385.00064
    225567_at0.382.000726
    244561_at0.380.000766
Negatively correlated with MN1 expression
    218434_s_atAACSAcetoacetyl-CoA synthetase−0.4271.32E-04
    1553605_a_atABCA13ATP-binding cassette, sub-family A (ABC1), member 13−0.393.000485
    210377_atACSM3Acyl-CoA synthetase medium-chain family member 3−0.4132.34E-04
    205942_s_atACSM3Acyl-CoA synthetase medium-chain family member 3−0.4172.00E-04
    201792_atAEBP1AE binding protein 1−0.4378.81E-05
    212173_atAK2Adenylate kinase 2−0.4869.9E-06
    212747_atANKS1AAnkyrin repeat and sterile alpha motif domain containing 1A−0.5339E-07
    225286_atARSDArylsulfatase D−0.374.000955
    223695_s_atARSDArylsulfatase D−0.375.000918
    230131_x_atARSDArylsulfatase D−0.384.000673
    204608_atASLArgininosuccinate lyase−0.381.00075
    218908_atASPSCR1Alveolar soft part sarcoma chromosome region, candidate 1−0.395.000461
    240747_atATP8B4ATPase, Class I, type 8B, member 4−0.377.00086
    220416_atATP8B4ATPase, Class I, type 8B, member 4−0.4231.55E-04
    227877_atAXIIRSimilar to annexin II receptor−0.4162.06E-04
    203304_atBAMBIBMP and activin membrane-bound inhibitor homolog (Xenopus laevis)−0.509.000003
    218332_atBEX1Brain expressed, X-linked 1−0.4281.27E-04
    202265_atBMI1BMI1 polycomb ring finger oncogene−0.388.000588
    213578_atBMPR1ABone morphogenetic protein receptor, type IA−0.4122.38E-04
    240772_atC10orf11Chromosome 10 open reading frame 11−0.4879.4E-06
    223703_atC10orf11Chromosome 10 open reading frame 11−0.5112.8E-06
    219988_s_atC1orf164Chromosome 1 open reading frame 164−0.404.000322
    230381_atC1orf186Chromosome 1 open reading frame 186−0.394.000473
    223063_atC1orf198Chromosome 1 open reading frame 198−0.373.000974
    219951_s_atC20orf12Chromosome 20 open reading frame 12−0.388.000579
    238767_atC4orf36Chromosome 4 open reading frame 36−0.394.000476
    201309_x_atC5orf13Chromosome 5 open reading frame 13−0.396.000442
    201310_s_atC5orf13Chromosome 5 open reading frame 13−0.4102.62E-04
    238465_atC5orf35Chromosome 5 open reading frame 35−0.4301.19E-04
    219261_atC7orf26Chromosome 7 open reading frame 26−0.379.000811
    232668_atC8orf72Chromosome 8 open reading frame 72−0.4623.07E-05
    228790_atC8orf72Chromosome 8 open reading frame 72−0.482.000012
    221959_atC8orf72Chromosome 8 open reading frame 72−0.4985.5E-06
    207129_atCA5BCarbonic anhydrase VB, mitochondrial−0.397.000418
    214082_atCA5BCarbonic anhydrase VB, mitochondrial−0.4132.33E-04
    243416_atCACHD1Cache domain containing 1−0.4456.40E-05
    225627_s_atCACHD1Cache domain containing 1−0.4642.77E-05
    210817_s_atCALCOCO2Calcium binding and coiled-coil domain 2−0.374.000958
    220162_s_atCARD9Caspase recruitment domain family, member 9−0.4112.52E-04
    201432_atCATCatalase−0.4956.3E-06
    211922_s_atCATCatalase−0.510.000003
    228061_atCCDC126Coiled-coil domain containing 126−0.379.000792
    237305_atCDH2Cadherin 2, type 1, N-cadherin (neuronal)−0.403.000338
    222755_s_atCHD7Chromodomain helicase DNA binding protein 7−0.504.000004
    226123_atCHD7Chromodomain helicase DNA binding protein 7−0.5093.1E-06
    218829_s_atCHD7Chromodomain helicase DNA binding protein 7−0.5112.9E-06
    205131_x_atCLEC11AC-type lectin domain family 11, member A−0.388.000587
    210783_x_atCLEC11AC-type lectin domain family 11, member A−0.403.000336
    227209_atCNTN1Contactin 1−0.398.000402
    212489_atCOL5A1Collagen, type V, alpha 1−0.377.000857
    212488_atCOL5A1Collagen, type V, alpha 1−0.4191.83E-04
    213622_atCOL9A2Collagen, type IX, alpha 2−0.4465.96E-05
    223457_atCOPG2Coatomer protein complex, subunit gamma 2−0.400.000384
    205624_atCPA3Carboxypeptidase A3 (mast cell)−0.4534.49E-05
    205653_atCTSGCathepsin G−0.385.000642
    229415_atCYCSCytochrome c, somatic−0.388.000584
    1567101_atDACH1Dachshund homolog 1 (Drosophila)−0.374.000934
    217025_s_atDBN1Drebrin 1−0.376.000893
    210397_atDEFB1Defensin, beta 1−0.398.000414
    207147_atDLX2Distal-less homeobox 2−0.384.000674
    228598_atDPP10Dipeptidyl-peptidase 10−0.373.000985
    238784_atDPY19L2dpy-19-like 2 (C. elegans)−0.393.000491
    204750_s_atDSC2Desmocollin 2−0.4241.52E-04
    204751_x_atDSC2Desmocollin 2−0.4456.28E-05
    226817_atDSC2Desmocollin 2−0.4623.03E-05
    205741_s_atDTNADystrobrevin, alpha−0.4672.38E-05
    210091_s_atDTNADystrobrevin, alpha−0.4771.49E-05
    227084_atDTNADystrobrevin, alpha−0.4811.24E-05
    1557803_atDTNADystrobrevin, alpha−0.5367E-07
    219469_atDYNC2H1Dynein, cytoplasmic 2, heavy chain 1−0.383.000688
    1565149_atDYNC2H1Dynein, cytoplasmic 2, heavy chain 1−0.4102.55E-04
    205107_s_atEFNA4Ephrin-A4−0.399.000397
    1558871_atEPGNEpithelial mitogen homolog (mouse)−0.5221.5E-06
    203349_s_atETV5ets variant gene 5 (ets-related molecule)−0.389.000553
    201828_x_atFAM127AFamily with sequence similarity 127, member A−0.396.000444
    224973_atFAM46AFamily with sequence similarity 46, member A−0.383.000685
    221766_s_atFAM46AFamily with sequence similarity 46, member A−0.4231.53E-04
    229546_atFAM84AFamily with sequence similarity 84, member A−0.398.000412
    228459_atFAM84AFamily with sequence similarity 84, member A−0.399.000395
    234331_s_atFAM84AFamily with sequence similarity 84, member A−0.4692.24E-05
    225667_s_atFAM84AFamily with sequence similarity 84, member A−0.4791.38E-05
    233087_atFBXL17F-box and leucine-rich repeat protein 17−0.402.000348
    227203_atFBXL17F-box and leucine-rich repeat protein 17−0.4241.50E-04
    238174_atFBXL17F-box and leucine-rich repeat protein 17−0.4662.49E-05
    242034_atFBXL17F-box and leucine-rich repeat protein 17−0.477.000015
    215000_s_atFEZ2Fasciculation and elongation protein zeta 2 (zygin II)−0.406.000301
    229280_s_atFLJ22536Hypothetical locus LOC401237−0.409.000271
    212288_atFNBP1Formin binding protein 1−0.374.000961
    209702_atFTOFatso−0.5112.8E-06
    204452_s_atFZD1Frizzled homolog 1 (Drosophila)−0.383.000689
    214106_s_atGMDSGDP-mannose 4,6-dehydratase−0.407.000294
    204983_s_atGPC4Glypican 4−0.4221.64E-04
    232453_atGPC6Glypican 6−0.387.000613
    220773_s_atGPHNGephyrin−0.384.00068
    234941_s_atGPHNGephyrin−0.4171.96E-04
    221892_atH6PDHexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)−0.4514.96E-05
    206643_atHALHistidine ammonia-lyase−0.5329E-07
    238021_s_athCG_1815491hCG1815491−0.4731.84E-05
    238022_athCG_1815491hCG1815491−0.4927.5E-06
    219687_atHHATHedgehog acyltransferase−0.377.000855
    237466_s_atHHIPHedgehog interacting protein−0.375.000911
    1556037_s_atHHIPHedgehog interacting protein−0.4191.86E-04
    207982_atHIST1H1THistone cluster 1, H1t−0.4231.55E-04
    214522_x_atHIST1H2ADHistone cluster 1, H2ad−0.393.000491
    239669_atHIST1H2ADHistone cluster 1, H2ad−0.5291.1E-06
    214644_atHIST1H2AKHistone cluster 1, H2ak−0.394.000464
    239041_atHIST1H2AKHistone cluster 1, H2ak−0.4359.54E-05
    214455_atHIST1H2BCHistone cluster 1, H2bc−0.4398.06E-05
    209911_x_atHIST1H2BDHistone cluster 1, H2bd−0.378.000836
    222067_x_atHIST1H2BDHistone cluster 1, H2bd−0.380.000781
    208527_x_atHIST1H2BEHistone cluster 1, H2be−0.403.000341
    208490_x_atHIST1H2BFHistone cluster 1, H2bf−0.385.000659
    236193_atHIST1H2BGHistone cluster 1, H2bg−0.4642.73E-05
    208523_x_atHIST1H2BIHistone cluster 1, H2bi−0.404.000331
    214502_atHIST1H2BJHistone cluster 1, H2bj−0.383.000704
    207226_atHIST1H2BNHistone cluster 1, H2bn−0.4583.65E-05
    214472_atHIST1H3DHistone cluster 1, H3d−0.4331.04E-04
    208076_atHIST1H4DHistone cluster 1, H4d−0.4495.29E-05
    202708_s_atHIST2H2BEHistone cluster 2, H2be−0.4466.08E-05
    1554453_atHNRPLLHeterogeneous nuclear ribonucleoprotein L-like−0.380.000772
    225385_s_atHNRPLLHeterogeneous nuclear ribonucleoprotein L-like−0.4563.88E-05
    204647_atHOMER3Homer homolog 3 (Drosophila)−0.4436.76E-05
    215489_x_atHOMER3Homer homolog 3 (Drosophila)−0.4761.62E-05
    222222_s_atHOMER3Homer homolog 3 (Drosophila)−0.484.000011
    214457_atHOXA2Homeobox A2−0.4956.4E-06
    208604_s_atHOXA3Homeobox A3−0.394.000476
    206289_atHOXA4Homeobox A4−0.382.000717
    213844_atHOXA5Homeobox A5−0.374.000956
    235521_atHOXA5Homeobox A5−0.400.000373
    223963_s_atIGF2BP2Insulin-like growth factor 2 mRNA binding protein 2−0.379.000814
    218847_atIGF2BP2Insulin-like growth factor 2 mRNA binding protein 2−0.383.000695
    203006_atINPP5AInositol polyphosphate-5-phosphatase, 40kDa−0.406.000298
    203331_s_atINPP5DInositol polyphosphate-5-phosphatase, 145kDa−0.374.000946
    213392_atIQCKIQ motif containing K−0.386.000622
    224572_s_atIRF2BP2Interferon regulatory factor 2 binding protein 2−0.4642.77E-05
    224570_s_atIRF2BP2Interferon regulatory factor 2 binding protein 2−0.4652.67E-05
    229638_atIRX3Iroquois homeobox protein 3−0.4632.83E-05
    210239_atIRX5Iroquois homeobox protein 5−0.531.000001
    226246_atKCTD1Potassium channel tetramerisation domain containing 1−0.384.000665
    226245_atKCTD1Potassium channel tetramerisation domain containing 1−0.395.000453
    228683_s_atKCTD15Potassium channel tetramerisation domain containing 15−0.397.000426
    230249_atKHDRBS3KH domain containing, RNA binding, signal transduction associated 3−0.4898.4E-06
    209781_s_atKHDRBS3KH domain containing, RNA binding, signal transduction associated 3−0.5281.1E-06
    1556425_a_atKIAA0802KIAA0802−0.4162.04E-04
    239033_atKIAA1958KIAA1958−0.405.000315
    235112_atKIAA1958KIAA1958−0.4321.09E-04
    213623_atKIF3AKinesin family member 3A−0.390.000546
    236565_s_atLARP6La ribonucleoprotein domain family, member 6−0.384.000683
    207348_s_atLIG3Ligase III, DNA, ATP-dependent−0.4261.36E-04
    204123_atLIG3Ligase III, DNA, ATP-dependent−0.4831.12E-05
    240027_atLIN7ALin-7 homolog A (C. elegans)−0.4341.01E-04
    206440_atLIN7ALin-7 homolog A (C. elegans)−0.4888.9E-06
    241652_x_atLIN7ALin-7 homolog A (C. elegans)−0.5112.8E-06
    233336_atLOC142893Hypothetical protein LOC142893−0.4112.52E-04
    230648_atLOC283663Hypothetical protein LOC283663−0.395.000461
    241370_atLOC286052Hypothetical protein LOC286052−0.375.000916
    227547_atLOC388795Similar to CG40449-PA.3−0.4514.98E-05
    232113_atLOC399959Hypothetical gene supported by BX647608−0.404.000331
    240423_atLOC441204Hypothetical locus LOC441204−0.4446.75E-05
    229429_x_atLOC728855Hypothetical protein LOC728855−0.373.000985
    202728_s_atLTBP1Latent transforming growth factor beta binding protein 1−0.4975.8E-06
    202729_s_atLTBP1Latent transforming growth factor beta binding protein 1−0.518.000002
    228150_atLZTR2Leucine zipper transcription regulator 2−0.399.000388
    241607_atLZTR2Leucine zipper transcription regulator 2−0.4301.16E-04
    1564423_a_atLZTR2Leucine zipper transcription regulator 2−0.4505.09E-05
    242172_atMEIS1Meis homeobox 1−0.4311.12E-04
    1559477_s_atMEIS1Meis homeobox 1−0.4427.12E-05
    204069_atMEIS1Meis homeobox 1−0.4623.01E-05
    238347_atMGC15523Hypothetical protein MGC15523−0.376.000902
    242942_atMGC15523Hypothetical protein MGC15523−0.390.000551
    210254_atMS4A3Membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)−0.4751.66E-05
    1554892_a_atMS4A3Membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)−0.4761.58E-05
    202247_s_atMTA1Metastasis associated 1−0.379.000803
    204798_atMYBv-myb myeloblastosis viral oncogene homolog (avian)−0.4349.98E-05
    209550_atNDNNecdin homolog (mouse)−0.391.000532
    1552736_a_atNETO1Neuropilin (NRP) and tolloid (TLL)-like 1−0.4162.03E-04
    209706_atNKX3-1NK3 transcription factor related, locus 1 (Drosophila)−0.477.000015
    232478_atNR6A1Nuclear receptor subfamily 6, group A, member 1−0.5024.4E-06
    220110_s_atNXF3Nuclear RNA export factor 3−0.5044.1E-06
    227492_atOCLNOccluding−0.407.000287
    209925_atOCLNOccluding−0.4554.05E-05
    223464_atOSBPL5Oxysterol binding protein-like 5−0.4495.38E-05
    204082_atPBX3Pre-B-cell leukemia homeobox 3−0.391.000526
    209361_s_atPCBP4Poly(rC) binding protein 4−0.392.000515
    219737_s_atPCDH9Protocadherin 9−0.375.000907
    222860_s_atPDGFDPlatelet derived growth factor D−0.4271.35E-04
    219304_s_atPDGFDPlatelet derived growth factor D−0.490.000008
    225829_atPDZD8PDZ domain containing 8−0.382.000709
    225830_atPDZD8PDZ domain containing 8−0.402.000347
    209438_atPHKA2Phosphorylase kinase, alpha 2 (liver)−0.4632.94E-05
    1559705_s_atPHKA2Phosphorylase kinase, alpha 2 (liver)−0.4898.5E-06
    209439_s_atPHKA2Phosphorylase kinase, alpha 2 (liver)−0.5211.6E-06
    225903_atPIGUPhosphatidylinositol glycan anchor biosynthesis, class U−0.389.000568
    215807_s_atPLXNB1Plexin B1−0.4281.28E-04
    228383_atPNPLA7Patatin-like phospholipase domain containing 7−0.4771.49E-05
    222238_s_atPOLMPolymerase (DNA directed), mu−0.395.000448
    204117_atPREPProlyl endopeptidase−0.4261.37E-04
    37950_atPREPProlyl endopeptidase−0.4642.74E-05
    220798_x_atPRG2Plasticity-related gene 2−0.633< 1e-07
    209158_s_atPSCD2Pleckstrin homology, Sec7 and coiled-coil domains 2 (cytohesin-2)−0.4142.24E-04
    211373_s_atPSEN2Presenilin 2 (Alzheimer disease 4)−0.4781.43E-05
    213933_atPTGER3Prostaglandin E receptor 3 (subtype EP3)−0.4301.19E-04
    1569830_atPTPRCProtein tyrosine phosphatase, receptor type, C−0.391.000523
    1558290_a_atPVT1Pvt1 oncogene homolog, MYC activator (mouse)−0.4331.03E-04
    212013_atPXDNPeroxidasin homolog (Drosophila)−0.394.000471
    201481_s_atPYGBPhosphorylase, glycogen; brain−0.4495.30E-05
    222810_s_atRASAL2RAS protein activator like 2−0.581< 1e-07
    244526_atRASGRP3RAS guanyl releasing protein 3 (calcium and DAG-regulated)−0.4231.59E-04
    205801_s_atRASGRP3RAS guanyl releasing protein 3 (calcium and DAG-regulated)−0.4544.22E-05
    208031_s_atRFX2Regulatory factor X, 2 (influences HLA class II expression)−0.4495.35E-05
    226872_atRFX2Regulatory factor X, 2 (influences HLA class II expression)−0.4583.53E-05
    91816_f_atRKHD1Ring finger and KH domain containing 1−0.384.000676
    206851_atRNASE3Ribonuclease, RNase A family, 3 (eosinophil cationic protein)−0.375.00093
    1556590_s_atSAPS3SAPS domain family, member 3−0.4181.93E-04
    1556589_atSAPS3SAPS domain family, member 3−0.4261.38E-04
    228497_atSLC22A15Solute carrier family 22 (organic cation transporter), member 15−0.4514.85E-05
    1563453_atSLC24A3Solute carrier family 24 (sodium/potassium/calcium exchanger), member 3−0.4811.22E-05
    57588_atSLC24A3Solute carrier family 24 (sodium/potassium/calcium exchanger), member 3−0.5523E-07
    234199_atSLC24A3Solute carrier family 24 (sodium/potassium/calcium exchanger), member 3−0.5622E-07
    219090_atSLC24A3Solute carrier family 24 (sodium/potassium/calcium exchanger), member 3−0.5681E-07
    233773_atSLC24A3Solute carrier family 24 (sodium/potassium/calcium exchanger), member 3−0.5721E-07
    219932_atSLC27A6Solute carrier family 27 (fatty acid transporter), member 6−0.376.0009
    244018_atSLC2A9Solute carrier family 2 (facilitated glucose transporter), member 9−0.4721.89E-05
    1556551_s_atSLC39A6Solute carrier family 39 (zinc transporter), member 6−0.389.00057
    1555460_a_atSLC39A6Solute carrier family 39 (zinc transporter), member 6−0.405.000318
    202089_s_atSLC39A6Solute carrier family 39 (zinc transporter), member 6−0.4122.40E-04
    237833_s_atSNCAIPSynuclein, alpha interacting protein (synphilin)−0.4162.04E-04
    219511_s_atSNCAIPSynuclein, alpha interacting protein (synphilin)−0.4291.25E-04
    243486_atSND1Staphylococcal nuclease and tudor domain containing 1−0.380.000786
    242736_atSORBS1Sorbin and SH3 domain containing 1−0.394.000475
    213668_s_atSOX4SRY (sex determining region Y)-box 4−0.385.000653
    201418_s_atSOX4SRY (sex determining region Y)-box 4−0.4092.67E-04
    242086_atSPATA6Spermatogenesis associated 6−0.396.00044
    1563595_atSRGAP3SLIT-ROBO Rho GTPase activating protein 3−0.4122.43E-04
    215550_atSRGAP3SLIT-ROBO Rho GTPase activating protein 3−0.4291.21E-04
    209794_atSRGAP3SLIT-ROBO Rho GTPase activating protein 3−0.4672.42E-05
    204548_atSTARSteroidogenic acute regulator−0.4946.6E-06
    208425_s_atTANC2Tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2−0.4593.52E-05
    224952_atTANC2Tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2−0.4593.48E-05
    205513_atTCN1Transcobalamin I (vitamin B12 binding protein, R binder family)−0.4672.39E-05
    209215_atTETRANTetracycline transporter-like protein−0.4879.6E-06
    226050_atTMCO3Transmembrane and coiled-coil domains 3−0.395.00046
    224916_atTMEM173Transmembrane protein 173−0.376.000895
    241342_atTMEM65Transmembrane protein 65−0.403.000334
    238045_atTMEM65Transmembrane protein 65−0.4652.62E-05
    225802_atTOP1MTTopoisomerase (DNA) I, mitochondrial−0.4241.49E-04
    224836_atTP53INP2Tumor protein p53 inducible nuclear protein 2−0.4801.31E-05
    210882_s_atTROTrophinin−0.389.000558
    235737_atTSLPThymic stromal lymphopoietin−0.401.00037
    230625_s_atTSPAN12Tetraspanin 12−0.4142.19E-04
    230626_atTSPAN12Tetraspanin 12−0.4221.60E-04
    244248_atTTC27Tetratricopeptide repeat domain 27−0.4573.79E-05
    218710_atTTC27Tetratricopeptide repeat domain 27−0.4975.8E-06
    235749_atUGCGL2UDP-glucose ceramide glucosyltransferase-like 2−0.510.000003
    1558466_atUGCGL2UDP-glucose ceramide glucosyltransferase-like 2−0.5251.3E-06
    1555561_a_atUGCGL2UDP-glucose ceramide glucosyltransferase-like 2−0.5651E-07
    1558467_a_atUGCGL2UDP-glucose ceramide glucosyltransferase-like 2−0.5721E-07
    218801_atUGCGL2UDP-glucose ceramide glucosyltransferase-like 2−0.586< 1e-07
    224048_atUSP44Ubiquitin specific peptidase 44−0.4995.2E-06
    201557_atVAMP2Vesicle-associated membrane protein 2 (synaptobrevin 2)−0.373.000995
    219330_atVANGL1Vang-like 1 (van gogh, Drosophila)−0.378.000838
    229997_atVANGL1Vang-like 1 (van gogh, Drosophila)−0.382.000727
    208626_s_atVAT1Vesicle amine transport protein 1 homolog (T. californica)−0.5416E-07
    239429_atZNF323Zinc finger protein 323−0.4261.41E-04
    240449_atZNF341Zinc finger protein 341−0.387.000599
    1561002_atZNF521Zinc finger protein 521−0.4398.01E-05
    230106_atZXDCZXD family zinc finger C−0.373.000982
    218639_s_atZXDCZXD family zinc finger C−0.380.000768
    228919_at−0.372.000997
    240865_at−0.374.000944
    230135_at−0.378.000821
    232833_at−0.381.000758
    235681_at−0.386.000638
    235456_at−0.389.000563
    243806_at−0.390.000538
    228740_at−0.391.000532
    243742_at−0.393.00048
    1557443_s_at−0.394.000473
    239488_at−0.399.000385
    1556580_a_at−0.404.000331
    240566_at−0.409.000267
    243082_at−0.4162.09E-04
    1555967_at−0.4221.61E-04
    228349_at−0.4251.44E-04
    1554599_x_at−0.4261.38E-04
    236104_at−0.4378.91E-05
    1554597_at−0.4388.37E-05
    231233_at−0.4495.36E-05
    220898_at−0.4603.33E-05
    1559117_at−0.4613.09E-05
    227929_at−0.479.000014
    1555968_a_at−0.5063.7E-06
    217521_at−0.5152.3E-06
    227036_at−0.591< 1e-07

Table A2.

GO Terms of Biological Processes Significantly Over-Represented in the Gene-Expression Signature Associated With MN1 Expression

GO IDGO TermMembers of the GO Term Present in the Gene Expression Signature (%)P
GO terms over-represented among the genes positively correlated with MN1 expression
    2504Antigen processing and presentation of peptide or polysaccharide antigen via MHC class II47.06< .001
    2478Antigen processing and presentation of exogenous peptide antigen42.86.002
    2495Antigen processing and presentation of peptide antigen via MHC class II42.86.002
    19,886Antigen processing and presentation of exogenous peptide antigen via MHC class II42.86.002
    7618Mating40.00.005
    19,884Antigen processing and presentation of exogenous antigen37.50.002
    19,882Antigen processing and presentation32.20< .001
    48,002Antigen processing and presentation of peptide antigen25.00< .001
    2474Antigen processing and presentation of peptide antigen via MHC class I20.00< .001
    6935Chemotaxis6.12.005
    42,330Taxis6.12.005
    6955Immune response5.22< .001
    7610Behavior5.14.002
    2376Immune system process4.08< .001
    42,221Response to chemical stimulus3.83.005
    50,896Response to stimulus3.48< .001
GO terms over-represented among the genes negatively correlated with MN1 expression
    35,272Exocrine system development33.33.005
    9953Dorsal/ventral pattern formation30.77< .001
    42,384Cilium biogenesis22.22.004
    42,742Defense response to bacterium17.95< .001
    48,736Appendage development16.00< .001
    35,108Limb morphogenesis16.00< .001
    35,107Appendage morphogenesis16.00< .001
    6334Nucleosome assembly15.38< .001
    9617Response to bacterium15.22.001
    31,497Chromatin assembly14.12< .001
    35,113Embryonic appendage morphogenesis13.64.003
    30,326Embryonic limb morphogenesis13.64.003
    6333Chromatin assembly or disassembly10.92< .001
    65,004Protein-DNA complex assembly10.57< .001
    3002Regionalization10.34.002
    7389Pattern specification process9.76.001
    51,707Response to other organism8.41< .001
    9607Response to biotic stimulus6.12.002
    6325Establishment and/or maintenance of chromatin architecture5.98< .001
    6323DNA packaging5.93< .001
    7001Chromosome organization and biogenesis (sensu Eukaryota)5.19< .001
    51,276Chromosome organization and biogenesis5.07< .001
    65,003Macromolecular complex assembly3.82.001
    6259DNA metabolic process3.64.004
    7275Multicellular organismal development2.93.003
    48,856Anatomical structure development2.83.005
    32,502Developmental process2.76< .001
    48,869Cellular developmental process2.63.005
    30,154Cell differentiation2.63.005

Abbreviation: GO, gene ontology.

Table A3.

Signature of 15 microRNA Probes Significantly Correlated With MN1 Expression Level, Grouped by Direction of Correlation

Target microRNAProbe SequenceCorrelation CoefficientP
Probes positively correlated with MN1 expression
    hsa-miR-126ACACTTCAAACTCGTACCGTGAGTAATAATGCGCCGTCCA0.405.002893
    hsa-miR-126ACACTTCAAACTCGTACCGTGAGTAATAATGCGCCGTCCA0.388.004862
    hsa-miR-126*CGCTGGCGACGGGACATTATTACTTTTGGTACGCGCTGTG0.541.000001
    hsa-miR-126*GCTGGCGACGGGACATTATTACTTTTGGTACGCGCTGTGA0.502.000005
    hsa-miR-126*GACGGGACATTATTACTTTTGGTACGCGCTGTGACACTTC0.482.000012
    hsa-miR-129-5pCCCTTCGCGAATCTTTTTGCGGTCTGGGCTTGCTGTACAT0.391.000517
    hsa-miR-130bCTGGGAAGCAGTGCAATGATGAAAGGGCATCGGTCAGGTC0.340.002874
    hsa-miR-424GAGGGGATACAGCAGCAATTCATGTTTTGAAGTGTTCTAA0.346.002367
Probes negatively correlated with MN1 expression
    hsa-miR-16GTTCCACTCTAGCAGCACGTAAATATTGGCGTAGTGAAAT−0.332.003575
    hsa-miR-16CAATGTCAGCAGTGCCTTAGCAGCACGTAAATATTGGCGT−0.339.002957
    hsa-miR-19aTGTAGTTGTGCAAATCTATGCAAAACTGATGGTGGCCTGC−0.342.004595
    hsa-miR-20aTAAAGTGCTTATAGTGCAGGTAGTGTTTAGTTATCTACTG−0.324.004543
    hsa-miR-100TGAGGCCTGTTGCCACAAACCCGTAGATCCGAACTTGTGG−0.411.000250
    hsa-miR-100CCTGTTGCCACAAACCCGTAGATCCGAACTTGTGGTATTA−0.486.000040
    hsa-miR-196aAGCTGATCTGTGGCTTAGGTAGTTTCATGTTGTTGGGATT−0.335.004960

Footnotes

Supported in part by Grants No. CA101140, CA114725, CA31946, CA33601, CA16058, CA77658, CA35279, CA03927, and CA41287 from the National Cancer Institute, Bethesda, MD, and The Coleman Leukemia Research Foundation.

Authors' disclosures of potential conflicts of interest and author contributions are found at the end of this article.

AUTHORS' DISCLOSURES OF POTENTIAL CONFLICTS OF INTEREST

The author(s) indicated no potential conflicts of interest.

AUTHOR CONTRIBUTIONS

Conception and design: Guido Marcucci, Michael D. Radmacher, Clara D. Bloomfield

Financial support: Michael A. Caligiuri, Clara D. Bloomfield

Administrative support: Guido Marcucci, Michael A. Caligiuri, Clara D. Bloomfield

Provision of study materials or patients: Guido Marcucci, Ravi Vij, Bayard L. Powell, Jonathan E. Kolitz, Michael A. Caligiuri, Richard A. Larson, Clara D. Bloomfield

Collection and assembly of data: Guido Marcucci, Peter Paschka, Susan P. Whitman, Claudia D. Baldus, Andrew J. Carroll

Data analysis and interpretation: Christian Langer, Guido Marcucci, Kelsi B. Holland, Michael D. Radmacher, Kati Maharry, Peter Paschka, Susan P. Whitman, Krzysztof Mrózek, Claudia D. Baldus, Andrew J. Carroll, Clara D. Bloomfield

Manuscript writing: Christian Langer, Guido Marcucci, Kelsi B. Holland, Michael D. Radmacher, Kati Maharry, Peter Paschka, Susan P. Whitman, Krzysztof Mrózek, Clara D. Bloomfield

Final approval of manuscript: Christian Langer, Guido Marcucci, Kelsi B. Holland, Michael D. Radmacher, Kati Maharry, Peter Paschka, Susan P. Whitman, Krzysztof Mrózek, Claudia D. Baldus, Ravi Vij, Bayard L. Powell, Andrew J. Carroll, Jonathan E. Kolitz, Michael A. Caligiuri, Richard A. Larson, Clara D. Bloomfield

REFERENCES

1. Byrd JC, Mrózek K, Dodge RK, et al. Pretreatment cytogenetic abnormalities are predictive of induction success, cumulative incidence of relapse, and overall survival in adult patients with de novo acute myeloid leukemia: Results from Cancer and Leukemia Group B (CALGB 8461) Blood. 2002;100:4325–4336. [PubMed]
2. Grimwade D, Walker H, Oliver F, et al. The importance of diagnostic cytogenetics on outcome in AML: Analysis of 1,612 patients entered into the MRC AML 10 trial. Blood. 1998;92:2322–2333. [PubMed]
3. Slovak ML, Kopecky KJ, Cassileth PA, et al. Karyotypic analysis predicts outcome of preremission and postremission therapy in adult acute myeloid leukemia: A Southwest Oncology Group/Eastern Cooperative Oncology Group study. Blood. 2000;96:4075–4083. [PubMed]
4. Mrózek K, Heerema NA, Bloomfield CD. Cytogenetics in acute leukemia. Blood Rev. 2004;18:115–136. [PubMed]
5. Mrózek K, Marcucci G, Paschka P, et al. Clinical relevance of mutations and gene-expression changes in adult acute myeloid leukemia with normal cytogenetics: Are we ready for a prognostically prioritized molecular classification? Blood. 2007;109:431–448. [PubMed]
6. van Wely KHM, Molijn AC, Buijs A, et al. The MN1 oncoprotein synergizes with coactivators RAC3 and p300 in RAR-RXR-mediated transcription. Oncogene. 2003;22:699–709. [PubMed]
7. Sutton ALM, Zhang X, Ellison TI, et al. The 1,25(OH)2D3-regulated transcription factor MN1 stimulates vitamin D receptor-mediated transcription and inhibits osteoblastic cell proliferation. Mol Endocrinol. 2005;19:2234–2244. [PubMed]
8. Lekanne Deprez RH, Riegman PHJ, Groen NA, et al. Cloning and characterization of MN1, a gene from chromosome 22q11, which is disrupted by a balanced translocation in a meningioma. Oncogene. 1995;10:1521–1528. [PubMed]
9. Buijs A, Sherr S, van Baal S, et al. Translocation (12;22)(p13;q11) in myeloproliferative disorders results in fusion of the ETS-like TEL gene on 12p13 to the MN1 gene on 22q1. Oncogene. 1995;10:1511–1519. [PubMed]
10. Valk PJM, Verhaak RGW, Beijen MA, et al. Prognostically useful gene-expression profiles in acute myeloid leukemia. N Engl J Med. 2004;350:1617–1628. [PubMed]
11. Carella C, Bonten J, Sirma S, et al. MN1 overexpression is an important step in the development of inv16 AML. Leukemia. 2007;21:1679–1690. [PubMed]
12. Carella C, Bonten J, Rehg J, et al. MN1-TEL, the product of the t(12;22) in human myeloid leukemia, immortalizes murine myeloid cells and causes myeloid malignancy in mice. Leukemia. 2006;20:1582–1592. [PubMed]
13. Heuser M, Argiropoulos B, Kuchenbauer F, et al. MN1 overexpression induces acute myeloid leukemia in mice and predicts ATRA resistance in patients with AML. Blood. 2007;110:1639–1647. [PubMed]
14. Heuser M, Beutel G, Krauter J, et al. High meningioma 1 (MN1) expression as a predictor for poor outcome in acute myeloid leukemia with normal cytogenetics. Blood. 2006;108:3898–3905. [PubMed]
15. Kolitz JE, George SL, Dodge RK, et al. Dose escalation studies of cytarabine, daunorubicin, and etoposide with and without multidrug resistance modulation with PSC-833 in untreated adults with acute myeloid leukemia younger than 60 years: Final induction results of Cancer and Leukemia Group B study 9621. J Clin Oncol. 2004;22:4290–4301. [PubMed]
16. Kolitz JE, George SL, Marcucci G, et al. A randomized comparison of induction therapy for untreated acute myeloid leukemia (AML) in patients < 60 years using P-glycoprotein (Pgp) modulation with Valspodar (PSC833): Preliminary results of Cancer and Leukemia Group B study 19808. Blood. 2005;106(abstr 407):122a–123a.
17. Mrózek K, Carroll AJ, Maharry K, et al. Central review of cytogenetics is necessary for cooperative group correlative and clinical studies of adult acute leukemia: The Cancer and Leukemia Group B experience. Int J Oncol. 2008;33:239–244. [PubMed]
18. Whitman SP, Archer KJ, Feng L, et al. Absence of the wild-type allele predicts poor prognosis in adult de novo acute myeloid leukemia with normal cytogenetics and the internal tandem duplication of FLT3: A Cancer and Leukemia Group B study. Cancer Res. 2001;61:7233–7239. [PubMed]
19. Thiede C, Steudel C, Mohr B, et al. Analysis of FLT3-activating mutations in 979 patients with acute myelogenous leukemia: Association with FAB subtypes and identification of subgroups with poor prognosis. Blood. 2002;99:4326–4335. [PubMed]
20. Yamamoto Y, Kiyoi H, Nakano Y, et al. Activating mutation of D835 within the activation loop of FLT3 in human hematologic malignancies. Blood. 2001;97:2434–2439. [PubMed]
21. Whitman SP, Ruppert AS, Radmacher MD, et al. FLT3 D835/I836 mutations are associated with poor disease-free survival and a distinct gene-expression signature among younger adults with de novo cytogenetically normal acute myeloid leukemia lacking FLT3 internal tandem duplications. Blood. 2008;111:1552–1559. [PubMed]
22. Döhner K, Schlenk RF, Habdank M, et al. Mutant nucleophosmin (NPM1) predicts favorable prognosis in younger adults with acute myeloid leukemia and normal cytogenetics: Interaction with other gene mutations. Blood. 2005;106:3740–3746. [PubMed]
23. Marcucci G, Maharry K, Radmacher MD, et al. Prognostic significance of, and gene and microRNA expression signatures associated with, CEBPA mutations in cytogenetically normal acute myeloid leukemia with high-risk molecular features: A Cancer and Leukemia Group B study. J Clin Oncol. 2008;26:5078–5087. [PMC free article] [PubMed]
24. Paschka P, Marcucci G, Ruppert AS, et al. Wilms' tumor 1 gene mutations independently predict poor outcome in adults with cytogenetically normal acute myeloid leukemia: A Cancer and Leukemia Group B study. J Clin Oncol. 2008;26:4595–4602. [PMC free article] [PubMed]
25. Caligiuri MA, Strout MP, Schichman SA, et al. Partial tandem duplication of ALL1 as a recurrent molecular defect in acute myeloid leukemia with trisomy 11. Cancer Res. 1996;56:1418–1425. [PubMed]
26. Whitman SP, Ruppert AS, Marcucci G, et al. Long-term disease-free survivors with cytogenetically normal acute myeloid leukemia and MLL partial tandem duplication: A Cancer and Leukemia Group B study. Blood. 2007;109:5164–5167. [PubMed]
27. Marcucci G, Baldus CD, Ruppert AS, et al. Overexpression of the ETS-related gene, ERG, predicts a worse outcome in acute myeloid leukemia with normal karyotype: A Cancer and Leukemia Group B study. J Clin Oncol. 2005;23:9234–9242. [PubMed]
28. Marcucci G, Maharry K, Whitman SP, et al. High expression levels of the ETS-related gene, ERG, predict adverse outcome and improve molecular risk-based classification of cytogenetically normal acute myeloid leukemia: A Cancer and Leukemia Group B study. J Clin Oncol. 2007;25:3337–3343. [PubMed]
29. Baldus CD, Tanner SM, Ruppert AS, et al. BAALC expression predicts clinical outcome of de novo acute myeloid leukemia patients with normal cytogenetics: A Cancer and Leukemia Group B study. Blood. 2003;102:1613–1618. [PubMed]
30. Langer C, Radmacher MD, Ruppert AS, et al. High BAALC expression associates with other molecular prognostic markers, poor outcome and a distinct gene-expression signature in cytogenetically normal patients younger than 60 years with acute myeloid leukemia: A Cancer and Leukemia Group B (CALGB) study. Blood. 2008;111:5371–5379. [PubMed]
31. Radmacher MD, Marcucci G, Ruppert AS, et al. Independent confirmation of a prognostic gene-expression signature in adult acute myeloid leukemia with a normal karyotype: A Cancer and Leukemia Group B study. Blood. 2006;108:1677–1683. [PubMed]
32. Calin GA, Ferracin M, Cimmino A, et al. A microRNA signature associated with prognosis and progression in chronic lymphocytic leukemia. N Engl J Med. 2005;353:1793–1801. [PubMed]
33. Marcucci G, Radmacher MD, Maharry K, et al. MicroRNA expression in cytogenetically normal acute myeloid leukemia. N Engl J Med. 2008;358:1919–1928. [PubMed]
34. Klein JP, Moeschberger ML. Survival Analysis: Techniques for Censored and Truncated Data. New York, NY: Springer-Verlag; 1997.
35. Irizarry RA, Bolstad BM, Collin F, et al. Summaries of Affymetrix GeneChip probe level data. Nucleic Acids Res. 2003;31:e15. [PMC free article] [PubMed]
36. Dahlquist KD, Salomonis N, Vranizan K, et al. GenMAPP, a new tool for viewing and analyzing microarray data on biological pathways. Nat Genet. 2002;31:19–20. [PubMed]
37. Verhaak RGW, Goudswaard CS, van Putten W, et al. Mutations in nucleophosmin (NPM1) in acute myeloid leukemia (AML): Association with other gene abnormalities and previously established gene expression signatures and their favorable prognostic significance. Blood. 2005;106:3747–3754. [PubMed]
38. Vyas JM, Van der Veen AG, Ploegh HL. The known unknowns of antigen processing and presentation. Nat Rev Immunol. 2008;8:607–618. [PMC free article] [PubMed]
39. Fish JE, Santoro MM, Morton SU, et al. miR-126 regulates angiogenic signaling and vascular integrity. Dev Cell. 2008;15:272–284. [PMC free article] [PubMed]
40. Wang S, Aurora AB, Johnson BA, et al. The endothelial-specific microRNA miR-126 governs vascular integrity and angiogenesis. Dev Cell. 2008;15:261–271. [PMC free article] [PubMed]
41. Rosa A, Ballarino M, Sorrentino A, et al. The interplay between the master transcription factor PU.1 and miR-424 regulates human monocyte/macrophage differentiation. Proc Natl Acad Sci U S A. 2007;104:19849–19854. [PubMed]
42. Cimmino A, Calin GA, Fabbri M, et al. miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A. 2005;102:13944–13949. [PubMed]
43. O'Donnell KA, Wentzel EA, Zeller KI, et al. C-Myc-regulated microRNAs modulate E2F1 expression. Nature. 2005;435:839–843. [PubMed]
44. Hayashita Y, Osada H, Tatematsu Y, et al. A polycistronic microRNA cluster, miR-17-92, is overexpressed in human lung cancers and enhances cell proliferation. Cancer Res. 2005;65:9628–9632. [PubMed]
45. Musiyenko A, Bitko V, Barik S. Ectopic expression of miR-126*, an intronic product of the vascular endothelial EGF-like 7 gene, regulates prostein translation and invasiveness of prostate cancer LNCaP cells. J Mol Med. 2008;86:313–322. [PubMed]

Articles from Journal of Clinical Oncology are provided here courtesy of American Society of Clinical Oncology