PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of aacPermissionsJournals.ASM.orgJournalAAC ArticleJournal InfoAuthorsReviewers
 
Antimicrob Agents Chemother. Aug 2009; 53(8): 3515–3519.
Published online Jun 15, 2009. doi:  10.1128/AAC.00012-09
PMCID: PMC2715596
Protein Kinase G Is Required for Intrinsic Antibiotic Resistance in Mycobacteria[down-pointing small open triangle]
Kerstin A. Wolff, Hoa T. Nguyen, Richard H. Cartabuke, Ajay Singh, Sam Ogwang, and Liem Nguyen*
Department of Molecular Biology and Microbiology, School of Medicine, Case Western Reserve University, Cleveland, Ohio 44106
*Corresponding author. Mailing address: Department of Molecular Biology and Microbiology, Case Western Reserve University, School of Medicine, Wood Building, 10900 Euclid Avenue, Cleveland, OH 44106-4960. Phone: (216) 368-3148. Fax: (216) 368-3055. E-mail: liem.nguyen/at/case.edu
These authors contributed equally to this research.
Received January 5, 2009; Revised March 5, 2009; Accepted June 6, 2009.
Abstract
Antibiotic resistance and virulence of pathogenic mycobacteria are phenotypically associated, but the underlying genetic linkage has not been known. Here we show that PknG, a eukaryotic-type protein kinase previously found to support survival of mycobacteria in host cells, is required for the intrinsic resistance of mycobacterial species to multiple antibiotics.
Although intrinsic antibiotic resistance and host persistence have been viewed as two isolated characteristics of mycobacterial species, in vitro and in vivo observations have demonstrated phenotypic correlations between these two phenomena (10, 14, 21). Mycobacterium tuberculosis surviving in a persistent state during latent infection usually displays a reduced antibiotic susceptibility compared to that of the bacterium during active growth (12, 27-29). Conversely, exposure to antibiotics may also induce a transformation of M. tuberculosis from an active growth to a persistent state (11).
As an intracellular pathogen, the key factor deciding the successful persistence of M. tuberculosis in the host is its ability to survive within infected cells (15). Beside several host factors, mycobacterial lipids, and the RD1 specialized secretion system (4, 23, 25), mycobacterial protein phosphatases and kinases are also emerging as key players in this process (1, 25, 26). The eukaryotic-type protein kinase G (PknG) is involved in mycobacterial survival within macrophages, presumably by blocking lysosomal delivery (26). It has been generally thought that factors required for pathogenicity such as PknG are not encoded in nonpathogenic mycobacteria, for example, Mycobacterium smegmatis (8, 26). However, recent studies showed that pknG is ubiquitously present in the Mycobacterium genus (7, 17). The M. tuberculosis PknG (PknGMtb) and M. smegmatis PknG (PknGMsm) share almost 80% identity and appear at syntenic loci of the genomes (7) (Fig. (Fig.1A).1A). These observations suggested that PknG might provide physiological functions to both nonpathogenic and pathogenic mycobacteria besides its role in pathogenicity of the latter species.
FIG. 1.
FIG. 1.
Identification of MAR4, a pknGMsm transposon mutant. (A) Synteny of the pknG loci in M. smegmatis and M. tuberculosis genomes and the Himar1 transposon insertion in MAR4. Homologous genes are uniformly illustrated. The nucleotide sequence at the pknG (more ...)
Another feature that makes eradication of M. tuberculosis difficult is its profound intrinsic antibiotic resistance (14). In addition to a repertoire of dedicated antibiotic resistance mechanisms, the thick and hydrophobic cell envelope constitutes an effective barrier decelerating the influx of antibiotics (13, 14). In a screen to identify genome-wide drug resistance determinants of mycobacteria, a library of more than 5,000 transposon mutants derived from wild-type M. smegmatis mc2155 (22) was generated by Himar1-mediated mutagenesis (13). The library was subjected to an exhaustive screen to identify mutants sensitive to single or multiple antibiotics. One of the identified mutants, MAR4, displayed increased sensitivity to many clinically important antibiotics of diverse chemical structures and mechanisms of action. These include antibiotics targeting cell wall synthesis (imipenem, vancomycin, and ethambutol), protein synthesis (erythromycin), folate synthesis (sulfachloropyridazine), and transcription (rifampin [rifampicin]) (Table (Table1).1). Notably, rifampin and ethambutol are front-line tuberculosis drugs. MICs for five representative antibiotics quantified by using the Etest assay (AB Biodisk, Sweden) as previously described (13) indicated that MAR4 was 8-, 12-, 15-, 4-, and >8-fold more susceptible than the wild-type strain to erythromycin, vancomycin, imipenem, ethambutol, and rifampin, respectively (Table (Table11).
TABLE 1.
TABLE 1.
Susceptibility of M. smegmatis strains to antibiotics
Arbitrary PCR was done as previously described (13, 18) to map the transposon insertion in MAR4 to msmeg_0786, the gene encoding PknGMsm (Fig. (Fig.1A).1A). The pknGMsm disruption in MAR4 was confirmed by PCR using primers flanking the gene, MS-PknG1 (GAATTCCATATGACTTCACCCGAGAACC) and MS-PknG2 (AAGCTTCCATGAAAGCACGGTCGACGTG) (Fig. (Fig.1A).1A). The PCR product generated from MAR4 template was larger than that of the wild type, consistent with Himar1 transposon insertion (Fig. (Fig.1B).1B). Sequencing of the PCR product identified the insertion site at the dinucleotide TA1015-1016, which introduced a stop codon after the triplet encoding the Ile338 residue and created a gene truncation (Fig. (Fig.1A,1A, bottom). To confirm loss of the pknG gene product in MAR4, Western blot assays were done using a polyclonal antibody raised against the M. tuberculosis PknG (26). The antibody recognized a protein band of ~78 kDa corresponding to the molecular mass of PknG in cell extract of wild-type M. smegmatis which was undetectable in the extract of MAR4 (Fig. (Fig.1C1C).
To confirm that the multidrug-sensitive phenotype of MAR4 was due to pknG deletion but not secondary mutations or polar effects on downstream genes, a targeted pknG mutant (the ΔpknGMsm strain) was constructed by the recombineering method with modifications (24). Plasmid pVN701B was first constructed by cloning the SpeI-XbaI fragment encoding the mycobacteriophage Che9c recombination proteins gp60 and gp61 from pJV53 (24) into the XbaI site of pPR27 (19) (Fig. (Fig.2A).2A). pVN701B was thus replicated from a temperature-sensitive origin of replication [Ori(Ts)] and expressed the counterselectable marker gene sacB, which is toxic for mycobacteria in the presence of sucrose (19, 20). These genetic elements facilitated homologous recombination and removal of pVN701B after gene deletion was completed. The pknGMsm deletion cassette (Fig. (Fig.2B)2B) was constructed by cloning the chromosomal DNA sequences flanking pknGMsm into two sides of the hygromycin-resistant gene in pYUB854 (2): primers PknGDel1 (ACTAGTACCAGGTGGACATCGTCGTCAAGA) and PknGDel2 (AAGCTTGATCAGGGTTCTCGGGTGAAGTCA) were used to PCR amplify the 5′-flanking region, and primers PknGDel3 (TCTAGACTGGTCGACCTGGCCAACAGC) and PknGDel4 (GGTACCCAATGGGAATTGACGGGTCGATCC) were used for the 3′-flanking region. The linear pknGMsm deletion cassette fragment was removed from pYUB854 by SpeI/KpnI digestion and transformed into M. smegmatis cells that had been induced to express the recombineering system from pVN701B (Fig. (Fig.2A)2A) (24). The hygromycin-resistant transformants were screened by PCR for the correct gene deletion by using primers annealing to chromosomal regions outside the homologous sequences (Fig. (Fig.2B).2B). Primers P1 (ATCGGCAGCAACCTGTTCTCGTTC) and P2 (CTGCACGACTTCGAGGTGTTCGA) recovered the 5′-pknGhyg junction (PCR A, Fig. Fig.2C);2C); primers P3 (GCGATTCAGCCTGGTATGATCAGC) and P4 (CCGTCTTCTACAGTCGTCGTAGG) recovered the Ωhyg-3′-pknG (PCR B). All eight random hygromycin-resistant transformants showed correct homologous recombination (Fig. (Fig.2C).2C). Besides being resistant to both hygromycin (75 mg/liter) and kanamycin (50 mg/liter), these ΔpknGMsm transformants showed reduced growth on a medium supplemented with sucrose (1%, wt/vol) (Fig. (Fig.2D,2D, left panel), indicating the presence of pVN701B. To remove pVN701B, cultures were shifted to 39°C on medium supplemented with only hygromycin. All of the recovered ΔpknGMsm clones became kanamycin sensitive and sucrose resistant, indicating the successful removal of the plasmid (Fig. (Fig.2D,2D, right panel). Two complementation plasmids expressing pknGMsm (pVN579) or pknGMtb (pVN578) from the heat shock promoter were constructed as previously described (26) and used to transform into the ΔpknGMsm strain. Transformants were selected on 7H10 medium containing kanamycin (50 mg/liter).
FIG. 2.
FIG. 2.
Construction and complementation of the ΔpknGMsm strain. (A) Construction of pVN701B. (B) The pknGMsm deletion cassette and pknG locus in wild-type M. smegmatis mc2155 and its derived ΔpknGMsm strain. (C) PCR confirmation of pknG deletion (more ...)
Reverse transcription-PCR and Western blotting were used to analyze the transcription and translation of pknG, respectively. RNA samples were isolated from M. smegmatis strains using the RNeasy minikit (Qiagen) and reverse transcribed by a standard method (7). The pknG cDNA was amplified using primers RTpknG1 (GCCACCGACATCTACACCGT) and RTpknG2 (GGTGTGCGCCACCAGCAG), which recognized both M. smegmatis and M. tuberculosis pknG sequences. Both reverse transcription-PCR and Western blotting (described above) readily detected transcription and translation of PknG in the wild-type M. smegmatis strain but not in the ΔpknGMsm strain (Fig. 2E and F). Transformation of pVN578 or pVN579 restored both transcription and translation of PknG in the ΔpknGMsm strain (Fig. 2E and F). Compared to M. bovis BCG (lane 1, Fig. Fig.2F),2F), a dramatic reduction of PknG signals was observed in wild-type M. smegmatis (lane 2, Fig. Fig.2F).2F). The reduced signal intensities likely reflected lower PknG production in M. smegmatis rather than a preferred specificity of the antibody for Mycobacterium bovis PknG (100% identical to PknGMtb) because in trans expression of PknGMsm or PknGMtb from the same vector yielded comparable signals on Western blots (lanes 4 and 5, Fig. Fig.2F).2F). Interestingly, a recent study suggested that the differential expression of PknG may relate to its new function as a virulence factor in pathogenic mycobacteria (7). Antibiotic susceptibility was tested using the Etest assay as described above. Similarly to MAR4, the ΔpknGMsm mutant became more sensitive to multiple antibiotics with diverse chemical structures and mechanisms of action (Table (Table1).1). In trans expression of pknGMsm or pknGMtb completely restored the multiple antibiotic resistance of the ΔpknGMsm strain to wild-type levels (Table (Table1).1). Similar results were also obtained for wild-type M. tuberculosis, M. bovis BCG, their derived ΔpknG mutants (26), and the complemented strains expressing pknGMtb from pVN578 (examples in Fig. Fig.3),3), demonstrating that PknG provides a drug resistance function not only to the nonpathogenic M. smegmatis but also to pathogenic mycobacteria such as M. tuberculosis.
FIG. 3.
FIG. 3.
Antibiotic susceptibilities of M. tuberculosis strains. (A) Growing cultures (10 μl; optical density at 600 nm, 1.0) of wild-type M. tuberculosis H37Rv, its derived ΔpknGMtb mutant, and the complemented ΔpknGMtb/pknGMtb (pVN578) (more ...)
Furthermore, to assess whether the function of PknG in intrinsic antibiotic resistance is provided through its kinase activity, plasmid pPknGK181M, previously shown to create a dominant-negative effect by overexpressing a kinase-inactive form of PknG (26) (kindly provided by Jean Pieters, University of Basel), was introduced into wild-type M. smegmatis and the ΔpknGMsm strain. Whereas overexpression of this dominant-negative PknGK181M form did not alter the antibiotic susceptibility of the ΔpknGMsm strain, it resulted in an increased antibiotic susceptibility in the wild-type M. smegmatis strain, similar to the effect caused by pknG deletion (Table (Table11).
The nonspecific sensitivity of the pknG mutants to antibiotics with diverse chemical structures and mechanisms of action suggested two possibilities: (i) PknG controls activities of dedicated multiple antibiotic resistance systems such as efflux pumps or (ii) PknG controls essential cellular functions (for example, metabolism or cell envelope structure) whose disruption resulted in pleiotropic defects leading to the reduced drug resistance. Properties of the mycobacterial cell surface were characterized using previously described methods (3, 6). Compared to wild-type M. smegmatis, the cell wall of the ΔpknGMsm strain displayed a significantly reduced hydrophobicity (Table (Table2),2), which correlates with a reduced association of Congo red, a lipid-bound hydrophobic dye that has been used as an indicator of phenotypic drug susceptibility (3). Reduced cell wall hydrophobicity has previously been reported to be important for multiple antibiotic resistance in mycobacteria (9, 13). Recent findings that PknG is involved in metabolic pathways such as the tricarboxylic acid cycle and glutamine utilization in Corynebacterium and Mycobacterium species (5, 16, 17) also favor the latter hypothesis. The fact that increased expression of PknG in the ΔpknGMsm strain (lanes 4 and 5 in Fig. Fig.2F)2F) did not lead to a reduced drug susceptibility compared to wild-type M. smegmatis (Table (Table1)1) further suggested that PknG does not directly control dedicated antibiotic resistance systems.
TABLE 2.
TABLE 2.
Surface properties of M. smegmatis strains
In summary, we present comprehensive evidence supporting a role of PknG in the natural resistance of mycobacteria to multiple antibiotics. Both transposon-mediated and targeted disruption of pknG resulted in increased multiple antibiotic susceptibility. Together with previous reports (5, 26), our data suggest that signaling circuitries surrounding PknG might serve as a phenogenetic network that controls host persistence and intrinsic antibiotic resistance in mycobacteria (26). Pharmaceutical inactivation of PknG may thus not only inhibit the survival of pathogenic mycobacteria in macrophages (26) but also render the bacilli susceptible to a variety of readily available, clinically approved antibiotics. Further studies will need to address the underlying mechanisms that mediate PknG function in intrinsic antibiotic resistance of pathogenic mycobacteria.
Acknowledgments
We thank Jean Pieters and Graham F. Hatfull for providing materials and Abram Stavitsky and Kien Nguyen for critical reading of the manuscript.
Support was provided by start-up funds from the School of Medicine, a STERIS Infectious Diseases Research Grant, and a CFAR Developmental Award from the Case Center for AIDS Research to L.N. S.O. is a recipient of a Fogarty AIDS International Training and Research Program (AITRP) Fellowship.
Footnotes
[down-pointing small open triangle]Published ahead of print on 15 June 2009.
1. Bach, H., K. G. Papavinasasundaram, D. Wong, Z. Hmama, and Y. Av-Gay. 2008. Mycobacterium tuberculosis virulence is mediated by PtpA dephosphorylation of human vacuolar protein sorting 33B. Cell Host Microbe 3:316-322. [PubMed]
2. Bardarov, S., S. Bardarov, Jr., M. S. Pavelka, Jr., V. Sambandamurthy, M. Larsen, J. Tufariello, J. Chan, G. Hatfull, and W. R. Jacobs, Jr. 2002. Specialized transduction: an efficient method for generating marked and unmarked targeted gene disruptions in Mycobacterium tuberculosis, M. bovis BCG and M. smegmatis. Microbiology 148:3007-3017. [PubMed]
3. Cangelosi, G. A., C. O. Palermo, J. P. Laurent, A. M. Hamlin, and W. H. Brabant. 1999. Colony morphotypes on Congo red agar segregate along species and drug susceptibility lines in the Mycobacterium avium-intracellulare complex. Microbiology 145:1317-1324. [PubMed]
4. Chua, J., I. Vergne, S. Master, and V. Deretic. 2004. A tale of two lipids: Mycobacterium tuberculosis phagosome maturation arrest. Curr. Opin. Microbiol. 7:71-77. [PubMed]
5. Cowley, S., M. Ko, N. Pick, R. Chow, K. J. Downing, B. G. Gordhan, J. C. Betts, V. Mizrahi, D. A. Smith, R. W. Stokes, and Y. Av-Gay. 2004. The Mycobacterium tuberculosis protein serine/threonine kinase PknG is linked to cellular glutamate/glutamine levels and is important for growth in vivo. Mol. Microbiol. 52:1691-1702. [PubMed]
6. Etienne, G., C. Villeneuve, H. Billman-Jacobe, C. Astarie-Dequeker, M. A. Dupont, and M. Daffe. 2002. The impact of the absence of glycopeptidolipids on the ultrastructure, cell surface and cell wall properties, and phagocytosis of Mycobacterium smegmatis. Microbiology 148:3089-3100. [PubMed]
7. Houben, E. N., A. Walburger, G. Ferrari, L. Nguyen, C. J. Thompson, C. Miess, G. Vogel, B. Mueller, and J. Pieters. 2009. Differential expression of a virulence factor in pathogenic and non-pathogenic mycobacteria. Mol. Microbiol. 72:41-52. [PMC free article] [PubMed]
8. Koul, A., A. Choidas, A. K. Tyagi, K. Drlica, Y. Singh, and A. Ullrich. 2001. Serine/threonine protein kinases PknF and PknG of Mycobacterium tuberculosis: characterization and localization. Microbiology 147:2307-2314. [PubMed]
9. Liu, J., and H. Nikaido. 1999. A mutant of Mycobacterium smegmatis defective in the biosynthesis of mycolic acids accumulates meromycolates. Proc. Natl. Acad. Sci. USA 96:4011-4016. [PubMed]
10. McKinney, J. D. 2000. In vivo veritas: the search for TB drug targets goes live. Nat. Med. 6:1330-1333. [PubMed]
11. Michele, T. M., C. Ko, and W. R. Bishai. 1999. Exposure to antibiotics induces expression of the Mycobacterium tuberculosis sigF gene: implications for chemotherapy against mycobacterial persistors. Antimicrob. Agents Chemother. 43:218-225. [PMC free article] [PubMed]
12. Mitchison, D. A., A. Jindani, G. R. Davies, and F. Sirgel. 2007. Isoniazid activity is terminated by bacterial persistence. J. Infect. Dis. 195:1871-1872. [PubMed]
13. Nguyen, L., S. Chinnapapagari, and C. J. Thompson. 2005. FbpA-dependent biosynthesis of trehalose dimycolate is required for the intrinsic multidrug resistance, cell wall structure, and colonial morphology of Mycobacterium smegmatis. J. Bacteriol. 187:6603-6611. [PMC free article] [PubMed]
14. Nguyen, L., and J. Pieters. 2009. Mycobacterial subversion of chemotherapeutic reagents and host defense tactics: challenges in tuberculosis drug development. Annu. Rev. Pharmacol. Toxicol. 49:427-453. [PubMed]
15. Nguyen, L., and J. Pieters. 2005. The Trojan horse: survival tactics of pathogenic mycobacteria in macrophages. Trends Cell Biol. 15:269-276. [PubMed]
16. Niebisch, A., A. Kabus, C. Schultz, B. Weil, and M. Bott. 2006. Corynebacterial protein kinase G controls 2-oxoglutarate dehydrogenase activity via the phosphorylation status of the OdhI protein. J. Biol. Chem. 281:12300-12307. [PubMed]
17. O'Hare, H. M., R. Duran, C. Cervenansky, M. Bellinzoni, A. M. Wehenkel, O. Pritsch, G. Obal, J. Baumgartner, J. Vialaret, K. Johnsson, and P. M. Alzari. 2008. Regulation of glutamate metabolism by protein kinases in mycobacteria. Mol. Microbiol. 70:1408-1423. [PubMed]
18. O'Toole, G. A., L. A. Pratt, P. I. Watnick, D. K. Newman, V. B. Weaver, and R. Kolter. 1999. Genetic approaches to study of biofilms. Methods Enzymol. 310:91-109. [PubMed]
19. Pelicic, V., M. Jackson, J. M. Reyrat, W. R. Jacobs, Jr., B. Gicquel, and C. Guilhot. 1997. Efficient allelic exchange and transposon mutagenesis in Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. USA 94:10955-10960. [PubMed]
20. Pelicic, V., J. M. Reyrat, and B. Gicquel. 1996. Generation of unmarked directed mutations in mycobacteria, using sucrose counter-selectable suicide vectors. Mol. Microbiol. 20:919-925. [PubMed]
21. Sacchettini, J. C., E. J. Rubin, and J. S. Freundlich. 2008. Drugs versus bugs: in pursuit of the persistent predator Mycobacterium tuberculosis. Nat. Rev. Microbiol. 6:41-52. [PubMed]
22. Snapper, S. B., R. E. Melton, S. Mustafa, T. Kieser, and W. R. Jacobs, Jr. 1990. Isolation and characterization of efficient plasmid transformation mutants of Mycobacterium smegmatis. Mol. Microbiol. 4:1911-1919. [PubMed]
23. Tan, T., W. L. Lee, D. C. Alexander, S. Grinstein, and J. Liu. 2006. The ESAT-6/CFP-10 secretion system of Mycobacterium marinum modulates phagosome maturation. Cell. Microbiol. 8:1417-1429. [PubMed]
24. van Kessel, J. C., and G. F. Hatfull. 2007. Recombineering in Mycobacterium tuberculosis. Nat. Methods 4:147-152. [PubMed]
25. Vergne, I., J. Chua, H. H. Lee, M. Lucas, J. Belisle, and V. Deretic. 2005. Mechanism of phagolysosome biogenesis block by viable Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. USA 102:4033-4038. [PubMed]
26. Walburger, A., A. Koul, G. Ferrari, L. Nguyen, C. Prescianotto-Baschong, K. Huygen, B. Klebl, C. Thompson, G. Bacher, and J. Pieters. 2004. Protein kinase G from pathogenic mycobacteria promotes survival within macrophages. Science 304:1800-1804. [PubMed]
27. Wallis, R. S., M. Palaci, and K. Eisenach. 2007. Persistence, not resistance, is the cause of loss of isoniazid effect. J. Infect. Dis. 195:1870-1871. [PubMed]
28. Wallis, R. S., S. Patil, S. H. Cheon, K. Edmonds, M. Phillips, M. D. Perkins, M. Joloba, A. Namale, J. L. Johnson, L. Teixeira, R. Dietze, S. Siddiqi, R. D. Mugerwa, K. Eisenach, and J. J. Ellner. 1999. Drug tolerance in Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 43:2600-2606. [PMC free article] [PubMed]
29. Wayne, L. G., and L. G. Hayes. 1996. An in vitro model for sequential study of shiftdown of Mycobacterium tuberculosis through two stages of nonreplicating persistence. Infect. Immun. 64:2062-2069. [PMC free article] [PubMed]
Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of
American Society for Microbiology (ASM)