PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jvirolPermissionsJournals.ASM.orgJournalJV ArticleJournal InfoAuthorsReviewers
 
J Virol. 2009 July; 83(14): 7129–7141.
Published online 2009 May 13. doi:  10.1128/JVI.00397-09
PMCID: PMC2704763
Latency-Associated Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus (KSHV) Upregulates Survivin Expression in KSHV-Associated B-Lymphoma Cells and Contributes to Their Proliferation[down-pointing small open triangle]
Jie Lu, Subhash C. Verma, Masanao Murakami, Qiliang Cai, Pankaj Kumar, Bingyi Xiao, and Erle S. Robertson*
Department of Microbiology and Tumor Virology Program of the Abramson Comprehensive Cancer Center, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104
*Corresponding author. Mailing address: Department of Microbiology and Tumor Virology Program of the Abramson Comprehensive Cancer Center, University of Pennsylvania School of Medicine, 201E Johnson Pavilion, 3610 Hamilton Walk, Philadelphia, PA 19104. Phone: (215) 746-0114. Fax: (215) 898-9557. E-mail: erle/at/mail.med.upenn.edu
Received February 23, 2009; Accepted April 28, 2009.
Survivin is a master regulator of cell proliferation and cell viability and is highly expressed in most human tumors. The molecular network linked to survivin expression in tumors has not been completely elucidated. In this study, we show that latency-associated nuclear antigen (LANA), a multifunctional protein of Kaposi's sarcoma-associated herpesvirus (KSHV) that is found in Kaposi's sarcoma tumors, upregulates survivin expression and increases the proliferation of KSHV-infected B cells. Analysis of pathway-specific gene arrays showed that survivin expression was highly upregulated in BJAB cells expressing LANA. The mRNA levels of survivin were also upregulated in HEK 293 and BJAB cells expressing LANA. Similarly, protein levels of survivin were significantly higher in LANA-expressing, as well as KSHV-infected, cells. Survivin promoter activity assays identified GC/Sp1 and p53 cis-acting elements within the core promoter region as being important for LANA activity. Gel mobility shift assays revealed that LANA forms a complex with Sp1 or Sp1-like proteins bound to the GC/Sp1 box of the survivin promoter. In addition, a LANA/p53 complex bound to the p53 cis-acting element within the survivin promoter, indicating that upregulation of survivin expression can also occur through suppression of p53 function. Furthermore, immunohistochemistry analyses revealed that survivin expression was upregulated in KSHV-associated Kaposi's sarcoma tissue, suggesting that LANA plays an important role in the upregulation of survivin expression in KSHV-infected endothelial cells. Knockdown of survivin expression by lentivirus-delivered small hairpin RNA resulted in loss of cell proliferation in KSHV-infected cells. Therefore, upregulation of survivin expression in KSHV-associated human cells contributes to their proliferation.
Kaposi's sarcoma-associated herpesvirus (KSHV)/human herpesvirus 8 has been implicated in the development of the endothelial neoplasm referred to as Kaposi's sarcoma (KS), as well as several B-cell lymphoproliferative diseases (14, 16, 38, 46). Latency-associated nuclear antigen (LANA), encoded by open reading frame 73 (OFR73) of KSHV, is one of several viral genes constitutively expressed during latent infection (12). It is a highly immunogenic nuclear protein that was initially detected by immunofluorescence assay in sera from KS patients (33). LANA is composed of 1,162 amino acid residues and is resolved on sodium dodecyl sulfate (SDS)-polyacrylamide gels as a 222- to 234-kDa protein (26, 33). Importantly, LANA is a multifunctional protein, with DNA replication, chromosome tethering, antiapoptotic, cell cycle regulatory, and gene regulatory functions (32).
Recent gene array studies from Wang et al. have found that KSHV infection reprograms cellular gene expression (66) and that the expression of LANA alone is sufficient to modulate gene expression (9, 53, 56, 67). Additionally, LANA can associate with the transcription factor 4/cyclic AMP response element-binding protein 2 and mSin3A, as well as CREB-binding protein and RING3, to repress transcription (35, 42). LANA also modulates transcription by altering the subcellular distribution of glycogen synthase kinase 3b, a negative regulator of β-catenin (24). Friborg et al. also showed that LANA represses the transcriptional activity of p53 and, furthermore, inhibits the ability of p53 to induce cell death (23). Furthermore, LANA interacts with pRb protein and concurrently stimulates transcription from the cyclin E promoter (50). These findings provided evidence suggesting that LANA contributes to KSHV-mediated oncogenesis by deregulating both the p53 and pRb tumor suppressor pathways.
The association of LANA with multiple proteins that participate in transcriptional repression strongly supported the possibility that LANA can also upregulate cellular genes indirectly. Genes regulated by a variety of transcription factors (E2F, Sp1, Ap1, RBP-Jκ, ATF4, CBP, and Id-1) have been reported to be modulated by LANA (36, 43, 50, 61, 63). There is also the indirect regulation of the Ets-1 responsive promoters through a LANA-Daxx interaction (47). More recently, we showed that LANA regulates the ubiquitination of intracellular activated Notch (ICN) mediated by the F-box component of the E3 ligase, Sel10, that is important for proliferation of the virally infected cells (37). Also, LANA was shown to recruit the EC5S E3 ligase for regulating ubiquitination of the p53 and VHL tumor suppressors (13).
Survivin is a well-studied member of the inhibitor of apoptosis (IAP) gene family in mammalian cells that is about 16.5 kDa in size and is expressed in embryonic or proliferating adult tissues (58). Moreover, it is highly overexpressed in many human cancers (4), such as lung, colon, breast, pancreas, stomach, liver, ovary, and prostate cancer, as well as in melanoma and hematopoietic malignancies (2, 8, 11, 28). The results of current studies indicate that survivin can function as a critical nodal protein in the context of cancer networks regulating numerous cellular pathways (5). These pathways regulate cell functions which include cell division, apoptosis or programmed cell death, cellular stress response, and checkpoint mechanisms of genomic integrity (3, 5). Interestingly, Wang et al. previously reported that the KSHV-encoded K7 protein is a viral antiapoptotic protein which is structurally and functionally similar to a spliced variant of human survivin, survivin-ΔEx3 (65).
The survivin gene promoter contains Sp1, Sp1-like, and p53 cis-acting elements (21). Thus, the Sp1 and p53 transcription factors are likely to play a role in the regulation of survivin expression. Previous reports indicated that the constitutive expression of survivin in human cancers is a direct consequence of the multiple Sp1 sites within the survivin core promoter region (28, 39). Thus, the targeted inhibition of Sp1 function and/or disruption of Sp1 binding to its DNA cognate sequence may be an effective strategy for suppression of survivin transcription. Transcriptional studies have also identified a proximal promoter that lacks a TATA or CAAT box but possesses CpG islands that are capable of binding Sp1 (39). Analysis of this promoter element showed that these CpG islands are essential for activating transcription of the human survivin gene (39). These Sp1 and Sp1-like proteins are expressed in the majority of mammalian cells and can bind and regulate the expression of many housekeeping, tissue-specific, viral, and inducible genes through interaction with GC boxes (41, 54, 59). Transcription regulation mediated by Sp1 and Sp1-like proteins depends on the environmental milieu, as well as interaction with other transcription factors. Thus, Sp1 can act as an activator of transcription, while Sp1-like proteins can either activate or repress transcription (22, 49, 68).
Survivin transcription has been previously shown to be downregulated by binding of wild-type (WT) p53, the survivin promoter (30). Additionally, chromatin modification on the survivin promoter may contribute to silencing of survivin gene transcription by p53 (45). Recent studies also showed that downregulation of the survivin gene is mediated by p53 through the recruitment of DNA (cytosine-5-)-methyltransferase 1 (DNMT1) (21).
In this study, we showed that LANA can upregulate survivin expression by forming a complex with Sp1 or Sp1-like proteins, as well as p53, and their cognate sequences on the survivin promoter, thereby upregulating survivin gene transcription. Knockdown of survivin showed that LANA also played an important role in survivin-mediated cell proliferation. These findings describe a mechanism by which the KSHV-encoded LANA protein enhances survivin expression through association with Sp1 and p53 bound to their cis-acting element on the survivin promoter, thus leading to proliferation of the virus-infected cells.
Cell lines and antibodies.
Human embryonic kidney 293 (HEK 293) cells and p53-null Saos-2 osteosarcoma cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 7% bovine growth serum, 2 mM l-glutamine, and penicillin-streptomycin (5 U/ml and 5 μg/ml, respectively). KSHV-negative BJAB and DG75 and KSHV-infected JSC-1, BC-3, and BCBL-1 cells were cultured in RPMI 1640 (HyClone, UT) medium supplemented with 10% fetal bovine serum (FBS), 2 mM l-glutamine, and penicillin-streptomycin (5 U/ml and 5 μg/ml, respectively). All cell lines were grown at 37°C in a humidified environment supplemented with 5% CO2. BJAB cells latently infected with KSHV were kindly provided by Michael Lagunoff of the University of Washington, Seattle, WA (17). Red fluorescent protein (RFP)-BJAB and RFP-BJAB stable cell lines were described previously (57).
Antibodies for the Sp1 transcription factor were purchased from Santa Cruz Biotechnologies, Inc. (Santa Cruz, CA), and survivin antibody was purchased from Cell Signaling Technology, Inc. (Danvers, MA). Previously described rabbit anti-LANA antibody was used for the detection of LANA (37). Myc- or hemagglutinin-tagged proteins were detected with supernatants from 9E10 or 12CA5 hybridoma, respectively.
RNA extraction, gene array hybridization, and data analysis.
Total RNA was extracted from BJAB cells expressing RFP-LANA or RFP (57) by using TRIZOL reagent according to the manufacturer's instructions (Life Technologies, Gaithersburg, MD). RNA was digested with DNase to remove contaminating DNA, and the quality of RNA was evaluated by measuring the A260/A280 ratio, which was at least 1.9, as well as its gel electrophoretic pattern, which revealed two major bands of 28S and 18S RNA. Approximately 5 μg of RNA was reverse transcribed for first-strand cDNA synthesis using a SuperScript II reverse transcription system (Invitrogen, Frederick, MD). cDNA was synthesized from each RNA preparation by using the SuperScript system and used as template for the preparation of biotin-labeled cRNA using a BioArray high-yield RNA transcript labeling kit according to the manufacturer's instructions (Superarray, Frederick, MD). Biotin-labeled cRNA was hybridized to an oligo GEArray human cell cycle gene array (catalog no. OHS-020; SABiosciences, Frederick, MD) at 60°C overnight. For each reaction, 8 μg of biotinylated cRNA was used for hybridization. The filters were then washed twice with 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-1% SDS and twice with 0.1× SSC-1% SDS at 60°C for 15 min each, stained with Alexa 800-streptavidin, and scanned using an Odyssey infrared scanner (LI-COR, Inc., Lincoln, NE). Data acquisition and quantification of spot intensities were performed by using GEArray Expression Analysis suite software. Levels of change were calculated by comparing the intensities of the spots in RFP-Vector and RFP-LANA array sets after subtraction of the blank spots. Genes were considered to be expressed differentially if their expression levels were found to be altered at least 2.5-fold. Data were saved as raw image files and converted into probe set data by using the microarray suite. Statistical analysis of the data was performed using Microsoft Excel (Microsoft, Inc., Redmond, WA).
Immunofluorescence assay.
RFP-BJAB and RFP-LANA-BJAB cells on cover slides were fixed in 3% paraformaldehyde with 0.1% Triton X-100 for 20 min at room temperature. Cover slides were washed with 1× phosphate-buffered saline (PBS) and subsequently blocked in 1% bovine serum albumin for 10 min. Cells were washed in PBS and then incubated in mouse anti-LANA antibody (1:50 dilution) for 30 min. Cover slides were washed in 1× PBS and further incubated with a 1:1,000 dilution of anti-mouse Alexa Fluor 488 (Molecular Probes, Eugene, OR). DAPI (4,6-diamidino-2-phenylindole) at 0.5 μM was used for nuclear staining (Pierce, Rockford, IL). Cover slides were washed in PBS and mounted on glass slides using Prolong antifade mounting medium (Molecular Probes, Eugene, OR). The slides were examined with a Fluoview FV300 (Olympus, Melville, NY) confocal microscope, and the images were analyzed with FLUOVIEW software (Olympus, Inc., Melville, NY).
Plasmids.
The survivin promoter was amplified by PCR from plasmid pLuc-649c (generous gift from Dario C. Altieri), which has the full-length survivin promoter (69). The forward primer (5′-TTTAGATCTCCTCCCCTGTTCATTTGTCCTTCATGCCCG-3′) contains a BglII site at the 5′ end, and the reverse primer (5′-TTTAAGCTTGCCGCCGCCGCCACCTCTGCC-3′) contains a HindIII site at the 3′ end. Numbering begins at the ATG initiation site (39, 69). The survivin promoter region (positions −649 to +1) was cloned into the pGL3-basic vector (pGL3B) that had been digested with BglII and HindIII, generating pGL3B-SurP (positions −649 to +1).
The promoter region was analyzed for transcription factor binding motifs by using an online motif search tool (http://motif.genome.jp/). The promoter element with the potential Nkx2.5 binding sequence deletion was generated by PCR amplification using specific primers and designated SurPΔNkx (−389 to −342). Sp1 and p53 transcription factor binding sites were mutated by site-directed mutagenesis using PCR primers and cloned into the corresponding sites of the pGL3-basic vector to generate plasmids SurP−269/+1ΔGC/Sp1, SurP−269/+1Δp53, SurPΔGC/Sp1, SurPΔGC/Sp1+Δp53, and SurPΔp53. All the clones were confirmed by DNA sequencing performed at the University of Pennsylvania School of Medicine sequencing core.
Expression vectors for myc-tagged and flag-tagged LANA were described previously (63). Myc-tagged p53 was generated by PCR amplification and cloned in frame with the vector pA3M (13).
Real-time PCR.
Total RNA from cells (HEK 293, LANA-expressing HEK 293, BJAB, and LANA-expressing BJAB cells) was extracted by using TRIzol reagent (Invitrogen, Inc., Carlsbad, CA) according to the manufacturer's instructions. cDNA was synthesized using a SuperScript II reverse transcriptase kit (Invitrogen, Inc., Carlsbad, CA). The primers for real-time PCR were as follows: for survivin, 5′-CAGCCCTTTCTCAAGGACCA-3′ and 5′-TGTTCCTCTATGGGGTCGTC-3′, and for GAPDH (glyceraldehyde-3-phosphate dehydrogenase), 5′-TGCACCACCAACTGCTTAG-3′ and 5′-GATGCAGGGATGATGTTC-3′. The cDNA was amplified by using 10 μl of Master Mix from the DyNAmo SYBR green quantitative real-time PCR kit (MJ Research, Inc.), 1 mM of each primer, and 2 μl of the cDNA product in a 20-μl total volume. Thirty cycles of 1 min at 94°C, 30 s at 55°C, and 40 s at 72°C were followed by 10 min at 72°C in an MJ Research Opticon II thermocycler (MJ Research, Inc., Waltham, MA). Each cycle was followed by two plate readings, with the first at 72°C and the second at 85°C. A melting curve analysis was performed to verify the specificities of the amplified products. The values for the relative levels of change were calculated by the cycle threshold values for each sample tested, in triplicates.
Reporter assay.
Reporter assays were performed with HEK 293 and DG75 cells. Twelve million cells were transfected by using a Bio-Rad electroporater (Bio-Rad Laboratories, Inc., Hercules, CA) with 2.0 μg of the reporter plasmids and increasing amounts of LANA vectors (1, 2, 5, 10, 15, and 20 ng). pA3M empty vector was used as filler DNA. Transfection efficiencies were monitored by using the green fluorescent protein (GFP)-containing vector pEGFP-C1 (Clontech, Inc., Palo Alto, CA). At 24 h posttransfection, cells were harvested, washed in PBS, and lysed in cell lysis buffer (BioVision, Inc., Mountain View, CA). Fifty microliters of cell lysate was used for the reporter assay, using an LMaxII384 luminometer (Molecular Devices, Inc., Sunnyvale, CA).
A portion of the cell lysate was used for Western blotting. Transferred proteins were detected with Odyssey infrared scanning technology (LI-COR, Inc., Lincoln, NE), using Alexa Fluor 680 and Alexa Fluor 800 (Molecular Probes, Carlsbad, CA, and Rockland, Gilbertsville, PA, respectively). The level of change for the reporter plasmid with LANA was normalized to the level with the empty vector. All the transfections were done multiple times, and the results shown represent the means of the data from three independent experiments.
EMSA.
A p53 DNA probe was prepared with the complementary strand of the survivin promoter sequence from positions −86 to −59 (5′-GCGTGCGCTCCCGACATGCCCCGCGGCG-3′ [the underlined sequence is the consensus binding site for p53]). The mutant probe used as a control in electrophoretic mobility shift assays (EMSAs) had the sequence 5′-GCGTGCGCTCCTAGAATTCTATACGGCG-3′. The probes were end labeled with [γ-32P]dCTP by the use of terminal transferase (New England Biolabs, Inc., Beverly, MA). The labeled probes were purified with a NucTrap probe purification column (Stratagene, Inc., La Jolla, CA) according to the manufacturer's instructions. Nuclear extracts from Saos-2 cells expressing p53 from a heterogonous system were used as a source of p53, which was prepared as described previously (64). EMSA binding reaction mixtures were prepared with a Saos-2 nuclear extract (approximately 5 μg of protein) and the p53 probe in a 50-μl reaction mixture volume with binding buffer (20 mM HEPES [pH 7.5], 0.01% NP-40, 5.0% glycerol, 10 mM MgCl2, 100 μg bovine serum albumin, 2 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 40 mM KCl) and were then incubated at room temperature for 5 min. Antimyc antibody was used to supershift the mobility of the complex. Cold competitors (200×) were added 5 min prior to the addition of the radiolabeled probe. Bound complexes were resolved on a 5.0% nondenaturing polyacrylamide gel in 0.5× Tris-borate-EDTA. The gel was dried, and the signals were detected with a phosphorimager plate (Molecular Dynamics, Inc.).
An Sp1 DNA probe was also prepared with the complementary strand of the survivin promoter sequence from positions −147 to −117 (GGCACACCCCGCGCCGCCCCGCCTCTACTCCCAGAAGG [the underlined sequence is the consensus binding site for the Sp1 transcription factor]). The mutant probe used as a control in EMSAs had the sequence GCACCCGAATTCATGGATCCTCTACTCCCAG. Saos-2 nuclear extracts were used as a source of the Sp1 transcription factor.
To determine the specificity of the complex of Sp1 and probe, a 200-fold molar excess of unlabeled probe was added to the protein-poly(dI-dC) mixture before incubation at room temperature, and similarly, a 200-fold molar excess of unlabeled nonspecific competitor probe was added in a separate reaction mixture. Antibodies specific to Sp1 and nonspecific antibody were used as controls to show supershifted complexes.
Immunohistochemistry.
Slides mounted with sections of paraffin-embedded, archival, deidentified KS tissue specimens were a generous gift from Michael Feldman (Department of Pathology and Laboratory Medicine, Hospital of the University of Pennsylvania, Philadelphia, PA). Slides were deparaffinized, rehydrated, and washed with PBS. Following antigen retrieval in 10 mM sodium citrate buffer (pH 6.0) and the quenching of endogenous peroxidase activity with 0.6% H2O2, samples were blocked with 10% normal rabbit serum prior to incubation with primary antibodies overnight at 4°C. Survivin was detected by using mouse monoclonal antisurvivin antibody followed by anti-mouse Alexa Fluor 488 (Molecular Probes, Eugene, OR), and LANA was detected by using rabbit polyclonal anti-LANA antibody followed by anti-rabbit Alexa Fluor 594 (Molecular Probes, Eugene, OR). All steps were performed at room temperature. Fluorescence confocal microscopy was performed with an Olympus microscope (Olympus, Melville, NY).
Lentiviral shRNA vector constructs.
A vector expressing survivin small hairpin RNAs (shRNAs [survivin shRNA is hereinafter abbreviated as sh-SV]), pGIPZ, was purchased from Open Biosystems, Inc. (catalog no. RHS4430-99140887; Huntsville, AL). A 21-mer oligonucleotide (TCTCGCTTGGGCGAGAGTAAG) that had no significant homology to any known human mRNA in the databases was cloned in the same vector and used as control. Control shRNA is hereinafter abbreviated as sh-C.
Virus production and transduction of KSHV-infected B cells.
Lentiviruses were produced by transient transfection into HEK 293T cells as previously described (20), with the following modifications. A total of 2 × 106 HEK 293T cells were seeded in 10-cm-diameter dishes in DMEM (HyClone, Logan, UT) supplemented with 10% FBS and 1% antibiotic-antimycotic and cultured in a 5% CO2 incubator for 24 h prior to transfection, and the culture medium was changed 2 h prior to transfection. A total of 20 μg of plasmid DNA was used for the transfection of one dish, including 1.5 μg of envelope plasmid pCMV-VSV-G (catalog no. 8454; Addgene, Inc., Cambridge, MA), 3 μg of packaging plasmid pRSV-Rev (catalog no. 12253; Addgene, Inc., Cambridge, MA), 5 μg of packaging plasmid pMDLg/pRRE (catalog no. 12251 Addgene, Inc., Cambridge, MA), and 10.5 μg of lentiviral vector plasmid. The precipitate was formed by adding the plasmids to a final volume of 438 μl of H2O and 62 μl of 2 μM CaCl2, mixing well, adding 500 μl of 2× HEPES-buffered saline (281 mM NaCl, 100 mM HEPES, 1.5 mM Na2HPO4 [pH 7.05]), and then incubating at room temperature for 30 min. Chloroquine was added to the 10 ml of plated medium to a final concentration of 25 μM 5 min prior to transfection. The medium was replaced after 12 h with DMEM supplemented with 10% FBS, 10 mM HEPES, and 10 mM sodium butyrate. After 8 to 10 h, the medium was again replaced, using RPMI 1640 supplemented with 10% FBS and 10 mM HEPES. The conditioned medium was collected four times every 12 h, filtered through 0.45-μm-pore-size cellulose acetate filters, and stored on ice. The virus was concentrated by spinning at 70,000 × g for 2.5 h. Concentrated virus was used to infect 105 cells in a six-well plate in the presence of Polybrene (8 mg/ml). After 72 h, the medium was replaced with 2 ml RPMI 1640 containing 2 μg/ml puromycin. GFP immunofluorescence was assessed by using an Olympus IX71 microscope (×20 magnification) fitted with 560-nm excitation and 645-nm emission filters. Visible colonies were grown to 80% confluence in the presence of 2 μg/ml puromycin prior to cell viability and Western blot analysis.
Proliferation assay.
A total of 2 × 105 BJAB, BJAB-sh-C, BJAB-sh-SV, JSC, JSC-sh-C, or JSC-sh-SV cells were plated into each well of the 12-well plates and cultured at 37°C in complete medium without puromycin. Cells from each well were counted by trypan blue exclusion daily for five days. Experiments were performed in duplicate and were repeated three times.
Apoptosis assay.
The propidium iodide (PI) flow cytometric assay is based on the principle that apoptotic cells are characterized by DNA fragmentation and the consequent loss of nuclear DNA content at the late phase of apoptosis. Briefly, cells (106) were washed with PBS and fixed with 70% ethanol overnight at 4°C. The fixed cells were then stained with 50 μg of PI (Sigma, St. Louis, MO)/ml and 1 μg of RNase A/ml at 4°C for 1 h. PI binds to DNA by intercalating between the bases, with no sequence preference. Different cell cycle phases (G1, S, or G2/M phase) were characterized by their different DNA contents by using a FACSCalibur cytometer (Becton Dickinson, San Jose, CA), and the results were analyzed with FlowJo software (Tree Star, Ashland, OR).
The expression of survivin is upregulated in LANA-expressing BJAB cells.
LANA has been reported to regulate various cellular pathways, such as the Wnt signaling pathway stabilizing β-catenin (24, 25); tumor suppressor pathways, in association with pRb and p53 (23, 50); the ICN signaling pathway, by targeting Sel10 (37); the transcriptional activity of ATF4/CREB2, by inhibition (43); and HIF-1α, regulated by inducing ubiquitination and degradation of VHL and p53 (13). In order to further determine the effects of LANA on other potentially critical cellular pathways, we performed a pathway-specific gene array assay which determines the differential of the synthesized message from LANA-expressing cells when compared with that of the control set without LANA. Immunofluorescence assays showed that LANA protein was expressed in RFP-LANA BJAB cells (Fig. (Fig.1A).1A). The difference in the signal intensities of the spots represents the difference in the mRNA levels of the particular gene on the array. Cells expressing LANA showed modulation of the signal intensities of a number of cellular genes (Fig. (Fig.1C).1C). The genes whose signals were modulated more than 2.5-fold (results derived from the data from RFP-LANA and RFP-Vector sets after normalization) are indicated in Fig. Fig.1.1. Control genes (GAPDH and β-actin), also indicated in Fig. Fig.1,1, showed signal intensities similar to those expected for equivalent amounts of total RNA in both the sets. Similarly, spots of artificial biotinylated sequences showed similar levels of hybridization signals, confirming that the biotin labeling was equally efficient in both LANA-RFP and RFP-Vector cDNA. We therefore decided to focus our investigation on those genes which were upregulated more than 2.5-fold. The baculoviral IAP repeat-containing 5 (BIRC5), also called survivin (7), which belongs to the IAP family and can function to inhibit caspases 3 and 7 and therefore negatively regulate apoptosis, was identified (60).
FIG. 1.
FIG. 1.
Gene array analysis of the total RNA from BJAB cells expressing RFP-Vector or RFP-LANA. (A) Immunofluorescence assay for LANA and RFP expression in BJAB cells. (B) Schematic representation of the gene array protocol. (C) Hybridization signals for genes (more ...)
Our gene array analysis with the RNA from LANA-expressing cells showed upregulation of survivin transcripts, along with those of a number of other genes, including cyclin-dependent kinase 4 (CDK4), CDC28 protein kinase regulatory subunit 2 (CKS2), minichromosome maintenance-deficient 2 (MCM2), proliferating-cell nuclear antigen (PCNA), and SMT3 suppressor of mif two 3 homolog 1 (SUMO-1). Importantly, survivin is one of the well-known cellular molecules involved in inhibition of apoptosis, genome fidelity, and induction of cell proliferation. Therefore, we decided to investigate further the potential links between the enhanced levels of survivin in KSHV-infected cells and KSHV-induced cell proliferation.
LANA induces the expression of survivin in human cells and in KSHV-infected lymphoma cells.
To support and validate the data from the pathway-specific gene array analysis showing upregulation of survivin, we performed reverse transcription-PCR (RT-PCR) and Western blot analyses to more specifically determine the direct effect of LANA on the levels of survivin mRNA and protein (Fig. (Fig.2).2). We extracted total RNA from HEK 293 and BJAB cells stably expressing LANA and vector only for use in RT-PCR. RT-PCR analysis showed that LANA increased the survivin transcript levels by 4.5-fold and 2.4-fold in human HEK 293 and BJAB cells, respectively (Fig. 2A and B). Furthermore, the effect of LANA on the survivin protein levels was analyzed by Western blotting, which again showed upregulation of survivin protein by approximately three- to fivefold as seen by visual inspection (Fig. (Fig.2C).2C). To determine the levels of survivin in KSHV-infected cells (BC3, BCBL1, and JSC cells), we again performed Western blot analysis to detect survivin; the results of those analyses showed a threefold-enhancement of survivin expression compared to the levels in noninfected cells (HEK 293, Saos-2, and BJAB cells) (Fig. (Fig.2D2D).
FIG. 2.
FIG. 2.
Survivin was upregulated by LANA. (A, B) Quantitation of survivin transcripts by semiquantitative RT-PCR. Total RNA was isolated from 20 million HEK 293 (−), LANA-expressing HEK 293, or KSHV-infected and noninfected (−) BJAB cells by using (more ...)
LANA can upregulate survivin promoter activity in a dose-dependent manner.
Since KSHV-infected and LANA-expressing cells showed higher levels of survivin mRNA and protein levels, we further explored the molecular mechanism through which the survivin promoter is upregulated by LANA. In order to analyze the role of LANA on the survivin promoter, we cloned the full-length promoter into the pGL3B vector. A fixed amount of WT (positions −649 to +1) survivin promoter driving luciferase DNA was cotransfected with increasing doses of pA3M-LANA into HEK 293 and DG75 cells. The total amount of DNA was normalized to that of the pA3M vectors. After 24 h of incubation, the cells were harvested for luciferase reporter assays. The reporter assays showed that, in HEK 293 cells and the DG75 B-cell line, LANA indeed activated the survivin promoter at levels approximately three- to fivefold greater than the level of survivin promoter activator with the vector control, in a dose-dependent fashion (Fig. 3A and B).
FIG. 3.
FIG. 3.
LANA upregulated survivin promoter activity in a dose-dependent manner. (A, B) A fixed amount (2 μg) of the reporter plasmid PGL3B-SurP was transfected or cotransfected with increasing amounts of pA3M-LANA (1, 2, 5, 10, 15, and 20 μg [numbered (more ...)
The GC/Sp1-rich and p53 cis-acting elements are important for activation of the survivin promoter by LANA.
To define the cis elements responsible for the activation of survivin transcription by LANA, 5′-end deletion mutants of the survivin promoter were generated and these constructs were cotransfected into HEK 293 cells in the presence or absence of the LANA expression vector. The luciferase activity was assayed, and representative results from these experiments are shown in Fig. 4A to D.
FIG. 4.
FIG. 4.
Identification of cis-acting elements responsible for activation of survivin transcription by LANA. (A to D) Fixed amounts (2 μg) of WT or indicated mutant survivin promoter reporter plasmids were transfected or cotransfected into 10 million HEK (more ...)
As the results show (Fig. (Fig.4A),4A), the deletion of NK2 transcription factor-related locus 5 (Nkx2.5), a cardiac homeobox transcription factor, from the 5′ end of the survivin promoter (SurPΔNkx) resulted in a mild stimulatory effect on survivin promoter activity compared to the activity of the WT survivin promoter (pGL3B-SurP) (Fig. 4A and E). Therefore, these sequences are not likely to be critical in the requirement for LANA-mediated upregulation. However, the deletion of the first GC/Sp1 element of the survivin promoter (SurP−269/+1) resulted in a strong decrease in the promoter activity (Fig. 4B and E). Furthermore, mutation of the p53 responsive element (SurPΔp53) had little or no effect on the promoter activity (Fig. 4C and E). However, mutation of GC/Sp1 and the p53 element (SurPΔGC+ΔP53) resulted in the loss of survivin promoter activity in the presence of LANA (Fig. (Fig.4B,4B, D, and E). These results strongly suggested that the GC/Sp1 and p53 responsive elements were the major cis elements on the survivin promoter that were responsive to LANA.
The p53 cis elements are synergistic in their response to LANA and p53.
To test whether the p53 binding motif is important for the effect of LANA on the survivin promoter or if the response is through the direct interaction of LANA and p53, a similar assay was performed in the p53-null cell line Saos-2. As expected, mutation of the p53 responsive element had a significant effect on survivin promoter activity compared to the effect of the control, pGL3B-SurP (Fig. (Fig.5,5, lanes 7 and 8). However, mutation of the GC/Sp1 element 52 bp upstream of the p53 site showed a slight effect on survivin promoter activity compared to the effect of the pGL3B-SurP control without LANA expression (Fig. (Fig.5,5, lanes 5 and 6). Interestingly, mutation of both the GC/Sp1 and p53 responsive elements led to a significant decrease in survivin promoter activity compared to the effect of the pGL3B-SurP control with LANA expression in the p53-null Saos-2 cell line (Fig. (Fig.5,5, lanes 2 and 9). These results suggest that p53, through interaction with its responsive element on the survivin promoter, can cooperate with the complex bound to the GC/Sp1 site and contribute to the predominant survivin promoter activity mediated by LANA.
FIG. 5.
FIG. 5.
Reporter assay for GC/Sp1 and p53 mutant survivin promoters in Saos-2 cells. A fixed amount (2 μg) of the WT or mutant reporter plasmid was transfected into 10 million Saos-2 cells in the presence of 10 μg of pA3M-LANA expression vector. (more ...)
Sp1 and p53 bound to their cis-acting elements form complexes with LANA.
The survivin gene promoter contains several canonical Sp1, Sp1-like, and p53 binding elements (21). The deletion of these sites abrogates the activity of the promoter, suggesting that Sp1 in collaboration with p53 contributes to the regulation of survivin gene expression. Therefore, to test whether LANA-mediated upregulation of the survivin promoter occurs through the formation of a complex with LANA and Sp1 bound at its cognate sequence or LANA and p53 bound to its binding site, EMSAs were performed. WT and mutant probes for EMSAs were designed which consisted of the potential Sp1 and p53 elements from the survivin promoter. To determine whether LANA formed a complex with Sp1 bound to DNA, double-stranded DNA probes for the Sp1 binding site were labeled and tested for binding to Sp1 protein from the nuclear extracts of Saos-2 cells transiently expressing Sp1 (Fig. (Fig.6A).6A). The results showed that the WT Sp1 probe generated a specific shift with Sp1 from nuclear extracts of Saos-2 cells (Fig. (Fig.6A,6A, lane 2). The specificity of the shift was verified by using excess specific cold competitor, which abolished the shift of the specific probe (Fig. (Fig.6A,6A, lane 3). The use of similar amounts of cold mutant or the nonspecific cold competitor probe was not able to abolish binding of Sp1 to the specific probe (Fig. (Fig.6A,6A, lane 4), suggesting that there is specificity of Sp1 interaction at the survivin promoter. To determine if the indicated shift was due to Sp1, we used an anti-Sp1-specific antibody, which supershifted the complex (Fig. (Fig.6A,6A, lane 5). The addition of LANA to the reaction mixture further shifted the entire complex, suggesting that both Sp1 and LANA were bound to the probe (Fig. (Fig.6A,6A, lane 6). Importantly, the use of antimyc antibody, which recognizes the myc epitope tag fused to LANA, shifted the complex further and so confirmed the association of the above-described Sp1 DNA complex with LANA (Fig. (Fig.6A,6A, lane 7).
FIG. 6.
FIG. 6.
EMSAs. (A) Binding of Sp1 site with LANA protein, as well as Sp1. Lane 1 contains probe (bottom) alone. Lane 2 contains probe with nuclear extract containing Sp1 and shows retarded mobility of the probe (stars), which was abolished by adding an excess (more ...)
Similarly, to determine whether LANA formed a complex with p53 bound to the p53 responsive element, an EMSA using nuclear extract from Saos-2 cells expressing p53 and LANA was also performed as described above. The results showed a distinctive shift when nuclear extract containing p53 was incubated with the p53-specific labeled probe (Fig. (Fig.6B,6B, lane 3). The specificity of the shift was verified through its disappearance in the presence of a specific cold competitor (Fig. (Fig.6B,6B, lane 4), with no effect seen in the presence of nonspecific cold competitor (Fig. (Fig.6B,6B, lane 5). The complex was clearly supershifted in the presence of antimyc antibodies which recognize the myc epitope tag fused to p53 (Fig. (Fig.6B,6B, lane 6). Importantly, the probes were further supershifted by the use of LANA protein and antiflag antibodies to detect the LANA-flag fusion protein, indicating the presence of these proteins in the complexes (Fig. (Fig.6B,6B, lanes 7 and 8).
These results reliably show that LANA-mediated upregulation of the survivin promoter likely occurs through the formation of complexes of LANA and Sp1 bound to its cognate sequence, as well as LANA and p53 bound to its binding site. These results, in addition to those of the reporter assays described above, provide ample evidence for LANA-mediated upregulation of survivin expression.
Survivin expression is upregulated in KSHV-infected KS tissues.
To support the above-described in vitro data, we wanted to show that survivin expression is also upregulated in KSHV-associated tissue. Therefore, sections of a KS lesion from a human immunodeficiency virus-positive patient were analyzed by immunohistochemistry. LANA signals were detected by using rabbit polyclonal anti-LANA antibody followed by anti-rabbit Alexa Fluor 488 (Fig. (Fig.7B),7B), and survivin signals were detected by using mouse monoclonal antisurvivin antibody followed by anti-mouse Alexa Fluor 594 (Fig. (Fig.7C).7C). The results from this immunohistochemical analysis showed that the expression of high levels of survivin in cells from KS tissue correlated with the presence of LANA in KSHV-positive cells (Fig. (Fig.7D).7D). The merged signals showed significant overlap between the LANA and survivin signals shown in Fig. 7B and C.
FIG. 7.
FIG. 7.
Immunohistochemistry of survivin in KSHV-infected KS tissues. Paraffin-embedded KS tissue specimens were deparaffinized, rehydrated, and washed with PBS. Following antigen retrieval in 0.1 mM sodium citrate (pH 6.0) and the quenching of endogenous peroxidase (more ...)
The expression of survivin is important for driving cell proliferation in KSHV-infected and uninfected cells.
In the context of the above-described results, we hypothesized that LANA utilizes the survivin pathway to promote cellular survival and proliferation. Thus, we wanted to determine whether LANA-mediated enhanced levels of survivin play a role in cell proliferation. Transduction with shRNA-containing lentivirus and selection of KSHV-infected cells resulted in stable cell lines carrying the sh-SV vector and the sh-C vector. The cells with GFP immunofluorescence were monitored by using the Olympus IX71 fluorescent microscope (Fig. (Fig.8A).8A). The expression levels of survivin among these cells, along with the levels of sh-C, were then detected by Western blot analysis (Fig. (Fig.8B).8B). The results showed that the survivin expression level was significantly knocked down in cells infected with the sh-SV lentivirus (Fig. (Fig.8B).8B). To further confirm that LANA-mediated cell proliferation occurred when the levels of survivin expression in KSHV-infected cells were higher, proliferation assays were performed. The results showed that BJAB cells infected with the lentivirus control sh-C expressed a relatively high level of survivin, but in cells infected with the lentivirus sh-SV, the level of survivin was substantially decreased (Fig. (Fig.8C).8C). Similarly, JSC cells infected with KSHV in which LANA expression is at a relatively high level were infected with lentivirus carrying sh-SV that specifically knocks down survivin expression in these cells (JSC-sh-SV) when compared to the level of survivin expression with JSC-sh-C (Fig. (Fig.8C).8C). We further compared the proliferation rates in these systems with and without KSHV expressing LANA. Interestingly, the proliferation of KSHV-negative BJAB cells with survivin knocked down was also clearly slower than that of the cells with sh-C (Fig. (Fig.8C).8C). Moreover, the proliferation rate of KSHV-positive JSC cells with reduced levels of survivin was dramatically slower (at least a fivefold decrease) than the proliferation rates of all other cells, starting from 48 h and increasing by 96 h (Fig. (Fig.8C).8C). A small decrease in growth rate was seen in JSC cells carrying the control lentivirus JSC-sh-C, which may be a consequence of the infection and of sensitivity of the JSC cells to the lentivirus. However, it was clear from repeated analyses that the JSC cells infected with the sh-SV lentivirus had a much more dramatic reduction in growth rate. Furthermore, the results of apoptosis assays showed that the JSC cells infected with the sh-SV lentivirus had an enhanced level of cell apoptosis compared to the levels of apoptosis in the JSC-sh-C cells and BJAB-sh-SV cells at 96 h (Fig. (Fig.8D).8D). Therefore, the results of the studies described above support our hypothesis that KSHV-positive cells expressing LANA play a critical role in survivin expression in the infected cells and have a direct role in driving the proliferative state in KSHV-infected lymphoma cells.
FIG. 8.
FIG. 8.
Proliferation rates of cells with survivin knocked down by lentivirus-delivered shRNA. (A) Survivin expression of cell line BJAB not infected with KSHV and KSHV-infected cell line JSC was knocked down by lentivirus-delivered shRNA. GFP expression was (more ...)
KSHV is known to possess a complex series of molecular strategies linked to regulation of cell proliferation, induction of cell transformation, and suppression of apoptosis. Indeed, a number of previous single-gene studies have shown that different KSHV-encoded genes harbor many of these functional properties (15, 18, 23, 50). The LANA protein of KSHV is abundantly expressed in virus-associated malignancies (34, 51). LANA is not only critical for viral episomal maintenance during latent infection but has also been reported to have transcriptional regulatory properties that allow it to directly modulate the promoters of cellular and viral genes, as well as its own promoters (27, 31). Another crucial role associated with LANA's oncogenicity is its interaction with an array of transcriptional factors, such as ATF4/CREB2 (43), c-Jun (10), p53 (23), and STAT3 (48), shown to indirectly regulate downstream target gene expression. Recently, we showed the interaction of LANA with Sp1, resulting in upregulation of the telomerase promoter and potentially contributing to the immortalization of KSHV-infected cells (63). Additionally, LANA can suppress the functional activities of p53, thereby facilitating KSHV-mediated pathogenesis (57).
These reports establish that LANA can modulate various cellular pathways. The results of our pathway-specific gene array analysis of the total RNA from BJAB cells expressing RFP-Vector and RFP-LANA further showed that a number of cell factors were upregulated in LANA-expressing cells, including the inhibitor of apoptosis protein survivin. This suggested that LANA may function as an activator for upregulating survivin expression. As expected, the results further showed that LANA expression resulted in increased levels of survivin mRNA in LANA-expressing HEK 293 and BJAB cells. Additionally, survivin expression was upregulated in KSHV-infected cells (BCBL1, BC3, and JSC) in comparison with its levels in cells not infected with KSHV (HEK 293, Saos-2, and BJAB), and LANA increased survivin expression in a dose-dependent manner in epithelial and B-cell lines. The results suggested that upregulation of survivin was correlated with LANA expression levels.
Generalized transcription activity is a local phenomenon, and every cell coordinates the expression of a vast number of genes important for survival as part of its generalized transcription activity. Survivin gene expression is essential and evolutionarily conserved during late-stage cell division, especially in cytokinesis, which potentially involves cleavage furrow formation (1, 62). Survivin is also associated with DNA damage and other epigenetic effects (21). In addition, increased survivin expression leads to uncontrolled cell proliferation and survival, which is a hallmark of cancer (29). Survivin, an IAP family member, is known to be involved in the control of both cell division and inhibition (3, 6, 40, 44, 55). In addition, the spliced variant survivin-ΔEx3 may be the cellular homologue of KSHV K7 and functions as a constitutively expressed adaptor protein capable of recruiting activated caspases (65). Several groups have also independently demonstrated that survivin repression is p53 dependent (30, 45), but it was not clear if the p53 binding sequence of the survivin promoter was involved in its repression in response to p53 activation. The data described above showed that LANA can bind to Sp1 and p53 in complex with their cis-acting elements within the survivin promoter. However, the detailed mechanism and significance of LANA interaction with the survivin promoter continues to be explored in our laboratory.
Previous reports showed that the survivin gene promoter contains CG-rich-Sp1 canonical, Sp1-like, cell cycle-dependent element/cell cycle gene homology region, and p53 binding sites (21). Therefore, we analyzed the promoter region from positions −649 to +1 and tried to determine which responsive elements of the survivin promoter were responsible for interaction and complex formation with LANA. Using a series of survivin promoter-luciferase constructs, we identified GC/Sp1 and p53 elements within the survivin core promoter region that were critical for LANA to enhance survivin transcription. Another study has shown that Sp1 is a major player in regulating survivin gene expression and apoptosis control (39). EMSA results further revealed that LANA forms a complex with Sp1 or Sp1-like proteins bound to the GC/Sp1 cis-acting DNA element on the survivin promoter, which results in upregulation of its activity. Interestingly, a recent study has shown that selenium inhibits Sp1 binding to its cis-acting element and downregulates the survivin promoter activity (19). In addition, p53 regulated survivin expression by binding directly to the survivin promoter (52). The LANA/p53 complex was also shown to bind the p53 responsive element on the survivin promoter, indicating that upregulation of survivin expression may occur through alteration of p53 function through its association with LANA. Previous studies have also suggested that LANA contributes to viral persistence and oncogenesis through the promotion of cell survival via targeted disruption of p53 functions (13, 23). Furthermore, survivin expression also antagonizes p53-induced apoptosis (30).
The results of immunohistochemistry analysis revealed that survivin expression was upregulated in KSHV-associated tissue, suggesting that LANA, in addition to other latent proteins, is likely to play an important role in the upregulation of survivin expression in KSHV-infected cells, thus contributing to KSHV-associated tumorigenesis. Furthermore, depletion of survivin by using shRNA decreases the rate of cell proliferation in KSHV-positive lymphoma cells, which strongly suggests that LANA plays an important role in the upregulation of survivin expression and, thus, maintenance of the proliferative state in KSHV-infected cells. The utilization of the survivin pathway by LANA would be at least in part to promote enhanced cellular survival and proliferation, which then, combined with decreased apoptotic activity, may drive polyclonal expansion of cells. These changes, in addition to the acquisition of epigenetic changes and disruption of the cellular processes involved in genome fidelity (57), are likely to lead to the outgrowth of tumor cells.
In summary, we have shown in this report that the LANA protein of KSHV upregulates survivin expression through the formation of complexes with Sp1 or Sp1-like proteins binding to the Sp1 site within the core survivin promoter region. In addition, LANA also alters p53 function by forming complexes with p53 bound to the p53 binding site on the survivin promoter, thus increasing survivin promoter activity (Fig. (Fig.9).9). Survivin expression was also upregulated in KS tissue, suggesting that LANA can contribute to the upregulation of survivin expression in KSHV-positive KS tissue. Furthermore, knockdown of survivin expression by lentivirus-delivered shRNA showed that LANA plays an important role in survivin-mediated cell proliferation. These results show that LANA upregulated survivin expression by complexing with Sp1 or Sp1-like proteins, as well as p53, at specific cis elements on the survivin promoter. This contributes to the enhanced effect of LANA on survivin gene transcription and, therefore, the upregulation of survivin which contributes to cell proliferation. The present study provides an insight into the mechanisms linked to the development of KSHV-associated cancer through the enhancement of a major cellular molecule, survivin, which is known to orchestrate the activities of a range of cellular networks that are important in the development of human cancers.
FIG. 9.
FIG. 9.
Hypothetical model showing upregulation of survivin through LANA association with the Sp1 transcription factor and p53 after KSHV infection. RE, responsive element.
Acknowledgments
We thank Dario C. Altieri (Department of Cancer Biology, University of Massachusetts Medical School, Worcester, MA) for the pLuc-649c plasmid with the full-length survivin promoter. We also thank Richard Dzeng for excellent technical assistance.
This work was supported by public health service grants NCI CA072510, CA091792, A167037, and NIDCR DE017338 (to E.S.R.). E.S.R. is a scholar of the Leukemia and Lymphoma Society of America. S.C.V. is supported by an NIH Pathway to Independence award (K99CA126182).
Footnotes
[down-pointing small open triangle]Published ahead of print on 13 May 2009.
1. Adams, R. R., M. Carmena, and W. C. Earnshaw. 2001. Chromosomal passengers and the (aurora) ABCs of mitosis. Trends Cell Biol. 1149-54. [PubMed]
2. Adida, C., C. Haioun, P. Gaulard, E. Lepage, P. Morel, J. Briere, H. Dombret, F. Reyes, J. Diebold, C. Gisselbrecht, G. Salles, D. C. Altieri, and T. J. Molina. 2000. Prognostic significance of survivin expression in diffuse large B-cell lymphomas. Blood 961921-1925. [PubMed]
3. Altieri, D. C. 2006. The case for survivin as a regulator of microtubule dynamics and cell-death decisions. Curr. Opin. Cell Biol. 18609-615. [PubMed]
4. Altieri, D. C. 2001. The molecular basis and potential role of survivin in cancer diagnosis and therapy. Trends Mol. Med. 7542-547. [PubMed]
5. Altieri, D. C. 2008. Survivin, cancer networks and pathway-directed drug discovery. Nat. Rev. Cancer 861-70. [PubMed]
6. Altieri, D. C. 2003. Survivin, versatile modulation of cell division and apoptosis in cancer. Oncogene 228581-8589. [PubMed]
7. Ambrosini, G., C. Adida, and D. C. Altieri. 1997. A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nat. Med. 3917-921. [PubMed]
8. Ambrosini, G., C. Adida, G. Sirugo, and D. C. Altieri. 1998. Induction of apoptosis and inhibition of cell proliferation by survivin gene targeting. J. Biol. Chem. 27311177-11182. [PubMed]
9. An, F. Q., N. Compitello, E. Horwitz, M. Sramkoski, E. S. Knudsen, and R. Renne. 2005. The latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus modulates cellular gene expression and protects lymphoid cells from p16 INK4A-induced cell cycle arrest. J. Biol. Chem. 2803862-3874. [PubMed]
10. An, J., Y. Sun, and M. B. Rettig. 2004. Transcriptional coactivation of c-Jun by the KSHV-encoded LANA. Blood 103222-228. [PubMed]
11. Andersen, M. H., I. M. Svane, J. C. Becker, and P. T. Straten. 2007. The universal character of the tumor-associated antigen survivin. Clin. Cancer Res. 135991-5994. [PubMed]
12. Ballestas, M. E., P. A. Chatis, and K. M. Kaye. 1999. Efficient persistence of extrachromosomal KSHV DNA mediated by latency-associated nuclear antigen. Science 284641-644. [PubMed]
13. Cai, Q. L., J. S. Knight, S. C. Verma, P. Zald, and E. S. Robertson. 2006. EC5S ubiquitin complex is recruited by KSHV latent antigen LANA for degradation of the VHL and p53 tumor suppressors. PLoS Pathog. 2e116. [PMC free article] [PubMed]
14. Cesarman, E., Y. Chang, P. S. Moore, J. W. Said, and D. M. Knowles. 1995. Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS- related body-cavity-based lymphomas. N. Engl. J. Med. 3321186-1191. [PubMed]
15. Cesarman, E., E. A. Mesri, and M. C. Gershengorn. 2000. Viral G protein-coupled receptor and Kaposi's sarcoma: a model of paracrine neoplasia? J. Exp. Med. 191417-422. [PMC free article] [PubMed]
16. Chang, Y., E. Cesarman, M. S. Pessin, F. Lee, J. Culpepper, D. M. Knowles, and P. S. Moore. 1994. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 2661865-1869. [PubMed]
17. Chen, L., and M. Lagunoff. 2005. Establishment and maintenance of Kaposi's sarcoma-associated herpesvirus latency in B cells. J. Virol. 7914383-14391. [PMC free article] [PubMed]
18. Cheng, E. H., J. Nicholas, D. S. Bellows, G. S. Hayward, H. G. Guo, M. S. Reitz, and J. M. Hardwick. 1997. A Bcl-2 homolog encoded by Kaposi sarcoma-associated virus, human herpesvirus 8, inhibits apoptosis but does not heterodimerize with Bax or Bak. Proc. Natl. Acad. Sci. USA 94690-694. [PubMed]
19. Chun, J. Y., Y. Hu, E. Pinder, J. Wu, F. Li, and A. C. Gao. 2007. Selenium inhibition of survivin expression by preventing Sp1 binding to its promoter. Mol. Cancer Ther. 62572-2580. [PMC free article] [PubMed]
20. Dull, T., R. Zufferey, M. Kelly, R. J. Mandel, M. Nguyen, D. Trono, and L. Naldini. 1998. A third-generation lentivirus vector with a conditional packaging system. J. Virol. 728463-8471. [PMC free article] [PubMed]
21. Esteve, P. O., H. G. Chin, and S. Pradhan. 2007. Molecular mechanisms of transactivation and doxorubicin-mediated repression of survivin gene in cancer cells. J. Biol. Chem. 2822615-2625. [PubMed]
22. French, S. W., C. S. Malone, R. R. Shen, M. Renard, S. E. Henson, M. D. Miner, R. Wall, and M. A. Teitell. 2003. Sp1 transactivation of the TCL1 oncogene. J. Biol. Chem. 278948-955. [PubMed]
23. Friborg, J., Jr., W. Kong, M. O. Hottiger, and G. J. Nabel. 1999. p53 inhibition by the LANA protein of KSHV protects against cell death. Nature 402889-894. [PubMed]
24. Fujimuro, M., and S. D. Hayward. 2003. The latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus manipulates the activity of glycogen synthase kinase-3β. J. Virol. 778019-8030. [PMC free article] [PubMed]
25. Fujimuro, M., F. Y. Wu, C. ApRhys, H. Kajumbula, D. B. Young, G. S. Hayward, and S. D. Hayward. 2003. A novel viral mechanism for dysregulation of beta-catenin in Kaposi's sarcoma-associated herpesvirus latency. Nat. Med. 9300-306. [PubMed]
26. Gao, S. J., L. Kingsley, M. Li, W. Zheng, C. Parravicini, J. Ziegler, R. Newton, C. R. Rinaldo, A. Saah, J. Phair, R. Detels, Y. Chang, and P. S. Moore. 1996. KSHV antibodies among Americans, Italians and Ugandans with and without Kaposi's sarcoma. Nat. Med. 2925-928. [PubMed]
27. Garber, A. C., M. A. Shu, J. Hu, and R. Renne. 2001. DNA binding and modulation of gene expression by the latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus. J. Virol. 757882-7892. [PMC free article] [PubMed]
28. Grossman, D., J. M. McNiff, F. Li, and D. C. Altieri. 1999. Expression and targeting of the apoptosis inhibitor, survivin, in human melanoma. J. Investig. Dermatol. 1131076-1081. [PubMed]
29. Hanahan, D., and R. A. Weinberg. 2000. The hallmarks of cancer. Cell 10057-70. [PubMed]
30. Hoffman, W. H., S. Biade, J. T. Zilfou, J. Chen, and M. Murphy. 2002. Transcriptional repression of the anti-apoptotic survivin gene by wild type p53. J. Biol. Chem. 2773247-3257. [PubMed]
31. Jeong, J. H., J. Orvis, J. W. Kim, C. P. McMurtrey, R. Renne, and D. P. Dittmer. 2004. Regulation and autoregulation of the promoter for the latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus. J. Biol. Chem. 27916822-16831. [PubMed]
32. Kaul, R., S. C. Verma, and E. S. Robertson. 2007. Protein complexes associated with the Kaposi's sarcoma-associated herpesvirus-encoded LANA. Virology 364317-329. [PubMed]
33. Kedes, D. H., E. Operskalski, M. Busch, R. Kohn, J. Flood, and D. Ganem. 1996. The seroepidemiology of human herpesvirus 8 (Kaposi's sarcoma-associated herpesvirus): distribution of infection in KS risk groups and evidence for sexual transmission. Nat. Med. 2918-924. [PubMed]
34. Kellam, P., C. Boshoff, D. Whitby, S. Matthews, R. A. Weiss, and S. J. Talbot. 1997. Identification of a major latent nuclear antigen, LNA-1, in the human herpesvirus 8 genome. J. Hum. Virol. 119-29. [PubMed]
35. Krithivas, A., D. B. Young, G. Liao, D. Greene, and S. D. Hayward. 2000. Human herpesvirus 8 LANA interacts with proteins of the mSin3 corepressor complex and negatively regulates Epstein-Barr virus gene expression in dually infected PEL cells. J. Virol. 749637-9645. [PMC free article] [PubMed]
36. Lan, K., D. A. Kuppers, and E. S. Robertson. 2005. Kaposi's sarcoma-associated herpesvirus reactivation is regulated by interaction of latency-associated nuclear antigen with recombination signal sequence-binding protein Jκ, the major downstream effector of the Notch signaling pathway. J. Virol. 793468-3478. [PMC free article] [PubMed]
37. Lan, K., S. C. Verma, M. Murakami, B. Bajaj, R. Kaul, and E. S. Robertson. 2007. Kaposi's sarcoma herpesvirus-encoded latency-associated nuclear antigen stabilizes intracellular activated Notch by targeting the Sel10 protein. Proc. Natl. Acad. Sci. USA 10416287-16292. [PubMed]
38. Laurent, C., F. Meggetto, and P. Brousset. 2008. Human herpesvirus 8 infections in patients with immunodeficiencies. Hum. Pathol. 39983-993. [PubMed]
39. Li, F., and D. C. Altieri. 1999. Transcriptional analysis of human survivin gene expression. Biochem. J. 344(Pt. 2)305-311. [PubMed]
40. Li, F., G. Ambrosini, E. Y. Chu, J. Plescia, S. Tognin, P. C. Marchisio, and D. C. Altieri. 1998. Control of apoptosis and mitotic spindle checkpoint by survivin. Nature 396580-584. [PubMed]
41. Li, L., S. He, J. M. Sun, and J. R. Davie. 2004. Gene regulation by Sp1 and Sp3. Biochem. Cell Biol. 82460-471. [PubMed]
42. Lim, C., Y. Gwack, S. Hwang, S. Kim, and J. Choe. 2001. The transcriptional activity of cAMP response element-binding protein-binding protein is modulated by the latency associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus. J. Biol. Chem. 27631016-31022. [PubMed]
43. Lim, C., H. Sohn, Y. Gwack, and J. Choe. 2000. Latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus (human herpesvirus-8) binds ATF4/CREB2 and inhibits its transcriptional activation activity. J. Gen. Virol. 812645-2652. [PubMed]
44. Liston, P., W. G. Fong, and R. G. Korneluk. 2003. The inhibitors of apoptosis: there is more to life than Bcl2. Oncogene 228568-8580. [PubMed]
45. Mirza, A., M. McGuirk, T. N. Hockenberry, Q. Wu, H. Ashar, S. Black, S. F. Wen, L. Wang, P. Kirschmeier, W. R. Bishop, L. L. Nielsen, C. B. Pickett, and S. Liu. 2002. Human survivin is negatively regulated by wild-type p53 and participates in p53-dependent apoptotic pathway. Oncogene 212613-2622. [PubMed]
46. Moore, P. S., and Y. Chang. 1995. Detection of herpesvirus-like DNA sequences in Kaposi's sarcoma in patients with and without HIV infection. N. Engl. J. Med. 3321181-1185. [PubMed]
47. Murakami, Y., S. Yamagoe, K. Noguchi, Y. Takebe, N. Takahashi, Y. Uehara, and H. Fukazawa. 2006. Ets-1-dependent expression of vascular endothelial growth factor receptors is activated by latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus through interaction with Daxx. J. Biol. Chem. 28128113-28121. [PubMed]
48. Muromoto, R., K. Okabe, M. Fujimuro, K. Sugiyama, H. Yokosawa, T. Seya, and T. Matsuda. 2006. Physical and functional interactions between STAT3 and Kaposi's sarcoma-associated herpesvirus-encoded LANA. FEBS Lett. 58093-98. [PubMed]
49. Pang, R. T., L. T. Lee, S. S. Ng, W. H. Yung, and B. K. Chow. 2004. CpG methylation and transcription factors Sp1 and Sp3 regulate the expression of the human secretin receptor gene. Mol. Endocrinol. 18471-483. [PubMed]
50. Radkov, S. A., P. Kellam, and C. Boshoff. 2000. The latent nuclear antigen of Kaposi sarcoma-associated herpesvirus targets the retinoblastoma-E2F pathway and with the oncogene Hras transforms primary rat cells. Nat. Med. 61121-1127. [PubMed]
51. Rainbow, L., G. M. Platt, G. R. Simpson, R. Sarid, S. J. Gao, H. Stoiber, C. S. Herrington, P. S. Moore, and T. F. Schulz. 1997. The 222- to 234-kilodalton latent nuclear protein (LNA) of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) is encoded by orf73 and is a component of the latency-associated nuclear antigen. J. Virol. 715915-5921. [PMC free article] [PubMed]
52. Raj, D., T. Liu, G. Samadashwily, F. Li, and D. Grossman. 2008. Survivin repression by p53, Rb and E2F2 in normal human melanocytes. Carcinogenesis 29194-201. [PMC free article] [PubMed]
53. Renne, R., C. Barry, D. Dittmer, N. Compitello, P. O. Brown, and D. Ganem. 2001. Modulation of cellular and viral gene expression by the latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus. J. Virol. 75458-468. [PMC free article] [PubMed]
54. Safe, S., and M. Abdelrahim. 2005. Sp transcription factor family and its role in cancer. Eur. J. Cancer 412438-2448. [PubMed]
55. Salvesen, G. S., and C. S. Duckett. 2002. IAP proteins: blocking the road to death's door. Nat. Rev. Mol. Cell Biol. 3401-410. [PubMed]
56. Shamay, M., A. Krithivas, J. Zhang, and S. D. Hayward. 2006. Recruitment of the de novo DNA methyltransferase Dnmt3a by Kaposi's sarcoma-associated herpesvirus LANA. Proc. Natl. Acad. Sci. USA 10314554-14559. [PubMed]
57. Si, H., and E. S. Robertson. 2006. Kaposi's sarcoma-associated herpesvirus-encoded latency-associated nuclear antigen induces chromosomal instability through inhibition of p53 function. J. Virol. 80697-709. [PMC free article] [PubMed]
58. Srinivasula, S. M., and J. D. Ashwell. 2008. IAPs: what's in a name? Mol. Cell 30123-135. [PMC free article] [PubMed]
59. Suske, G. 1999. The Sp-family of transcription factors. Gene 238291-300. [PubMed]
60. Tamm, I., Y. Wang, E. Sausville, D. A. Scudiero, N. Vigna, T. Oltersdorf, and J. C. Reed. 1998. IAP-family protein survivin inhibits caspase activity and apoptosis induced by Fas (CD95), Bax, caspases, and anticancer drugs. Cancer Res. 585315-5320. [PubMed]
61. Tang, J., G. M. Gordon, M. G. Muller, M. Dahiya, and K. E. Foreman. 2003. Kaposi's sarcoma-associated herpesvirus latency-associated nuclear antigen induces expression of the helix-loop-helix protein Id-1 in human endothelial cells. J. Virol. 775975-5984. [PMC free article] [PubMed]
62. Uren, A. G., L. Wong, M. Pakusch, K. J. Fowler, F. J. Burrows, D. L. Vaux, and K. H. Choo. 2000. Survivin and the inner centromere protein INCENP show similar cell-cycle localization and gene knockout phenotype. Curr. Biol. 101319-1328. [PubMed]
63. Verma, S. C., S. Borah, and E. S. Robertson. 2004. Latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus up-regulates transcription of human telomerase reverse transcriptase promoter through interaction with transcription factor Sp1. J. Virol. 7810348-10359. [PMC free article] [PubMed]
64. Verma, S. C., and E. S. Robertson. 2003. ORF73 of herpesvirus Saimiri strain C488 tethers the viral genome to metaphase chromosomes and binds to cis-acting DNA sequences in the terminal repeats. J. Virol. 7712494-12506. [PMC free article] [PubMed]
65. Wang, H. W., T. V. Sharp, A. Koumi, G. Koentges, and C. Boshoff. 2002. Characterization of an anti-apoptotic glycoprotein encoded by Kaposi's sarcoma-associated herpesvirus which resembles a spliced variant of human survivin. EMBO J. 212602-2615. [PubMed]
66. Wang, H. W., M. W. Trotter, D. Lagos, D. Bourboulia, S. Henderson, T. Makinen, S. Elliman, A. M. Flanagan, K. Alitalo, and C. Boshoff. 2004. Kaposi sarcoma herpesvirus-induced cellular reprogramming contributes to the lymphatic endothelial gene expression in Kaposi sarcoma. Nat. Genet. 36687-693. [PubMed]
67. Watanabe, T., M. Sugaya, A. M. Atkins, E. A. Aquilino, A. Yang, D. L. Borris, J. Brady, and A. Blauvelt. 2003. Kaposi's sarcoma-associated herpesvirus latency-associated nuclear antigen prolongs the life span of primary human umbilical vein endothelial cells. J. Virol. 776188-6196. [PMC free article] [PubMed]
68. Wooten, L. G., and B. Ogretmen. 2005. Sp1/Sp3-dependent regulation of human telomerase reverse transcriptase promoter activity by the bioactive sphingolipid ceramide. J. Biol. Chem. 28028867-28876. [PubMed]
69. Wu, J., X. Ling, D. Pan, P. Apontes, L. Song, P. Liang, D. C. Altieri, T. Beerman, and F. Li. 2005. Molecular mechanism of inhibition of survivin transcription by the GC-rich sequence-selective DNA binding antitumor agent, hedamycin: evidence of survivin down-regulation associated with drug sensitivity. J. Biol. Chem. 2809745-9751. [PMC free article] [PubMed]
Articles from Journal of Virology are provided here courtesy of
American Society for Microbiology (ASM)