PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Immunol. Author manuscript; available in PMC 2010 May 1.
Published in final edited form as:
PMCID: PMC2703443
NIHMSID: NIHMS96932

LTβR Signaling Induces Cytokine Expression and Up-Regulates Lymphangiogenic Factors in Lymph Node Anlagen1

Abstract

The formation of lymph nodes is a complex process crucially controlled through triggering of LTβR on mesenchymal cells by LTα1β2 expressing lymphoid tissue inducer (LTi) cells. This leads to the induction of chemokines to attract more hematopoietic cells and adhesion molecules to retain them. In this study, we show that the extravasation of the first hematopoietic cells at future lymph node locations occurs independently of LTα and that these cells, expressing TNF-related activation-induced cytokine (TRANCE), are the earliest LTi cells. By paracrine signaling the first expression of LTα1β2 is induced. Subsequent LTβR triggering on mesenchymal cells leads to their differentiation to stromal organizers, which now also start to express TRANCE, IL-7, as well as VEGF-C, in addition to the induced adhesion molecules and chemokines. Both TRANCE and IL-7 will further induce the expression of LTα1β2 on newly arrived immature LTi cells, resulting in more LTβR triggering, generating a positive feedback loop. Thus, LTβR triggering by LTi cells during lymph node development creates a local environment to which hematopoietic precursors are attracted and where they locally differentiate into fully mature, LTα1β2 expressing, LTi cells. Furthermore, the same signals may regulate lymphangiogenesis to the lymph node through induction of VEGF-C.

The development of lymph nodes (LNs)3 depends on the crosstalk between hematopoietic cells and mesenchymal stromal cells (1-6), whereby the inductive signal for lymph node development comes from CD4+IL-7R+CD3 CD45+RORγt+ hematopoietic cells. These lymphoid tissue inducer (LTi) cells express lymphotoxin-α1β2 (LTα1β2) and are thought to trigger lymphotoxin β receptor (LTβR) expressed on stromal cells (2, 7, 8). The importance of the LTβR signaling lies in the induction of adhesion molecules and production of chemokines that start a set of events leading to the formation of the lymph node. Initially, LTβR ligation leads to activation of the classical NF-κB pathway, which results in the expression of proinflammatory molecules such as the chemokines MIP1β, MIP-2, and the adhesion molecule VCAM-1. Prolonged triggering results in the activation of the alternative NF-κB pathway and the generation of p52, involved in the transcription of the lymphoid chemokines such as CCL21, CCL19, and CXCL13 (9, 10). These chemokines in particular are crucial for the development of the lymph node (2, 11-15).

The expression of LTα1β2 itself can equally well be induced by signaling through the IL-7R as well as the TNF-related activation-induced cytokine-receptor (TRANCE-R; also known as Rank, Tnfrsf11a, ODFR, or Ly109) upon binding of the respective ligands, IL-7 or TRANCE (3). For lymph node development, it was shown that signaling through both receptors is critical, while during Peyer's patch formation only IL-7R triggering is mandatory (2, 3, 5, 15-17). Although TRANCE has been reported to be expressed by LTi as well as stromal organizer cells in developing lymph nodes, IL-7 was shown to be expressed in stromal organizer cells of developing Peyer's patches (8, 18, 19). The importance of limited IL-7R triggering for lymphoid organ development can be deduced from experiments in which transgenic overexpression of IL-7 resulted in an increased number of LTi cells, leading to a 5-fold increase in the number of Peyer's patches and the formation of ectopic lymphoid structures (20). In contrast, transgenic overexpression of TRANCE did not affect the number of LTi cells on a wild-type (WT) background, while it was able to rescue the reduced number of LTi cells in developing lymph nodes of TRANCE−/− mice (18). It is unclear how expression of TRANCE and IL-7 is regulated during lymph node development, although analysis of the TRANCE promoter region revealed response elements for vitamin D3 and glucocorticoids (21, 22), as well as binding sites for Runx2 and NF-κB (23), while LTβR signaling has been proposed to result in enhanced IL-7 production (20). However, it has been reported that initial clustering of LTi cells can occur in LTα−/− mice, and therefore other mechanisms precede the crucial triggering of LTβR on stromal organizer cells (24, 25).

In this study, we show that the expression of TRANCE on LTi cells is unaffected in LN anlagen from LTα−/− mice, but that LTα1β2-mediated LTβR signaling is essential for the expression of TRANCE on stromal cells. The earliest phase of LN development is marked by the clustering of LTi cells, which occurs independent of LTα1β2-LTβR, followed by the LTα1β2-mediated differentiation of stromal cells. The LTα1β2-induced differentiation of stromal cells leads to the up-regulation of VCAM-1, mucosal addressin cell adhesion molecule-1 (MAdCAM-1), and ICAM-1, as well as to the induction of TRANCE and IL-7 expression, which will contribute to enhanced expression of LTα1β2 on LTi cells. Furthermore, LTβR triggering on mesenchymal cells by LTi cells results in the production of VEGF-C, which points to an additional role of LTi cells in the regulation of lymphangiogenesis to the developing lymph nodes.

Materials and Methods

Animals

C57BL/6 mice were purchased from Harlan Sprague Dawley, lymphotoxin α (LTα)−/− mice on the C57BL/6 background were purchased from Charles River Laboratories. Both mouse strains were bred in our in house facilities and kept under routine laboratory conditions. The Animal Experiments Committee of the VU (Vrije Universiteit) University Medical Center approved all of the experiments described in this study.

Timed pregnancies

Mice were mated overnight, and the day of vaginal-plug detection was marked as E0.5. Pregnant females were sacrificed at different time points, and embryos were harvested and stored in OCT embedding medium (Sakura Finetek Europe).

Immunofluorescence

Seven-μm cryosections were fixed in dehydrated acetone for 2 min and air-dried for an additional 15 min. Endogenous avidin was blocked with an avidin-biotin block (Vector Laboratories). Sections were then preincubated in PBS supplemented with 5% (v/v) mouse serum for 10 min. Incubation with primary Ab for 45 min was followed by a 30 min incubation with Fluor-Alexa-labeled conjugate (Invitrogen Life Technologies) when needed. All incubations were conducted at room temperature. Sections were counter stained with Hoechst 33342 (Invitrogen Life Technologies) for 10 min. For detection of LN anlagen, visible as clusters of LTi cells and their precursors, serial sections of embryos were collected and every twentieth section was stained for CD4 (expressed by LTi cells), IL-7R (expressed by LTi cells and their precursors), and CD45 (expressed by all hematopoietic cells) as described (26). Stainings were analyzed on a Leica TCS-SP2-AOBS Confocal Laser Scanning Microscope (Leica Microsystems) and images were obtained with Leica confocal software. Image processing involved contrast enhancement and region of interest selection, which was conducted with Jasc Paintshop Pro 7.0 (Jasc Software). Lenses used were dry lenses: 20× (HC PL APO CS 0.7), 40× (HCX PLAN APO 0.85).

Antibodies

For immunofluorescence, the following Abs were used: GK1.5 (anti-CD4), MECA-367 (MAdCAM-1), MP33 (anti-CD45), and anti-ICAM-1. All the Abs were affinity purified from hybridoma cell culture supernatants with protein G-Sepharose (Pharmacia) and biotinylated or labeled with Alexa-Fluor 488, Alexa-Fluor 546, or Alexa-Fluor 633 (Invitrogen Life Technologies). 429 (anti-VCAM-1; BD Biosciences), IK22/5 (anti-TRANCE; eBioscience), A7R34 (anti-IL-7R; eBioscience), 4H8WH2 (anti-LTβR; produced in Carl Ware's laboratory), HM0104 (anti-TNF-R1; Alexis Biochemicals), Avas12a1 (anti-VEGFr2; eBioscience), MECA-32 (pan-endothelial-cell marker; BD Biosciences), anti-Lyve-1 pAb (Millipore), 11D4.1 (anti- VE-cadherin; BD Biosciences), and anti-VEGFr1 pAb (anti-Flt1; Neomarkers) were used as biotinylated or as unconjugated primary Abs. 429, IK22/5, A7R34, Avas12a1, MECA-32, anti-Lyve-1 pAb, 11D4.1, and anti-VEGFr1 pAb were visualized with Alexa-Fluor 488, Alexa-Fluor 546, or Alexa-Fluor 633 conjugated streptavidin, anti-rat IgG or anti-rabbit IgG as appropriate. 4H8-WH2 and HM0104 were visualized with biotinylated anti-rat IgG, followed by signal amplification using a TSA Kit with HRP-streptavidin and Alexa Fluor 546 tyramide (Invitrogen Life Technologies). To assure specificity of the used Abs, conjugate-alone controls as well as control serum (rat or rabbit) as replacement of the primary incubation were used.

Mouse embryonic fibroblasts (MEFs) cell culture

MEFs from WT and LTβR−/− mice were established as described previously (27). Cultures were maintained in DMEM containing 10% FCS, 100 U/ml penicillin, and 100 μg/ml streptomycin. Stimulation of cells was performed by incubation with a mixture of two different agonistic anti-LTβR mAb (4H8-WH2 and 3C8 in a 9 to 1 proportion, with a total concentration of 2 μg/ml) or with 4H8-WH2 alone at 2 μg/ml or with isotype controls (Rat IgG2a and Rat IgG1, in the same proportion and concentration, BD Pharmingen). MEFs were stimulated for 2−30 h. ICAM-1, VCAM-1, and TRANCE induction on MEFs following LTβR stimulation was evaluated by flow cytometry at 24 h, using biotin-conjugated anti-ICAM-1 (eBioscience), FITC conjugated anti-VCAM-1 (eBioscience), and PE-conjugated anti-TRANCE mAb (eBioscience). Flow cytometric analysis was performed on a Cyan Advanced Digital Processing High-Performance Research flow cytometer (Beckman Coulter).

LTα/ rudimentary mesenteric LN (rMLN) cell culture

Embryos from LTα−/− mice were used to dissect total E18.5 rMLN anlagen. Cell suspensions were prepared by digesting isolated rMLN anlagen with 0.5 mg/ml collagenase type IV (Sigma-Aldrich) in PBS, 2% NBCS for 20 min at 37°C while stirring continuously. Cell suspensions were cultured in DMEM (Invitrogen Life Technologies), supplemented with 10% heat-inactivated FCS, 2 mM l-glutamine, 1 mM sodium pyruvate, 100 U/ml penicillin, and 100 μg/ml streptomycin. Before stimulation, cells were allowed to adhere overnight at standard culture conditions to form a confluent layer of cells. For LTβR stimulation, cell suspensions were stimulated for 8 h with 4H8-WH2 (agonistic anti-LTβR Ab) (9, 28-30) at 2.68 μg/ml, while control samples were nonstimulated.

Quantitative real-time PCR

RNA was extracted from cultured MLN cell suspensions and MEFs using TRIzol (Invitrogen Life Technologies), and reverse transcribed with oligo(dT)12−18 (Invitrogen Life Technologies) and random hexamer primers (Invitrogen Life Technologies) using standard protocols. Quantitative real-time PCR was performed on an ABI Prism 7900 Sequence Detection System (Applied Biosystems). The reaction mixture was composed of SYBR Green Mastermix (Applied Biosystems), 300 nM of each primer, and cDNA in a total volume of 20 μl, according to the manufacturer's instructions. Primers were designed across exon-intron boundaries using Primer Express software and guidelines (Applied Biosystems). The following sequences were used: 18S forward, TTGACGGAAGGGCACCACCAG, 18S reverse, GCACCACCACCCACGGAATCG; Hprt forward, CCTAAGAT GAGCGCAAGTTGAA, Hprt reverse, CCACAGGACTAGAACACCT GCTAA; GAPDH forward, GCATGGCCTTCCGTGTTC, GAPDH reverse, ATGTCATCATACTTGGCAGGTTTCT; Rps27a forward, AAGGTGGATGAAAATGGCAAA, Rps27a reverse, CCATGAAAA CTCCCAGCACCA; VCAM-1 forward, ACTACAAGTCTACATCTCT CCCAGGAAT, VCAM-1 reverse, CCTCGCTGGAACAGGTCATT; TRANCE forward, CCCATCGGGTTCCCATAAAG, TRANCE reverse, TAACCCTTAGTTTTCCGTTGCTTAA; IL-7 forward, ATCGTGCTG CTCGCAAGTT, IL-7 reverse, CACCAGTGTTTGTGTGCCTTGT; VEGF-C forward, GGTTACCTCAGCAAGACGTTGTTT, VEGF-C reverse, ATGCACCGGCAGGAAGTG.

From a set of eight housekeeping genes, the four most stable housekeeping genes were selected (18s, Hprt, GAPDH, and Rps27a) upon which a gene expression normalization factor for each tissue sample was calculated using geNorm 3.4 (http://medgen.ugent.be/~jvdesomp/genorm/) (31).

Statistics

Stimulated vs control cells from MLN anlagen were compared using an unpaired t test. Samples of MEFs were compared using a one-way ANOVA followed by a Tukey-Kramer multiple comparison test to allow comparison between different time points. p values of <0.05 were considered significant.

Results

Characterization of E14.5 LN anlagen

Because the very first events in LN development have not been fully characterized, we analyzed LN anlagen at different anatomical locations in E14.5 embryos for the presence of the various cellular subsets required for functional lymph nodes. In brachial LN anlage (Fig. 1A), axillary, iliac, and renal LN anlagen, LTi cells already form clusters, while a diffuse aggregation of LTi cells was observed in popliteal LN anlagen (supplementary Fig. 1).4 In mesenteric LN anlagen, few LTi cells were situated around a large blood vessel. Inguinal LN anlagen could not be identified at E14.5. A considerable number of LTi cells expressed TRANCE at levels that varied from low to high (Fig. 1C arrowhead; and supplementary Fig. 1). Because we have previously reported that stromal cells within neonatal lymph nodes also express TRANCE, we were surprised that stromal cells within E14.5 anlagen of brachial lymph nodes did not show any expression of TRANCE, while the stromal cells showed limited expression of VCAM-1 and ICAM-1 (Fig. 1B). At E14.5, most CD45+ clusters were encapsulated by Lyve-1+VEGFr2+ lymphatic endothelial cells and situated around a VEGFr2+MECA32+ blood vessel (Fig. 1F). In addition, in all LN anlagen, an additional larger blood vessel was found that consisted of VEGFr1+VEGFr2+MECA32−/low endothelial cells (data not shown). Combined expression of VEGFr1 and VEGFr2 was also observed on the aorta and not on the inferior vena cava at E14.5, suggesting that the VEGFr1+VEGFr2+MECA32−/low endothelial cells present within the lymph nodes represent an arterial blood vessel (supplementary Fig. 2). These VEGFr2+MECA32low blood vessels also showed high expression of LTβR, while stromal cells of axillary (ALN) and brachial (BLN) anlagen expressed LTβR at an intermediate level (Fig. 1D). In addition, TNF-R1+ cells could be found in E14.5 LN anlagen and these cells were in close association with CD4+ cells (Fig. 1E).

FIGURE 1
E14.5 WT BLN anlage characterization. A, CD4+IL-7R+CD45int and few immature CD4IL-7R+CD45int LTi cells are present in the E14.5 anlage (CD4 in green, IL-7R in red, and CD45 in blue). B, VCAM-1 expression (red) on stromal cells is limited at this ...

TRANCE expression in the first phase of LN development is LTα1β2-LTβR independent

Because it has been reported that the earliest events in LN development occur independently of LTβR signaling (24, 25), we investigated whether the early clusters of LTi cells could indeed be found in E14.5 LTα−/− embryos. In both WT and LTα−/− embryos, LN anlagen contained clusters of LTi cells, of similar size (Fig. 2, A and B). However, a clear dissimilarity was seen when the expression of TRANCE was analyzed, because in WT mice, the first TRANCE-expressing stromal cells could already be observed within restricted areas of some LNs, in addition to the TRANCE expressing CD45+ cells, while in LTα−/− LNs, TRANCE expression was exclusively detected on CD45+ cells, and not on stromal cells (Fig. 2, C and D). Of interest is that within WT LN anlagen TRANCE-expressing stromal cells are only present within areas where CD45+ cells are clustered closely together, while absent at the location where the CD45+ cells are more dispersed (Fig. 2C). Because stromal cell expression of TRANCE was completely absent in E14.5 LN anlagen of LTα−/− embryos, these data suggest that TRANCE expression on stromal organizer cells depends on LTβR triggering, and that this occurs earliest at the site where LTi cells are closely together.

FIGURE 2
TRANCE expression in E14.5 WT Axillary LN and LTα−/− rALN anlagen. A and B, ALN anlagen are found as clusters of hematopoietic cells in both WT and LTα−/− at E14.5 (CD4 in green, IL-7R in red, and CD45 in ...

LTα/ LN anlagen at E16.5 lack stromal cell organizers and hematopoietic cells

To further dissect the role of LTβR signaling for stromal cell differentiation, we analyzed E16.5 LN anlagen because at this time point stromal cells are clearly expressing all differentiation molecules such as VCAM-1 and TRANCE (8). When WT and LTα−/− anlagen were compared clear differences between WT and LTα−/− embryos could now be observed in developing lymph nodes. At E16.5, large clusters of LTi cells were found in WT LN anlagen (Fig. 3A), whereas in most LTα−/− LN anlagen studied only diffusely distributed LTi cells were found, with occasional small clusters of LTi cells (Fig. 3B). These data thus indicate that the clusters of LTi cells observed in E14.5 LTα−/− embryos had greatly disappeared in the following 2 days of development. The remaining LTi cells in LTα−/− LN anlagen were always located in proximity of VEGFr1+VEGFr2+Meca32low-expressing vessels, indicative of proper positioning relative to the major blood vessel that is central to developing lymph nodes (Fig. 3, B and J). However, an intimate clustering as seen in WT lymph nodes was never detected in LTα−/− LN anlagen, where stromal cells failed to express VCAM-1, ICAM-1, and MAdCAM-1 (Fig. 3, C–H). As expected from our observations at E14.5, TRANCE expression on stromal cells was completely absent in LTα−/− PLN and MLN anlagen, further supporting the idea that TRANCE expression is controlled by LTβR signaling (Fig. 3, E and F and data not shown). The capsule of Lyve-1+ expressing lymphatic endothelial cells (LECs) around the LN anlage, which forms a continuous layer in WT mice, appeared to form distinct lymph vessels around the LN anlagen in LTα−/− mice (Fig. 3, G and H).

FIGURE 3
Altered morphology of E16.5 LTα−/− BLN anlagen and lack of TRANCE expression on stromal cells. A, Clustered LTi cells are found in WT (A) BLN anlagen but not in LTα−/− (B) BLN anlagen (CD4 in green, IL-7R ...

Although clear phenotypic differences could be found for LN development in WT vs LTα−/− embryos with respect to clusters of LTi cells and lack of LN stromal cells and LECs, the development of larger blood vessels within the designated area of LN formation remained unchanged in LTα−/− LN anlagen. In fact, the characteristic combination of VEGFr2+MECA32+ vessels, which are always in close proximity to a vessel expressing VEGFr1 and VEGFr2, while lacking MECA32, allowed us to identify the LN regions within the LTα−/− embryos (Fig. 3, I and J).

LTβR triggering induces IL-7 and TRANCE in stromal cells

To prove that indeed signaling via the LTβR pathway directly controls TRANCE expression in stromal cells of the LN anlagen, in vitro experiments were performed. Cell suspensions from E18.5 LTα−/− rudimentary MLN anlagen were prepared, because these structures contain mesenchymal cells that have never encountered LTα1β2 expressing cells, which mediates their differentiation toward VCAM-1+ICAM-1+ stromal organizer cells. Incubation for 8 h with an agonistic anti-LTβR Ab resulted in the expected increase of VCAM-1 measured by real time PCR, which served as a positive control for proper activation of the stromal cells (Fig. 4A) (9). Further analysis showed that indeed LTβR triggering resulted in the induction of TRANCE expression (Fig. 4A). To further confirm that LTβR can mediate the induction of TRANCE, MEFs were obtained from WT mice, representing early mesenchymal subpopulations. When incubated with the agonistic anti-LTβR Ab WT MEFs showed significant increase of TRANCE expression at 6 and 24 h of stimulation (Fig. 4B). A similar pattern of induction was seen for VCAM-1, as has been reported before (Fig. 4B) (9). Analysis of protein expression by FACS showed that indeed TRANCE, as well as VCAM-1, and ICAM-1 expression were induced on MEFs after 24 h of stimulation with agonistic anti-LTβR Ab (Fig. 4C).

FIGURE 4
LTβR triggering results in TRANCE up-regulation (A). Stimulation of LTβR with agonistic anti LTβR mAb for 8 h in LTα−/− E18.5 rudimentary MLN cell cultures results in a significant increase in TRANCE mRNA ...

The differentiation of mesenchymal cells toward stromal organizer cells creates a positive feedback loop through which incoming precursor cells are able to differentiate into true LTi cells, because TRANCE has been described to induce LTα1β2 expression on LTi cells (3). Another molecule that can mediate differentiation of precursors to fully mature LTi cells is the cytokine IL-7, which can also induce LTα1β2 expression on LTi cells. Therefore, LTβR-stimulated MEFs were analyzed for the expression of IL-7, which was indeed induced upon LTβR triggering in WT, but not in LTβR−/− MEFs (Fig. 5A). This suggests that LTβR triggering within lymph node anlagen results in differentiation of mesenchymal cells to functional stromal organizers cells, which are now able to induce the expression of LTα1β2 on newly arriving precursors to LTi cells.

FIGURE 5
LTβR triggering leads to induction of IL-7 and VEGF-C. Treatment of cultured WT MEFs with agonistic LTβR mAb, but not with an isotype matched control mAb, results in the up-regulation of IL-7 (A) and VEGF-C (B) mRNA expression. MEFs were ...

To see whether continued LTβR triggering resulted in a further increase of TRANCE expression of stromal organizer cells, later stages of LN development were analyzed. Indeed, at E18.5 and at 1 day after birth lymph node stromal cells, characterized by expression of VCAM-1 and ICAM-1, showed high levels of TRANCE expression, confirming our earlier observations (supplementary Fig. 3) (8).

LTβR triggering up-regulates lymphangiogenic factors in LN

Because we also observed alterations in lymphatic vessel formation in LTα−/− vs WT and LTβR signaling has been implicated to be involved in lymphangiogenesis in inflamed areas (32), we further addressed whether lymphangiogenic factors were also induced by LTβR signaling. A strong up-regulation of VEGF-C by LTβR triggering was seen in MEF cultures (Fig. 5B). Up-regulation was first seen after 6 h of LTβR triggering and was still visible after 24 h of stimulation. LTβR−/− MEFs did not show increased expression of VEGF-C, which proved the specificity of the observed VEGF-C induction by LTβR triggering. We could not find a significant increase of VEGF-D expression in cultured MEFs upon LTβR triggering (data not shown).

Discussion

In this study, we show that during murine lymph node development the earliest clustering of LTi cells occurs independently of LTα and that the first TRANCE expressing stromal cells appear in LN anlagen from WT, and not LTα−/−, mice in areas where CD45+ cells are closely clustered together. The interaction among the hematopoietic cells may lead to paracrine triggering, resulting in the first LTα1β2 expressing cells. These cells are now able to trigger the surrounding stromal cells, which subsequently up-regulate TRANCE, IL-7, and VEGF-C, in addition to adhesion molecules and chemokines. The induced molecules will bring about further attraction and retention of more LTα1β2 negative pre-LTi cells, and induction of LTα1β2 expression on these pre-LTi cells, leading to further triggering of mesenchymal cells.

The earliest expression of TRANCE can be detected on LTi cells that arrive at the location of future LN development. This expression is independent of LTα1β2-mediated LTβR signaling because in both WT and LTα−/− mice LTi cells express TRANCE. It is very well likely that the paracrine triggering of the first pre-LTi cells that leads to the expression of LTα1β2 is mediated through TRANCE and its receptor, as it has been shown that LTα1β2 up-regulation can be accomplished by TRANCE-R signaling. Both TRANCE-R and TRANCE are expressed by the hematopoietic cells within the LN anlage (this study; Ref. 3, 18) and can thus account for the induction of the first LTα1β2 expressing cells.

How these first hematopoietic cells are attracted to the designated locations is still an open question. Local expression of chemokines at designated sites of LN development might attract these “first wave” LTi cells, similar to the accumulation of LTi cells after ectopic expression of CXCL13 (15). It is however unclear at this point which factors may induce the expression of these chemokines.

After LTβR triggering, stromal cells begin to express adhesion molecules and chemokines (9). These molecules are required to retain the “first wave” LTi cells, but are also involved in the attraction of additional hematopoietic cells, containing precursor (LTα1β2 negative) LTi cells that arrive in a “second wave”. These cells will also be retained within the LN anlage, due to the adhesion molecules that are now being expressed by the stromal organizer cells. Retention of the earliest hematopoietic cells is not successful in the LTα−/− mice, in which LN anlagen are devoid of hematopoietic clusters in E16.5 embryos. The mature stromal organizer cells in E16.5 WT embryos will allow local differentiation into mature LTα1β2 expressing LTi cells. Induction of LTα1β2 on these cells can be mediated by either TRANCE or IL-7, because both factors are expressed by stromal cells upon LTβR triggering. This results in a rapid increase of mature LTα1β2-expressing LTi cells that will further contribute to the LTβR signaling. In addition, it was recently shown that LTβR triggering is mandatory for stromal cell proliferation and survival during the development of inguinal lymph nodes (25).

Of interest is our observation that stromal cells in developing lymph nodes (E17.5) express TRANCE, while this expression is not detectable in developing Peyer's patches at the same time (supplementary Fig. 4). At this point in development, stromal organizers within Peyer's patches express VCAM-1 and ICAM-1 in an LTβR-dependent manner (2). However, after the animals are born stromal cells within sub-epithelial dome of the Peyer's patches start to express TRANCE (supplementary Fig. 4). This agrees with the reported expression of TRANCE on stromal cells within the subepithial dome area of the Peyer's patches, intestinal isolated lymphoid follicles and cryptopatches from adult mice (33). In these studies it was shown that TRANCE expression in the intestine was independent of LTβR triggering, suggesting that TRANCE expression is controlled differentially during LN formation vs intestinal lymphoid structures in adult mice. The restricted expression of TRANCE in developing lymph nodes, and not Peyer's patches, matches with the fact that TRANCE expression is mandatory for LN formation, while it is redundant for Peyer's patch development (18).

A crucial role of LTβR signaling in the maintenance of functional high endothelial venules has been shown, highlighting the importance of this signaling route for blood vessel differentiation within lymph nodes (34). We show in this study that LTβR triggering results in increased expression of VEGF-C, further adding to the mechanism of how LTβR triggering results in LN formation. In this way, LTi cells can also contribute to lymphangiogenesis in developing lymph nodes. Remodeling of lymph vessels also occurs in adult LNs as a result of immunization. This process might also be regulated by LTα1β2 because lymphangiogenesis in inflamed LNs was shown to involve B cells that can also express LTα1β2, and lymphangiogenesis in inflamed thyroid glands was shown to depend on LTβR signaling (32, 35, 36).

In sum, our experiments show that the first phase of LN development occurs similarly in WT and LTα−/− mice, and that subsequent LTβR triggering leads to the induction of TRANCE and IL-7, which can further enhance LTα1β2 expression. In addition, LTβR triggering can also lead to the production of the lymphangiogenic factor VEGF-C. As a consequence, these LN stromal organizers may control attraction, retention, as well as lymphangiogenesis to the developing lymph nodes.

Supplementary Material

Supplemental Data

Footnotes

1This work was supported by a VICI Grant (918.56.612) to R.E.M and a Genomics Grant (050−10−120) to M.V. from the Netherlands Organization for Scientific Research.

3Abbreviations used in this paper: LN, lymph node; LTi, lymphoid tissue inducer; LTα1β2, lymphotoxin-α1β2; LTβR, lymphotoxin β receptor; WT, wild type; MAdCAM-1, anti-mucosal addressin cell adhesion molecule-1; LTα, lymphotoxin α; MEF, mouse embryonic fibroblasts; rMLN, rudimentary mesenteric LN; ALN, axillary LN; BLN, brachial LN; LEC, lymphatic endothelial cell; TRANCE, TNF-related activation-induced cytokine.

4The online version of this article contains supplemental material.

Disclosures

The authors have no financial conflict of interest.

References

1. Adachi S, Yoshida H, Kataoka H, Nishikawa S. Three distinctive steps in Peyer's patch formation of murine embryo. Int. Immunol. 1997;9:507–514. [PubMed]
2. Honda K, Nakano H, Yoshida H, Nishikawa S, Rennert P, Ikuta K, Tamechika M, Yamaguchi K, Fukumoto T, Chiba T, Nishikawa SI. Molecular basis for hematopoietic/mesenchymal interaction during initiation of Peyer's patch organogenesis. J. Exp. Med. 2001;193:621–630. [PMC free article] [PubMed]
3. Yoshida H, Naito A, Inoue J, Satoh M, Santee-Cooper SM, Ware CF, Togawa A, Nishikawa S, Nishikawa S. Different cytokines induce surface lymphotoxin-αβ on IL-7 receptor-α cells that differentially engender lymph nodes and Peyer's patches. Immunity. 2002;17:823–833. [PubMed]
4. Adachi S, Yoshida H, Honda K, Maki K, Saijo K, Ikuta K, Saito T, Nishikawa SI. Essential role of IL-7 receptor α in the formation of Peyer's patch anlage. Int. Immunol. 1998;10:1–6. [PubMed]
5. Yoshida H, Honda K, Shinkura R, Adachi S, Nishikawa S, Maki K, Ikuta K, Nishikawa SI. IL-7 receptor α+ CD3 cells in the embryonic intestine induces the organizing center of Peyer's patches. t. Immunol. 1999;11:643–655. [PubMed]
6. Finke D, Acha-Orbea H, Mattis A, Lipp M, Kraehenbuhl J. CD4+CD3 cells induce Peyer's patch development: role of α4β1 integrin activation by CXCR. Immunity. 2002;17:363–373. [PubMed]
7. Mebius RE, Rennert P, Weissman IL. Developing lymph nodes collect CD4+CD3 LTβ+ cells that can differentiate to APC, NK cells, and follicular cells but not T or B cells. Immunity. 1997;7:493–504. [PubMed]
8. Cupedo T, Vondenhoff MF, Heeregrave EJ, De Weerd AE, Jansen W, Jackson DG, Kraal G, Mebius RE. Presumptive lymph node organizers are differentially represented in developing mesenteric and peripheral nodes. J. Immunol. 2004;173:2968–2975. [PubMed]
9. Dejardin E, Droin NM, Delhase M, Haas E, Cao Y, Makris C, Li ZW, Karin M, Ware CF, Green DR. The lymphotoxin-β receptor induces different patterns of gene expression via two NF-κB pathways. Immnity. 2002;17:525–35. [PubMed]
10. Muller JR, Siebenlist U. Lymphotoxin α receptor induces sequential activation of distinct NF-κB factors via separate signaling pathways. J. Biol. Chem. 2003;278:12006–12012. [PubMed]
11. Rennert PD, James D, Mackay F, Browning JL, Hochman PS. Lymph node genesis is induced by signaling through the lymphotoxin β receptor. Immunity. 1998;9:71–79. [PubMed]
12. Cupedo T, Lund FE, Ngo VN, Randall TD, Jansen W, Greuter MJ, de Waal-Malefyt R, Kraal G, Cyster JG, Mebius RE. Initiation of cellular organization in lymph nodes is regulated by non-B cell-derived signals and is not dependent on CXC chemokine ligand 13. J. Immunol. 2004;173:4889–4896. [PubMed]
13. Ohl L, Henning G, Krautwald S, Lipp M, Hardtke S, Bernhardt G, Pabst O, Forster R. Cooperating mechanisms of CXCR5 and CCR7 in development and organization of secondary lymphoid organs. J. Exp. Med. 2003;197:1199–1204. [PMC free article] [PubMed]
14. Ansel KM, Ngo VN, Hyman PL, Luther SA, Forster R, Sedgwick JD, Browning JL, Lipp M, Cyster JG. A chemokine-driven positive feedback loop organizes lymphoid follicles. Nature. 2000;406:309–314. [PubMed]
15. Luther SA, Ansel KM, Cyster JG. Overlapping roles of CXCL13, interleukin 7 receptor α, and CCR7 ligands in lymph node development. J. Exp. Med. 2003;197:1191–1198. [PMC free article] [PubMed]
16. Naito A, Azuma S, Tanaka S, Miyazaki T, Takaki S, Takatsu K, Nakao K, Nakamura K, Katsuki M, Yamamoto T, Inoue J. Severe osteopetrosis, defective interleukin-1 signalling and lymph node organogenesis in TRAF6-deficient mice. Genes Cells. 1999;4:353–362. [PubMed]
17. Kong YY, Boyle WJ, Penninger JM. Osteoprotegerin ligand: a common link between osteoclastogenesis, lymph node formation and lymphocyte development. Immunol. Cell Biol. 1999;77:188–193. [PubMed]
18. Kim D, Mebius RE, MacMicking JD, Jung S, Cupedo T, Castellanos Y, Rho J, Wong BR, Josien R, Kim N, et al. Regulation of peripheral lymph node genesis by the tumor necrosis factor family member TRANCE. J. Exp. Med. 2000;192:1467–1478. [PMC free article] [PubMed]
19. Nishikawa S, Honda K, Vieira P, Yoshida H. Organogenesis of peripheral lymphoid organs. Immunol. Rev. 2003;195:72–80. [PubMed]
20. Meier D, Bornmann C, Chappaz S, Schmutz S, Otten LA, Ceredig R, Acha-Orbea H, Finke D. Ectopic lymphoid-organ development occurs through interleukin 7-mediated enhanced survival of lymphoid-tissue-inducer cells. Immunity. 2007;26:643–654. [PubMed]
21. Kitazawa S, Kajimoto K, Kondo T, Kitazawa R. Vitamin D3 supports osteoclastogenesis via functional vitamin D response element of human RANKL gene promoter. J. Cell Biochem. 2003;89:771–777. [PubMed]
22. Kodaira K, Kodaira K, Mizuno A, Yasuda H, Shima N, Murakami A, Ueda M, Higashio K. Cloning and characterization of the gene encoding mouse osteoclast differentiation factor. Gene. 1999;230:121–127. [PubMed]
23. Gao YH, Shinki T, Yuasa T, Kataoka-Enomoto H, Komori T, Suda T, Yamaguchi A. Potential role of cbfa1, an essential transcriptional factor for osteoblast differentiation, in osteoclastogenesis: regulation of mRNA expression of osteoclast differentiation factor (ODF). Biochem. Biophys. Res. Commun. 1998;252:697–702. [PubMed]
24. Eberl G, Marmon S, Sunshine MJ, Rennert PD, Choi Y, Littman DR. An essential function for the nuclear receptor RORγ(t) in the generation of fetal lymphoid tissue inducer cells. Nat. Immunol. 2004;5:64–73. [PubMed]
25. White A, Carragher D, Parnell S, Msaki A, Perkins N, Lane P, Jenkinson E, Anderson G, Caamano JH. Lymphotoxin a-dependent and -independent signals regulate stromal organizer cell homeostasis during lymph node organogenesis. Blood. 2007;110:1950–1959. [PubMed]
26. Vondenhoff MF, van de Pavert SA, Dillard ME, Greuter M, Goverse G, Oliver G, Mebius RE. Lymph sacs are not required for the initiation of lymph node formation. Development. 2009;136:29–34. [PMC free article] [PubMed]
27. Matsumoto M, Iwamasa K, Rennert PD, Yamada T, Suzuki R, Matsushima A, Okabe M, Fujita S, Yokoyama M. Involvement of distinct cellular compartments in the abnormal lymphoid organogenesis in lymphotoxin-α-deficient mice and alymphoplasia (aly) mice defined by the chimeric analysis. J. Immunol. 1999;163:1584–1591. [PubMed]
28. VanArsdale TL, Ware CF. TNF receptor signal transduction. Ligand-dependent stimulation of a serine protein kinase activity associated with (CD120a) TNFR60. J. Immunol. 1994;153:3043–3050. [PubMed]
29. Browning JL, Dougas I, Ngam-Ek A, Bourdon PR, Ehrenfels BN, Miatkowski K, Zafari M, Yampaglia AM, Lawton P, Meier W, et al. Characterization of surface lymphotoxin forms: use of specific monoclonal antibodies and soluble receptors. J. Immunol. 1995;154:33–46. [PubMed]
30. Force WR, Glass AA, Benedict CA, Cheung TC, Lama J, Ware CF. Discrete signaling regions in the lymphotoxin-β receptor for tumor necrosis factor receptor-associated factor binding, subcellular localization, and activation of cell death and NF-κB pathways. J. Biol. Chem. 2000;275:11121–11129. [PubMed]
31. Vandesompele J, De PK, Pattyn F, Poppe B, Van RN, De PA, Speleman F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3:RESEARCH0034.1–0034.11. [PMC free article] [PubMed]
32. Furtado GC, Marinkovic T, Martin AP, Garin A, Hoch B, Hubner W, Chen BK, Genden E, Skobe M, Lira SA. Lymphotoxin β receptor signaling is required for inflammatory lymphangiogenesis in the thyroid. Proc. Natl. Acad. Sci. USA. 2007;104:5026–5031. [PubMed]
33. Taylor RT, Patel SR, Lin E, Butler BR, Lake JG, Newberry RD, Williams IR. Lymphotoxin-independent expression of TNF-related activation-induced cytokine by stromal cells in cryptopatches, isolated lymphoid follicles, and Peyer's patches. J. Immunol. 2007;178:5659–5667. [PubMed]
34. Browning JL, Allaire N, Ngam-Ek A, Notidis E, Hunt J, Perrin S, Fava RA. Lymphotoxin-β receptor signaling is required for the homeostatic control of HEV differentiation and function. Immunity. 2005;23:539–550. [PubMed]
35. Angeli V, Ginhoux F, Llodra J, Quemeneur L, Frenette PS, Skobe M, Jessberger R, Merad M, Randolph GJ. B cell-driven lymphangiogenesis in inflamed lymph nodes enhances dendritic cell mobilization. Immunity. 2006;24:203–215. [PubMed]
36. Liao S, Ruddle NH. Synchrony of high endothelial venules and lymphatic vessels revealed by immunization. J. Immunol. 2006;177:3369–3379. [PubMed]