PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Dev Biol. Author manuscript; available in PMC 2010 June 15.
Published in final edited form as:
PMCID: PMC2693300
NIHMSID: NIHMS109154

STIM1 regulates store-operated Ca2+ entry in oocytes

Abstract

The single transmembrane-spanning Ca2+-binding protein, STIM1, has been proposed to function as a Ca2+ sensor that links the endoplasmic reticulum to activation of store-operated Ca2+ channels. In this study, the presence, subcellular localization and function of STIM1 in store-operated Ca2+ entry in oocytes was investigated using the pig as a model. Cloning and sequence analysis revealed the presence of porcine STIM1 with a coding sequence of 2,058 bp. In oocytes with full cytoplasmic Ca2+ stores, STIM1 was localized predominantly in the inner cytoplasm as indicated by immunocytochemistry or overexpression of human STIM1 conjugated to the yellow fluorescent protein. Depletion of the Ca2+ stores was associated with redistribution of STIM1 along the plasma membrane. Increasing STIM1 expression resulted in enhanced Ca2+ influx after store depletion and subsequent Ca2+ add-back; the influx was inhibited when the oocytes were pretreated with lanthanum, a specific inhibitor of store-operated Ca2+ channels. When STIM1 expression was suppressed using siRNAs, there was no change in cytosolic free Ca2+ levels in the store-depleted oocytes after Ca2+ add-back. The findings suggest that in oocytes STIM1 serves as a sensor of Ca2+ store content that after store depletion moves to the plasma membrane to stimulate store-operated Ca2+ entry.

Keywords: Ca2+ signaling, STIM1, store-operated Ca2+ entry, oocytes, swine

Introduction

Ionized calcium (Ca2+) is one of the most important second messengers in cellular signaling. In response to physiological or pathological stimuli, the low intracellular free Ca2+ concentration [Ca2+]i in resting cells becomes briefly elevated and the generated Ca2+ signal can regulate a diverse range of cellular responses (Berridge et al., 2000). In non-excitable cells, the major mechanism for Ca2+ signaling involves the phosphoinositide pathway. Agonist binding to specific receptors on the plasma membrane activates an isoform of phospholipase C which in turn catalyzes the cleavage of membrane-bound phosphatidylinositol 4,5-bisphosphate (PIP2) into diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3). The primary role of DAG is to activate protein kinase C, while IP3 interacts with its receptor on the surface of the endoplasmic reticulum and stimulates the release of Ca2+ from the intracellular stores (reviewed by Berridge, 1993). Signal transduction at fertilization also involves Ca2+ signals that are responsible for activating the oocytes' developmental program (Cuthbertson et al., 1981). During fertilization, the sperm delivers the enzyme phospholipase C-zeta (PLC-ζ) to the oocyte's cytoplasm that leads to the hydrolysis of PIP2 and the release of Ca2+ from the stores (Saunders et al., 2002). In mammals, the initial [Ca2+]i increase is followed by a series of Ca2+ transients; these transients result from the cyclic release and subsequent re-uptake of Ca2+ by the endoplasmic reticulum.

In addition to the release of the stored Ca2+ from the endoplasmic reticulum, a continuous influx of Ca2+ through the plasma membrane is necessary to maintain the oscillation (Igusa and Miyazaki, 1983). The Ca2+ influx pathway seems to be activated by depletion of the intracellular Ca2+ stores. Previous works on the mechanisms of Ca2+ transients revealed that the initiation of Ca2+ entry requires signaling from the depleted intracellular stores to store-operated channels (SOCs) in the plasma membrane (reviewed by Putney, 2005). However, the identity of the signal that links store depletion to the plasma membrane Ca2+ influx channels has remained unresolved for a long time.

Recently, the stromal interaction molecule (STIM) family proteins have been proposed to function as transducers of the empty signal from the endoplasmic reticulum to the plasma membrane. By using large scale RNAi screens it was found that Stim in Drosophila S2 cells and its mammalian homologue STIM1 in human T lymphocytes are critical in the activation of Ca2+ release-activated Ca2+ (CRAC) channels, a type of SOCs identified in a variety of cells (Liou et al., 2005; Roos et al., 2005). STIM1 is a type 1a single-pass transmembrane protein containing several conserved domains including a sterile-alpha motif (SAM), a coiled coil region and an EF-hand domain (Manji et al., 2000; Williams et al., 2002). Because of the EF-hand and the presence of a single transmembrane domain, STIM1 was suggested to be an ideal candidate as the Ca2+ store-sensing component for the Ca2+ release-activated Ca2+ entry pathway. Additional research confirmed that STIM1 was localized on the endoplasmic reticulum with the EF hand as the Ca2+-sensing domain oriented in the store's lumen. Store depletion triggers a rapid redistribution of STIM1 near the plasma membrane where it activates CRAC channels and triggers the influx of Ca2+ (Liou et al., 2005; Zhang et al., 2005; Spassova et al., 2006).

Although the maintenance of the low frequency Ca2+ oscillation is a prerequisite for normal fertilization in mammals, little is know about the mechanism that regulates Ca2+ influx after store depletion in the oocyte. In this study, the presence of STIM1 in oocytes was investigated using the pig as a model; efforts were also made to characterize the function of STIM1 in regulating store-operated Ca2+ entry in the oocytes.

Materials and Methods

Chemicals

All chemicals were purchased from Sigma-Aldrich Chemical Company (St. Louis, MO) unless otherwise indicated.

Oocyte Maturation

Ovaries from prepubertal gilts were collected at a local abattoir. Follicular fluid was aspirated from medium size (4 to 8 mm) follicles. Oocytes with intact cumulus investment and evenly dark cytoplasm were selected. The cumulus-oocytes complexes (COCs) were rinsed two times in Hepes-buffered Tyrode's Lactate (TL-Hepes) medium. The COCs were then rinsed three times in Tissue Culture Medium 199 (TCM-199) and incubated in the same medium supplemented with 0.1 mg/ml cysteine, 10 ng/ml epidermal growth factor (EGF), 10 IU/ml luteinizing hormone (LH) and 10 IU/ml follicle stimulating hormone (FSH) at 39°C in 5% CO2 in air for 42 h. At the end of the maturation period the oocytes were collected and the surrounding cumulus cells were removed by vigorous vortexing for 6 min in the presence of 2 mg/ml hyaluronidase. Oocytes with an intact plasma membrane and evenly dark cytoplasm were collected and used for the experiments.

RT-PCR

Messenger RNA was isolated from pools of 50 mature oocytes. The oocytes were rinsed three times in phosphate-buffered saline (PBS) containing 0.1 mg/ml polyvinyl alcohol (PVA) and 0.1 mg/ml diethylpyrocarbonate (DEPC) and placed into 100 μl lysis/binding buffer consisting of 100 mM Tris-HCl, 500 mM LiCl, 10 mM EDTA, 1% LiDS and 5 mM dithiothereitol. The Dynabeads™ mRNA DIRECT™ Micro Kit (Invitrogen Corporation; Carlsbad, CA) was used to isolate mRNA. Magnetic beads with mRNA attached were re-suspended in 20 μl of reverse transcription (RT) reaction mix consisting of 4 μl of 5x iScript Reaction Mix, 1 μl of iScript Reverse Transcriptase and 15 μl of nuclease-free water (iScript™ cDNA Synthesis Kit; Bio-Rad; Hercules, CA). Reverse transcription reactions were carried out under conditions of 25°C for 5 min followed by 42°C for 30 min and 85°C for 5 min.

To demonstrate the presence of STIM1 in porcine oocytes, coding sequences of STIM1 of various species were obtained from GenBank and used to find porcine ESTs that showed high similarities to these sequences. Primers were designed based on a porcine EST sequence (GenBank ID: BI338098) that showed 97.8% amino acid identity with STIM1 of other species (human, mouse, bovine). The primers were expected to amplify a 248 bp DNA fragment from porcine cDNA. The forward primer used was 5'-TTGCCAAGCAGGAAGCCCAG-3', and the reverse primer was 5'-AGCTGCTTCTCGGCGTTCTG-3'. As an internal control, β-actin primers were used. These primers were able to amplify a 264 bp fragment from porcine cDNA or a 350 bp fragment from porcine genomic DNA. The sequence of the forward primer was 5'-GCTGTATTCCCCTCCATCGT-3', and that of the reverse primer was 5'-ACGGTTGGCCTTAGGGTTCA-3'. The PCR was carried out using the HotStarTaq Master Mix (Qiagen; Valencia, CA) with cDNA obtained from the 50 oocytes. The reaction was started with 1 cycle of 95°C for 15 min, followed by 32 cycles of denaturation for 45 sec at 94°C, annealing for 45 sec at 55°C, and extension for 45 sec at 72°C, with a 10-min final extension following the last cycle. The PCR products were separated using electrophoresis on a 1.5% agarose gel.

Gene Cloning

To clone the STIM1 coding sequence, two pairs of primers were designed based on porcine ESTs (GenBank ID: BE663170 and BX918614) that showed more than 95% amino acid identity with human, mouse and bovine STIM1 sequences. The first set of primers had the following nucleotide sequence: forward, 5'-CCTACCGTCATGGATGTGTGCG-3'; reverse, 5'-AGCTGCTTCTCGGCGTTCTG-3'; the second set of primers was the following: forward, 5'-CCTACCGTCATGGATGTGTGCG-3'; reverse, 5'-TGCGGGGACAGCAACTAAGA-3'. The primer sets were expected to amplify two fragments of the STIM1 coding sequence from porcine oocytes, a 1,028 bp and a 1,491 bp fragment, with a 176 bp overlap. The β-actin primers described above were also used to detect genomic DNA contamination. The PCR was carried out using the HotStarTaq Master Mix (Qiagen) with cDNA obtained from 50 oocytes. The reaction was started with 1 cycle of 95°C for 15 min, followed by 32 cycles of denaturation for 45 sec at 94°C, annealing for 45 sec at 55°C, and extension for 2 min at 72°C, with a 10-min final extension after the last cycle. The amplified products of the PCR reaction were separated on a 1% agarose gel. They were then inserted into a TOPO 2.1 vector by using the TOPO TA Cloning Kit (Invitrogen) and the vector was transformed into competent E. coli cells. The bacterial cells were incubated for 12 h on LB plates supplemented with 50 μg/ml ampicillin. After selection, a colony was picked from the plate and incubated for 12 h in LB with 50 μg/ml ampicillin. The plasmids in the E. coli were purified using FastPlasmid™ Mini (Eppendorf; Westbury, NY). The isolated plasmid was digested with EcoR1 restriction enzyme and the final products were separated on a 1 % agarose gel. The plasmid was sent to the DNA Sequencing Low Throughput Laboratory of Purdue University for sequencing.

Immunocytochemistry

Mature oocytes were collected and the zonae pellucidae were removed using 0.5% protease in TL-Hepes containing 0.1 mg/ml PVA (TL-Hepes-PVA). The oocytes were rinsed in PBS and fixed in 3.7% paraformaldehyde for 15 min at room temperature. After fixation, the oocytes were washed and permeabilized in PBS containing 0.1 % Triton X-100 for 15 min. The oocytes were washed in PBS containing 0.01% Tween-20 with 2% bovine serum albumin (BSA) and non-specific binding sites were blocked by incubation in the same medium overnight at 4°C. The oocytes were then incubated with mouse monoclonal IgG2a primary antibody (dilution 1:50) raised against human STIM1 (BD Biosciences; Franklin Lakes, NJ) overnight at 4°C. Following incubation with the primary antibody, the oocytes were stained with a rhodamine-conjugated rabbit polyclonal anti-mouse antibody (Abcam, Inc.; Cambridge, MA; dilution 1:200) for 30 min at room temperature. Oocytes incubated with the secondary antibody only were used as control. The intracellular localization of STIM1 in the oocytes was then examined using a laser-scanning confocal microscope.

In Vitro Transcription

The YFP-STIM1 plasmid encoding the yellow fluorescent protein (YFP) conjugated to the N-terminus of human STIM1 downstream of the CMV promoter (a generous gift from Drs. Jen Liou and Tobias Meyer at Stanford University) was transcribed in vitro. To allow in vitro transcription, CMV was replaced with the T7 promoter. For this purpose a primer set was designed based on the coding sequence of human STIM1 (GenBank accession number: NM003156). The non-priming T7 promoter sequence, TAATACGACTCACTATAGGG was added 5' to the forward primer to amplify the T7-YFP-STIM1 double-stranded DNA fragment from the original plasmid. The forward primer used was 5'-TAATACGACTCACTATAGGGAGAATGGATGTATGCGTCCGTCTTGC-3' and the reverse primer was 5'-CGCCTACTTCTTAAGAGGCTTCTTAAAGATTTTGAGAGG-3'. The primers were expected to amplify a fragment of about 2,900 bp from the plasmid. A plasmid encoding YFP driven by the T7 promoter (to be injected into control oocytes) was also constructed. The PCR reactions were carried out using Platinum® Taq DNA Polymerase High Fidelity (Invitrogen). The PCR products were electrophoresed on a 0.8% agarose gel and after size confirmation they were purified by the QIAquick PCR Purification Kit (Qiagen) following the manufacturer's recommendations. The PCR products were then transcribed in vitro using the mMESSAGE mMACHINE Kit (Ambion; Austin, TX). The kit generates capped RNA with a 7-methyl guanosine cap structure [m7G(5')ppp(5')G] at the 5' end. After mixing the individual components of the reaction, the mix was incubated at 37°C for 1 h. The template DNA was removed by a 15-min incubation in the presence of TURBO DNase (Ambion) at 37°C. The RNA was purified by LiCl precipitation and the pellet was re-suspended in nuclease-free water to a final concentration of 1.6 μg/μl. After making 5μl aliquots, the samples were stored at -80°C.

RNA Interference

Small interfering RNA (siRNA) was generated to target the SAM domain-encoding region of the STIM1 gene as described in a previous report (Jousset et al., 2007). Potential siRNA sequences were designed by Invitrogen through the Stealth™ RNAi program based on the sequence of the predicted porcine SAM domain-encoding region. The target region of each potential siRNA was then blasted against all available porcine sequences in GenBank to determine specificity. The following strands which showed the highest specificity were selected: sense, 5'-UCACGUACGUGGAGCUGCCUCAGUA; and antisense, 5'-UACUGAGGCAGCUCCACGUACGUGA. The siRNA was diluted to a final concentration of 1, 20 and 100 μM in DEPC-treated nuclease-free water, aliquoted and stored at -20°C until use. Oocytes injected with a non-silencing siRNA duplex (sense, 5'-UCAAUGCGUAGCGGUCCCUAGCGUA; antisense, 5'-UACGCUAGGGACCGCUACGCAUUGA; from Invitrogen) or with DEPC-treated nuclease-free water were used as negative control. The siRNAs were then microinjected into oocytes. To demonstrate that the microinjected siRNA effectively downregulated STIM1 expression, mRNA was isolated from 20 oocytes that had been microinjected with siRNA against STIM1 and reverse transcribed. A STIM1 fragment was then amplified from the cDNA by PCR; the PCR products were separated on a 1.5% agarose gel.

RNA microinjection

The oocytes were denuded 36 h after the beginning of maturation and YFP-STIM1 mRNA, YFP mRNA or siRNA was injected into the oocytes' cytoplasm using a FemtoJet microinjector (Eppendorf). Microinjection was performed in Ca2+-free TL-Hepes to avoid accidental oocyte activation as a result of Ca2+ contamination, on the heated stage of a Nikon TE2000-U inverted microscope (Nikon Corporation; Tokyo, Japan). The microinjected oocytes were rinsed with TCM-199 three times and incubated in TCM-199 supplemented with 0.1 mg/ml cysteine and 10 ng/ml EGF at 39°C in 5% CO2 in air. After 15 h of incubation (this time was sufficient to allow translation based on previous experiments), the ooyctes with first polar bodies and intact plasma membranes were selected and used for further analyses.

Western blot

Approximately 800 oocytes microinjected with mRNA encoding the YFP-STIM1 fusion protein were lysed, collected in SDS sample buffer and boiled for 3 min. The samples were then centrifuged at 12,000xg for 4 min and proteins were separated by SDS-PAGE in an ice-covered box using a 5% stacking gel and a 12% separating gel (for 30 min at 90 V and 2.5 h at 120 V, respectively). The separated proteins were electrophoretically transferred onto a PVDF membrane by the semi-dry transfer method at 180 mA for 1 h. After blocking at room temperature for 1 h in TBST buffer containing 5% non-fat milk, the membrane was incubated with anti-GFP polyclonal antibody (Abcam, 1:700) overnight at 4°C. After three washes in TBST, the membrane was incubated for 1 h at room temperature with horseradish peroxidase (HRP)-conjugated anti-rabbit immunoglobulin G (Promega; Madison, WI) diluted 1:1500 in TBST. The membrane was then washed three times in TBST and processed using the enhanced chemiluminescence (ECL) detection system (Pierce Thermo Scientific, Rockford, IL).

Cytosolic Ca2+ Measurements

The oocytes were loaded with the Ca2+ indicator dye fura-2. For this purpose they were incubated in the presence of 2 μM of the acetoxymethyl ester form of the dye and 0.02% pluronic F-127 for 40-50 min (both from Invitrogen). After incubation, individual oocytes were transferred into a measuring chamber and changes in the [Ca2+]i were recorded using InCyt Im2, a dual-wavelength fluorescence imaging system (Intracellular Imaging, Inc.; Cincinnati, OH). The [Ca2+]i was determined from the ratio of fura-2 fluorescence at 510 nm excited by UV light alternatively at 340 and 380 nm. The fluorescence ratio was compared against a standard curve of known Ca2+ concentrations prepared with fura-2 potassium salt (Invitrogen). Each Ca2+ measurement was performed for at least 15 minutes and the measurements in each treatment group were repeated using different oocytes. The intracellular Ca2+ levels are presented as fluorescence ratio values; ratios of 0.97 and 5.0 represent 100 and 1,040 nM Ca2+, respectively.

Results

STIM1 is present in porcine oocytes

The expression of STIM1 was monitored by investigating the presence of STIM1 mRNA in porcine oocytes. The designed primers successfully amplified the expected 248 bp fragment of STIM1 cDNA. The β-actin primers amplified only a 264 bp fragment indicating that there was no contamination from genomic DNA in the reaction mix (Figure 1).

Figure 1
Expression of STIM1 in porcine oocytes. Messenger RNA was isolated from the oocytes and used as template for RT-PCR. Lane 1: 264 bp β-actin cDNA (control), Lane 2: Molecular weight marker, Lane 3: 248 bp STIM1.

The oligonucleotide primers designed to clone the STIM1 gene amplified two fragments of the expected size: one with 1,028 bp and another with 1,491 bp. Sequence data from the PCR products were combined that led to the identification of a 2,058 bp product of the porcine STIM1 coding sequence (the information was submitted to GenBank, accession number EU038298). This coding sequence has the same length as human and mouse STIM1, and is somewhat longer than the 2,052 bp long bovine STIM1 coding sequence. Cloning and sequencing of the amplified fragments revealed identities of 91% at the DNA and 95.9% at the amino acid level compared to the human homologue (Figure 2). Comparison with mouse STIM1 DNA showed an 88.2% identity. In some occasions a longer transcript variant of STIM1 was found that contained an additional 93 bp; the additional sequence was localized at the predicted coiled coil region of STIM1 (Manji et al., 2000). This transcript variant showed over 85% identity with the predicted STIM1 precursor found in Rhesus monkey and chimpanzee. These results clearly indicate that porcine oocytes express STIM1 that has high similarities with STIM1 found in other species.

Figure 2
Amino acid sequence of mouse, human and porcine STIM1.

Store depletion leads to STIM1 translocation

The immunocytochemical analysis demonstrated that in mature oocytes endogenous STIM1 was localized predominantly in the inner regions of the cytoplasm (n=12; Figure 3A). When the intracellular stores were depleted using thapsigargin (thapsigargin blocks microsomal Ca2+ ATPases, thereby prevents pumping of Ca2+ into the endoplasmic reticulum that leads to store depletion), STIM1 underwent a rapid translocation. Following a 1-h treatment with 50 μM thapsigargin in Ca2+-free medium, STIM1 rearranged into punctuate structures in the cell periphery (Figure 3 B&C). Theses oocytes (n=10) showed fluorescence primarily in the cortical region indicating that in response to the depletion of the intracellular Ca2+ stores STIM1 migrated from the cytoplasm to the plasma membrane. Control oocytes (n=8) that were incubated with the secondary antibody only displayed no red fluorescence (data not shown).

Figure 3
Laser-scanning confocal images showing the distribution of STIM1 in porcine oocytes before and after store depletion. In order to better visualize STIM1 localization, 5 optical sections were combined in each cases except for image C. Images A, B, & ...

Overexpression of STIM1 tagged with YFP gave similar result. When the intracytoplasmic Ca2+ stores were full, the yellow fluorescent signal was distributed in the cytoplasm (n=14; Figure 3D). After the thapsigargin treatment in Ca2+-free medium, the signal from the inner cytoplasm mostly disappeared (n=10; Figure 3E); these oocytes showed YFP-STIM1 accumulation in the cortical cytoplasm. In oocytes injected with YFP mRNA (n=12), the yellow fluorescent signal showed no specific accumulation before or after store depletion, while the oocytes injected with the carrier medium alone (n=10) displayed no fluorescence in their cytoplasm (data not shown). This again suggests that store depletion resulted in the translocation of YFP-STIM1 from the cytoplasm to the plasma membrane.

STIM1 overexpression enhances store-operated Ca2+ entry

The STIM1 protein was overexpressed in porcine oocytes by microinjection of YFP-STIM1 mRNA produced by in vitro transcription. The exogenously expressed STIM1 was demonstrated in the injected oocytes by Western blot analysis. After microinjection of YFP-STIM1 mRNA followed by 15 h of incubation, a ~110 kDa band indicating YFP-conjugated STIM1 was clearly detectable in the gel; this band was absent in control non-injected oocytes (Figure 4).

Figure 4
STIM1 overexpression as demonstrated by Western blot analysis. Oocytes (n=800) microinjected with YFP-STIM1 mRNA were pooled and analyzed using an anti-GFP antibody; the control included 800 non-injected oocytes. The expected size of the YFP-STIM1 fusion ...

The Ca2+ stores were then depleted by incubating fura 2-loaded oocytes with thapsigargin in Ca2+-free TL-Hepes medium. This was followed by placing individual oocytes in 50 μl of Ca2+-free medium on the stage of an inverted microscope and after a baseline fluorescence recording 1 ml of TL-Hepes containing 2 mM Ca2+ was added to the medium. In control oocytes (either non-injected or injected with the carrier medium only) the addition of Ca2+ to the external medium induced an elevation in the intracellular free Ca2+ concentration (n=5; Figure 5). This suggested that the mechanism of store-operated Ca2+ entry was activated which created a Ca2+ influx into the cytoplasm. In oocytes where the STIM1 protein had been overexpressed, the re-addition of Ca2+ after the thapsigargin treatment stimulated enhanced Ca2+ influx (n=10). When 1 μM lanthanum (La3+), a specific inhibitor of the store-operated Ca2+ channels (Smyth et al., 2006) was added to the oocytes after STIM1 mRNA injection and the subsequent 15-h translation period, the thapsigargin-induced Ca2+ influx was almost completely abolished (n=11). This clearly indicates that the overexpressed STIM1 protein specifically activated SOCs in the plasma membrane.

Figure 5
The effect of STIM1 overexpression on store-operated Ca2+ entry. Oocytes were pre-incubated with 50 μM thapsigargin in Ca2+-free medium for 1 h to deplete the Ca2+ stores. After measuring the baseline Ca2+ level, Ca2+-containing TL-Hepes was added ...

STIM1 suppression blocks store depletion-induced Ca2+ influx

In order to further clarify the role of STIM1 in the store-operated Ca2+ entry mechanism in oocytes, STIM1 expression was suppressed by using siRNA against STIM1. To demonstrate the efficiency and specificity of the siRNA, three different concentrations, 1 μM, 20 μM and 100 μM of siRNA were tested. We found that 15 h after siRNA injection, the amount of STIM1 mRNA was highly suppressed in all three groups, whereas the control β-actin gene was expressed in the injected oocytes at an unaltered level (Figure 6). In control oocytes that were injected with non-silencing siRNA, STIM1 expression remained high. In addition, microinjection of 100 μM siRNA also led to decreased protein 1evels in the ooplasm as indicated by indirect immunosytochemistry (Figure 7). Oocytes injected with 100 μM siRNA that showed the lowest STIM1 mRNA levels were selected for the Ca2+ measurements.

Figure 6
Downregulation of STIM1 expression in porcine oocytes. Oocytes were microinjected with three different concentrations of siRNA against STIM1 (1 μM, 20 μM and 100 μM) or 100 μM non-silencing siRNA (control). STIM1 mRNA was ...
Figure 7
Results of immunocytochemical analysis indicating downregulation of STIM1 protein levels in porcine oocytes. A: non-treated oocyte; B: oocyte injected with 100 μM siRNA against STIM1. The white circle in each picture indicates the location of ...

Injecting porcine oocytes with 100 μM STIM1 siRNA successfully suppressed the Ca2+ release-induced Ca2+ influx. The Ca2+ content of the endoplasmic reticulum was depleted using thapsigargin in Ca2+-free medium and Ca2+ was then re-added to the medium holding the oocytes. This led to an increase in the intracellular free Ca2+ levels in control oocytes injected with either non-silencing siRNA (n=9) or carrier medium (n=8), while in the siRNA-treated group (n=11) there was no change in the cytosolic free Ca2+ concentration (Figure 8). In a similar experiment, general protein synthesis was inhibited in the oocytes by incubation in the presence of 10 μg/ml cycloheximide for 15 h. Store-operated Ca2+ entry was completely blocked in these oocytes, although they were capable of generating a large elevation in their cytosolic free Ca2+ levels when treated with 50 μM ionomycin (data not shown). These results demonstrate that downregulation of STIM1 expression effectively blocks store-operated Ca2+ entry.

Figure 8
Suppression of thapsigargin-induced Ca2+ influx by STIM1 siRNA. Oocytes were pre-incubated with 50 μM thapsigargin in Ca2+-free medium for 1 h to deplete Ca2+ stores. After a brief baseline measurement, Ca2+-containing TL-Hepes was added (arrow) ...

Discussion

Store-operated Ca2+ influx is critical in a number of cellular processes (reviewed by Smyth et al., 2006). The Ca2+ that enters the cell as a result of store depletion replenishes the endoplasmic reticulum and maintains its ability to generate additional signals (Parekh and Putney, 2005). It is also a key regulator of endoplasmic reticulum function, essential for processes that require a sufficient level of Ca2+ in the stores such as protein folding, protein trafficking, apoptosis and stress response (Burdakov et al., 2005). In addition, the Ca2+ influx in some cell types provides the sustained elevation in cytoplasmic Ca2+ levels that stimulates events downstream in the signaling pathway (Lewis, 2001). However, the molecular mechanism that signals the depletion of the cytoplasmic stores to the Ca2+ influx channels in the plasma membrane has been a major unresolved puzzle of cell biology. According to one model, an intermediate signaling mechanism is utilized by the cell to communicate information from the empty stores to plasma membrane channels to enable Ca2+ to enter the cell and refill the stores (Putney, 1986; 1991). Recently, STIM1 has been suggested to play a major role in the store-operated Ca2+ entry pathway in a number of cell types. It was proposed to serve as a sensor for the Ca2+ content of the endoplasmic reticulum that after store depletion moves to the plasma membrane and activates CRAC channels (Liou et al., 2005; Roos et al., 2005; Zhang et al., 2005). Here we report for the first time the existence of STIM1 in oocytes; its presence was clearly shown both at the transcript and protein levels. The fragment amplified from porcine oocytes has a 2058 bp coding sequence; in addition, a longer transcript that showed high similarity to STIM1 precursors in primates was also found. The deduced protein has 686 amino acids and has high similarity with other homologues suggesting that porcine STIM1 can be expected to possess similar structure and function as reported in other species.

It was demonstrated previously, that STIM1 primarily localized on the endoplasmic reticulum and rapidly redistributed into punctae near the plasma membrane after Ca2+ store depletion (Liou et al., 2005). However, the mechanism of STIM1 action and its exact cellular localization after store depletion is still a matter of debate. Whether it is released from the endoplasmic reticulum to activate channels in the plasma membrane or it accumulates in endoplasmic reticulum regions located close to the plasma membrane and thus interacts with entry channel components is unclear. A number of laboratories demonstrated that upon store depletion endogenous STIM1 incorporates in the plasma membrane and becomes exposed to the surface (Manji et al., 2000; Zhang et al., 2005; Spassova et al., 2006), while others failed to show surface exposure using fusion constructs where the N-terminus of STIM1 was labeled with fluorescent proteins, horseradish peroxidase or HA tag (Liou et al., 2005; Mercer et al., 2006; Wu et al., 2006). Recently it has been suggested that N-terminal tagging with bulky molecules interferes with protein trafficking and STIM1 surface exposure has been demonstrated by using short hexahistidine tags in combination with a novel chelating fluorophore (Hauser and Tsien, 2007). Nevertheless, externalization of the N-terminus does not seem essential to stimulate calcium influx channels, such channels are probably activated by the interaction between the cytosolic C terminus of STIM1 and the cytoplasmic domain of Orai1, a potential component of the Ca2+ release-activated Ca2+ channel in the plasma membrane (Soboloff et al., 2006; Peinelt et al., 2006). Our results indicated that endogenous STIM1 was predominantly located in the cytosol and rearranged near the cell periphery after a thapsigargin-induced Ca2+ release. Although we applied various treatments for oocyte permeabilization and fixation, low signal intensity made it necessary to combine several optical sections in order to better demonstrate STIM1 localization. The YFP-STIM1 expressed in porcine oocytes behaved in a very similar manner: first it localized in the inner cytoplasm and a thapsigargin-evoked Ca2+ store depletion triggered its redistribution. Although technical limitations prevented us from determining the degree of interaction with the plasma membrane, the translocation and aggregation was very similar to what was reported previously. These results support the hypothesis that Ca2+ store depletion induces STIM1 translocation to stimulate CRAC channel activity in the plasma membrane.

In different cell types, overexpression of STIM1 enhanced store-operated Ca2+ influx to various degrees. In HEK293 cells STIM1 overexpression moderately enhanced thapsigargin-induced Ca2+ entry (Roos et al., 2005), while in He La cells store-operated Ca2+ influx increased significantly after STIM1 overexpression (Liou et al., 2005). Furthermore, it was demonstrated that overexpression of STIM1 resulted in a 5-fold increase in Ca2+ influx but co-transfection of STIM1 and Orai1 led to an approximately 20-fold increase in Ca2+ entry (Mercer et al., 2006). Here we found that in porcine oocytes, STIM1 overexpression also enhanced the activity of the store-operated Ca2+ channels compared to control oocytes. Elevated protein levels were demonstrated by Western blot analysis. Although previously we had been unable to identify endogenous STIM1 even in a large number of oocytes by Western blot (probably due to relatively low STIM1 expression in pig oocytes and also, to limitations of the experimental system using oocytes), using a polyclonal anti-GFP antibody we could demonstrate the presence of the exogenously expressed YFP-STIM1. Adding Ca2+ to the external medium after a thapsigargin-induced store depletion led to higher intracellular Ca2+ levels in STIM1 mRNA-injected oocytes compared to the controls and the influx was completely blocked by La3+, an inhibitor of SOCs. As in other cell types, STIM1-mediated Ca2+ influx sustained high cytoplasmic Ca2+ levels in thapsigargin-pretreated oocytes for an extended period of time. The results support the idea that STIM1 is a necessary component of the signaling mechanism that links Ca2+ store depletion to the activation of store-operated Ca2+ entry in porcine oocytes.

The critical role of STIM1 in store-operated Ca2+ entry using STIM1 knockdown by siRNA has previously been demonstrated in various types of somatic cells (Roos et al., 2005; Liou et al., 2005; Jousset et al., 2007; Wedel et al., 2007). The result of our experiment using siRNA injection indicated for the first time that STIM1 has an essential role in the regulation of store-operated Ca2+ entry in oocytes. Knockdown of STIM1 in porcine oocytes completely suppressed thapsigargin-induced Ca2+ influx with no affect on the resting state cytosolic Ca2+ concentration. The siRNA with a length of 25 bp was designed to target position 425-449 of the porcine STIM1 CDS which lies in the SAM domain-encoding region. The target region was selected based on the results of a genome-wide siRNA screen (Liou et al., 2005) where 2,304 siRNAs were used against the SH2-, SAM-, EF-hand- and PH domains of human STIM1. Because the SAM domain-targeting siRNA showed very efficient knockdown, we also selected the sequence encoding the porcine SAM domain as the target in our experiment. When injected into oocytes, the siRNA showed highly efficient downregulation of STIM1 and suppression of store-operated Ca2+ entry.

Blocking protein synthesis during the last 15 h of maturation had a similar inhibitory effect on store-operated Ca2+ entry. This reveals an interesting aspect of STIM1 physiology. Mammalian oocytes reach their full capacity to generate a Ca2+ oscillation during the final stages of meiotic maturation and it is associated with a number of cytoplasmic changes including reorganization of endoplasmic reticulum, increase in the number (and modifications in the biochemical properties) of IP3 receptors, increase in the concentration of Ca2+ ions stored and redistribution of Ca2+-binding proteins in the endoplasmic reticulum take place (Carroll et al., 1996; Machaka, 2007; Ajduk et al., 2008). STIM1 expression seems to be important from this respect and our findings suggest that porcine STIM1 is primarily synthesized over the last 15 h of maturation, or alternatively, the protein is very labile, or both. Determining the relationship between STIM1 expression and characteristics of induced Ca2+ oscillations at various phases of maturation promises more insight into the role of STIM1 during Ca2+ signaling in the oocyte.

The results described above strongly argue for a central role of STIM1 in the regulation of the store-operated Ca2+ entry mechanism in oocytes and may be crucial to maintain the low frequency Ca2+ oscillation induced by the fertilizing sperm. This, however, needs further investigations. It has been demonstrated that Ca2+ oscillations are not always mediated by SOCs but may involve membrane channels opened by lipid second messengers (Shuttleworth, 1999) or other channels such as transient receptor potential channels (TRPs) that are associated with both store- and receptor-operated Ca2+ entry (Grimaldi et al., 2003; Wu et al., 2002). Oocytes were also shown to contain TRP channels (Brereton et al., 2000; Machaty et al., 2002), and although STIM1 can activate canonical TRP channels (Huang et al., 2006), additional research is required to characterize the exact role of STIM1 in the Ca2+ oscillation seen during fertilization.

Acknowledgements

The authors thank Dr. Jen Liou and Dr. Tobias Meyer of Stanford University for generously providing the YFP-STIM1 plasmid for the expression studies. We are also grateful to the Indiana Packers Corporation (Delphi, IN) for donating the pig ovaries. The work was supported by PHS grant HD056402; additional funding was provided by the Agricultural Research Programs office of Purdue University, ARP manuscript #2008-18403.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • Ajduk A, Małagocki A, Maleszewski M. Cytoplasmic maturation of mammalian oocytes: development of a mechanism responsible for sperm-induced Ca2+ oscillations. Reprod. Biol. 2008;8:3–22. [PubMed]
  • Berridge MJ. Inositol trisphosphate and calcium signalling. Nature. 1993;361:315–325. [PubMed]
  • Berridge MJ, Lipp P, Bootman MD. The versatility and universality of calcium signalling. Nat. Rev. Mol. Cell. Biol. 2000;1:11–21. [PubMed]
  • Brereton HM, Harland ML, Auld AM, Barritt GJ. Evidence that the TRP-1 protein is unlikely to account for store-operated Ca2+ inflow in Xenopus laevis oocytes. Mol. Cell. Biochem. 2000;214:63–74. [PubMed]
  • Burdakov D, Petersen OH, Verkhratsky A. Intraluminal calcium as a primary regulator of endoplasmic reticulum function. Cell Calcium. 2005;38:303–310. [PubMed]
  • Carroll J, Jones KT, Whittingham DG. Ca2+ release and the development of Ca2+ release mechanisms during oocyte maturation: a prelude to fertilization. Rev. Reprod. 1996;3:137–43. [PubMed]
  • Cuthbertson KS, Whittingham DG, Cobbold PH. Free Ca2+ increases in exponential phases during mouse oocyte activation. Nature. 1981;294:754–757. [PubMed]
  • Grimaldi M, Maratos M, Verma A. Transient receptor potential channel activation causes a novel form of [Ca2+]i oscillations and is not involved in capacitative Ca2+ entry in glial cells. J. Neurosci. 2003;23:4737–4745. [PubMed]
  • Hauser CT, Tsien RY. A hexahistidine-Zn2+-dye label reveals STIM1 surface exposure. Proc. Natl. Acad. Sci. U. S. A. 2007;104:3693–3697. [PubMed]
  • Huang GN, Zeng W, Kim JY, Yuan JP, Han L, Muallem S, Worley PF. STIM1 carboxyl-terminus activates native SOC, I(crac) and TRPC1 channels. Nat Cell Biol. 2006;8:1003–1010. [PubMed]
  • Igusa Y, Miyazaki S. Effects of altered extracellular and intracellular calcium concentration on hyperpolarizing responses of the hamster egg. J. Physiol. 1983;340:611–632. [PubMed]
  • Jousset H, Frieden M, Demaurex N. STIM1 knockdown reveals that store-operated Ca2+ channels located close to sarco/endoplasmic Ca2+ ATPases (SERCA) pumps silently refill the endoplasmic reticulum. J. Biol. Chem. 2007;282:11456–11464. [PubMed]
  • Lewis R,S. Calcium signaling mechanisms in T lymphocytes. Annu. Rev. Immunol. 2001;19:497–521. [PubMed]
  • Liou J, Kim ML, Heo WD, Jones JT, Myers JW, Ferrell JE, Jr., Meyer T. STIM is a Ca2+ sensor essential for Ca2+-store-depletion-triggered Ca2+ influx. Curr. Biol. 2005;15:1235–1241. [PMC free article] [PubMed]
  • Machaca K. Ca2+ signaling differentiation during oocyte maturation. J. Cell Physiol. 2007;213:331–340. [PubMed]
  • Machaty Z, Ramsoondar JJ, Bonk AJ, Bondioli KR, Prather RS. Capacitative calcium entry mechanism in porcine oocytes. Biol. Reprod. 2002;66:667–674. [PubMed]
  • Manji SS, Parker NJ, Williams RT, van Stekelenburg L, Pearson RB, Dziadek M, Smith PJ. STIM1: a novel phosphoprotein located at the cell surface. Biochim. Biophys. Acta. 2000;1481:147–155. [PubMed]
  • Mercer JC, Dehaven WI, Smyth JT, Wedel B, Boyles RR, Bird GS, Putney JW., Jr. Large store-operated calcium selective currents due to co-expression of Orai1 or Orai2 with the intracellular calcium sensor, Stim1. J. Biol. Chem. 2006;281:24979–24990. [PMC free article] [PubMed]
  • Parekh AB, Putney JW., Jr. Store-operated calcium channels. Physiol. Rev. 2005;85:757–810. [PubMed]
  • Peinelt C, Vig M, Koomoa DL, Beck A, Nadler MJ, Koblan-Huberson M, Lis A, Fleig A, Penner R, Kinet JP. Amplification of CRAC current by STIM1 and CRACM1 (Orai1) Nat. Cell. Biol. 2006;8:771–773. [PubMed]
  • Putney JW., Jr. A model for receptor-regulated calcium entry. Cell Calcium. 1986;7:1–12. [PubMed]
  • Putney JW., Jr. The capacitative model for receptor-activated calcium entry. Adv. Pharmacol. 1991;22:251–269. [PubMed]
  • Putney JW., Jr. Capacitative calcium entry: sensing the calcium stores. J. Cell. Biol. 2005;169:381–382. [PMC free article] [PubMed]
  • Roos J, DiGregorio PJ, Yeromin AV, Ohlsen K, Lioudyno M, Zhang S, Safrina O, Kozak JA, Wagner SL, Cahalan MD, Velicelebi G, Stauderman KA. STIM1, an essential and conserved component of store-operated Ca2+ channel function. J. Cell. Biol. 2005;169:435–445. [PMC free article] [PubMed]
  • Saunders CM, Larman MG, Parrington J, Cox LJ, Royse J, Blayney LM, Swann K, Lai FA. PLC zeta: a sperm-specific trigger of Ca2+ oscillations in eggs and embryo development. Development. 2002;129:3533–3544. [PubMed]
  • Shuttleworth TJ. What drives calcium entry during [Ca2+]i oscillations?--challenging the capacitative model. Cell Calcium. 1999;25:237–246. [PubMed]
  • Smyth JT, Dehaven WI, Jones BF, Mercer JC, Trebak M, Vazquez G, Putney JW., Jr. Emerging perspectives in store-operated Ca2+ entry: roles of Orai, Stim and TRP. Biochim. Biophys. Acta. 2006;1763:1147–1160. [PubMed]
  • Soboloff J, Spassova MA, Tang XD, Hewavitharana T, Xu W, Gill DL. Orai1 and STIM reconstitute store-operated calcium channel function. J. Biol. Chem. 2006;281:20661–20665. [PubMed]
  • Spassova MA, Soboloff J, He LP, Xu W, Dziadek MA, Gill DL. STIM1 has a plasma membrane role in the activation of store-operated Ca2+ channels. Proc. Natl. Acad. Sci. U. S. A. 2006;103:4040–4045. [PubMed]
  • Wedel B, Boyles RR, Putney JW, Jr., Bird GS. Role of the store-operated calcium entry proteins Stim1 and Orai1 in muscarinic cholinergic receptor-stimulated calcium oscillations in human embryonic kidney cells. J. Physiol. 2007;579:679–689. [PubMed]
  • Williams RT, Senior PV, Van Stekelenburg L, Layton JE, Smith PJ, Dziadek MA. Stromal interaction molecule 1 (STIM1), a transmembrane protein with growth suppressor activity, contains an extracellular SAM domain modified by N-linked glycosylation. Biochim. Biophys. Acta. 2002;1596:131–137. [PubMed]
  • Wu MM, Buchanan J, Luik RM, Lewis RS. Ca2+ store depletion causes STIM1 to accumulate in ER regions closely associated with the plasma membrane. J. Cell. Biol. 2006;174:803–813. [PMC free article] [PubMed]
  • Wu X, Babnigg G, Zagranichnaya T, Villereal ML. The role of endogenous human Trp4 in regulating carbachol-induced calcium oscillations in HEK-293 cells. J. Biol. Chem. 2002;277:13597–13608. [PubMed]
  • Zhang SL, Yu Y, Roos J, Kozak JA, Deerinck TJ, Ellisman MH, Stauderman KA, Cahalan MD. STIM1 is a Ca2+ sensor that activates CRAC channels and migrates from the Ca2+ store to the plasma membrane. Nature. 2005;437:902–905. [PMC free article] [PubMed]