PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Cell Sci. Author manuscript; available in PMC 2010 May 1.
Published in final edited form as:
PMCID: PMC2672968
NIHMSID: NIHMS86971
LC3 Mediated Fibronectin mRNA Translation Induces Fibrosarcoma Growth by Increasing Connective Tissue Growth Factor
Lihua Ying,* Agatha Lau,** Cristina M Alvira,* Robert West, Gordon M Cann,* Bin Zhou,†† Caroline Kinnear,** Eric Jan, Peter Sarnow, Matt Van de Rijn, and Marlene Rabinovitch*
* Department of Pediatrics, Stanford University School of Medicine, Stanford, CA, 94305
Department of Pathology, Stanford University School of Medicine, Stanford, CA, 94305
Departments of Microbiology and Immunology, Stanford University School of Medicine, Stanford, CA, 94305
** Departments of Pediatrics, Laboratory Medicine & Pathobiology, and Medicine at the University of Toronto, Ontario, Canada M5G 1X8 (where the study was initiated);
†† currently in the Department of Pediatrics, Vanderbilt University, Nashville, TN, 37232
Previously we related fibronectin (FN) mRNA translation to an interaction between an AU-rich element (ARE) in the FN-3′ UTR and Light Chain 3 (LC3) of microtubule associated proteins 1A and 1B. Since human fibrosarcoma (HT1080) cells produce both little FN and LC3, we used these cells to investigate how LC3-mediated FN mRNA translation might alter tumor growth. Transfection of HT1080 cells with LC3 enhanced FN mRNA translation that depended on an interaction between a triple arginine motif in LC3 and the ARE in FN mRNA, as determined by relating FN synthesis to mRNA levels, by polysome analysis of the FN mRNA transcript, and by RNA binding assays. Wild type, (WT) but not mutant LC3, accelerated HT1080 cell growth in culture and when implanted in SCID mice. Comparison of LC3-WT with vector-transfected HT1080 cells revealed increased FN-dependent proliferation, adhesion and invasion. Microarray analysis of genes differentially expressed in LC3-WT vs. vector-transfected control cells indicated enhanced expression of connective tissue growth factor (CTGF). Using siRNA, we show by qRT-PCR that enhanced expression of CTGF is FN- dependent and that LC3 mediated adhesion, invasion and proliferation are CTGF-dependent. Expression profiling of soft tissue tumors revealed increased expression of both LC3 and CTGF in some locally invasive tumor types.
Keywords: mRNA translation, microtubule associated protein, tumor invasiveness, LC3, fibronectin, connective tissue growth factor
Fibronectin (FN) is a homodimeric secreted glycoprotein present in the plasma or associated with the extracellular matrix. It influences cell adhesion, migration, proliferation, differentiation, and cytoskeletal organization (Hynes and Lander, 1992). An increase in FN synthesis is associated with migration of vascular smooth muscle cells contributing to intimal cushion formation in the developing ductus arteriosus (Mason et al., 1999b) and to the formation of the neointima in the post-cardiac transplant coronary arteriopathy (Clausell et al., 1993; Salomon et al., 1991) and in other occlusive vascular diseases (Jones et al., 1997). Studies investigating the mechanism regulating enhanced production of FN in ductus arteriosus smooth muscle cells led to the discovery that light chain 3 (LC3) of microtubule-associated proteins 1A and 1B binds to the AU-rich element (ARE) in the 3′ untranslated region (UTR) of the FN mRNA (Zhou et al., 1997), and increases the efficiency of translation by ribosomal recruitment (Zhou and Rabinovitch, 1998). Transfection of smooth muscle cells with a construct containing the chloramphenicol acetyl transferase (CAT) coding region and the wild type FN-3′UTR results in increased CAT activity when compared with a construct in which the FN-3′UTR is mutated at the ARE (Zhou et al., 1997). LC3 co-distributes with heavy polysomes containing FN mRNA, and when microtubules are disrupted, the association of both LC3 and FN mRNA with polysomes is lost and FN mRNA translation is suppressed (Zhou and Rabinovitch, 1998).
AREs are common regulatory sequences within the 3′UTR of mRNAs encoding inflammatory mediators, cytokines and oncogenes (Caput et al., 1986). While their documented role appears to be related to mRNA destabilization (Shaw and Kamen, 1986; Treisman, 1985) or translational repression (Kruys et al., 1989; Kruys et al., 1987), AREs also enhance mRNA translation. For example, enhanced TNF-α mRNA translation is associated with the interaction of a 55 kDa protein with an ARE (Lewis et al., 1998). Although a number of amino acid motifs in various RNA binding proteins are known to interact with mRNA regulatory sequences, none have been specifically identified in association with the ARE. The arginine-rich motif (ARM) is a common RNA binding domain present in RNA-binding proteins such as Rev and Tat (Iwai et al., 1992). It is the location of the ARM in the complex secondary structure of the binding protein, rather than the amino acid sequence per se, that appears be the major determinant of its interaction with RNA (Dayton et al., 1989; Malim et al., 1989). We have observed, using northwestern immunoblotting, that the ARM in LC3 is necessary for its binding to the ARE in the 3′UTR of FN mRNA (our unpublished data).
To further elucidate the importance of LC3 in mediating cell function related to mRNA translation, we screened cell lines for low levels of expression of LC3 and found that the HT1080 fibrosarcoma cell line also produces little fibronectin (FN) (Dean et al., 1988). In this study, we assess the functional significance of increasing LC3 in HT1080 cells on fibronectin mRNA translation and on growth of the tumor cells in culture and in SCID mice. We show that adhesion, invasion and proliferation are enhanced by LC3 in a FN-dependent manner, and that these properties are modulated by FN-mediated production of connective tissue growth factor (CTGF). Gene expression profiling of 239 soft tissue tumors showed coordinated expression of both LC3 and CTGF in some tumor types with locally invasive properties.
Enhanced FN Protein in HT1080 Stable Transfectants Expressing LC3
Previous studies showed that HT1080 cells synthesize low levels of FN and do not exhibit cell surface FN matrix deposits, a feature associated with the tumorigenicity of the cells (Dean et al., 1988). To establish that LC3-ARE binding can mediate enhanced FN mRNA translation in these cells, we constructed vectors encoding the wild-type LC3 (LC3-WT), and a mutant form of LC3, in which triple arginine motif of the ARM was replaced with glutamine, thus abolishing the positive charge of the ARM (LC3-R/Q). These constructs, as well as a vector only construct, were stably transfected into HT1080 cells, and LC3 protein (Fig 1A), FN protein (Fig. 1B), FN biosynthesis, (Fig. 1C), and steady state FN mRNA levels (Fig. 1D) were compared. LC3-WT and LC3-R/Q transfected cells expressed abundant LC3 protein in the form of a doublet compared to vector transfected cells where the protein was barely detectable (Fig.1A). The R/Q mutant LC3 protein doublet, when compared to the WT, was comprised of slightly downward shifted upper band that was increased in intensity and a lower band of reduced intensity. There was little LC3 present in the vector only transfected cells.
Figure 1
Figure 1
Stable transfection of HT1080 cells with LC3 induces FN synthesis
Western immunoblot showed a marked increase in steady-state levels of FN protein in the WT-LC3 when compared with the R/Q mutant and with the vector transfected cells (P< 0.01 for both comparisons) (Fig.1B). Similar results were obtained with assessment of newly synthesized FN secreted into the cultured media and measured following [35S]-methionine metabolic labeling as described in “Materials and Methods”. As shown in Fig. 1C, FN synthesis in LC3-WT was considerably elevated when compared to vector (P <0.005) or LC3-R/Q transfected clones (P <0.05), although there was also increased production of FN in LC3-R/Q transfected cells when compared to vector alone (P <0.01). Quantitative RT-PCR (Fig. 1D) revealed no significant differences in steady-state FN mRNA levels in the different transfected cells, supporting LC3 as mediating enhanced FN mRNA translation.
Polysome Analysis of FN mRNA in Stably-Transfected HT1080 Cells
We investigated the relative distribution of FN mRNA on polysomes using sucrose gradient analysis, to establish that the increase in fibronectin synthesis in LC3-WT transfected HT1080 cells is related to mRNA translation, and requires both the ARM of LC3 and the ARE of FN mRNA, The location of the monosomes/preinitiation complexes and of the polysomes was determined by ethidium bromide staining (data not shown), and the polysome RNA profile at 260 nm absorbance is illustrated in Fig 2A (top). Similar profiles were observed in LC3-WT and LC3-R/Q mutant transfected cells. RNA was extracted from each fraction and analyzed by quantitative RT-PCR.
Figure 2
Figure 2
Figure 2
Polysome analyses of stably-transfected HT1080cells suggest that enhanced FN mRNA translation is LC3-ARE dependent
In cells transfected with LC3-WT a major portion of human FN mRNA is associated with heavy polysomes and is thus actively translated (specifically fractions 8, 9, and 10), whereas in cells transfected with LC3-R/Q, more FN mRNA is associated with the lighter fractions (Fig 2B). As a negative control, we performed polysome analysis on c-Myc, a transcript with an ARE, that is not regulated by LC3. Transfection of LC3-WT vs. the LC3-R/Q mutant did not alter the polysome profile of c-Myc mRNA (Fig 2C), confirming the specificity of LC3 for the FN ARE in enhancing mRNA translation.
We saw an equivalent low level of FN mRNA across the sucrose gradient in cells that were stably transfected with vector only (data not shown). Treatment with EDTA resulted in the disruption of polysomes with little FN mRNA in fractions at the bottom of the sucrose gradient (data not shown). To address whether the ARE of the FN mRNA is important for FN mRNA translation, rat wild-type or ARE-deleted FN mRNA were transiently transfected into HT1080 cells that stably express LC3, and the distribution of rat FN mRNA on polysomes was analyzed. More wild-type rat FN mRNA, but not mutant ARE-deleted rat FN mRNA, was associated with heavy polysomes in HT1080 cells stably expressing LC3 (Fig. 2D).
To further establish the importance of the interaction between the ARM motif in LC3 and the ARE element in FN mRNA, we performed RNA electromobility gel shift assays. Cytoplasmic extracts from LC3-WT, LC-R/Q and vector transfected HT1080 cells were incubated with radiolabeled wild-type FN ARE (wtARE) RNA oligonucleotides and competition assessed using extracts from LC3 transfected cells and both excess cold wt ARE or an irrelevant oligonucleotide. Figure 2E is a representative blot of two different experiments, with a histogram of the intensities of the highlighted bands. The binding complexes formed between cytoplasmic extracts from LC3-WT transfected cells and radiolabeled wtARE are more abundant than those formed when using cytoplasmic extracts of cells transfected with LC3-R/Q or vector only. The binding (indicated by the arrow) is specific, as it was competed completely by excess of unlabeled FN ARE (LC3-WT+cold probe) and much less well by an oligonucleotide without the consensus ARE (LC3-WT+irrelevant probe). These data are consistent with optimization of LC3 interaction with FN mRNA requiring the ARM motif in LC3 and the ARE element in FN mRNA.
LC3 Regulates Cell Growth
Increased production of FN in tumor cells has been previously reported to revert the transformed phenotype by enhancing adhesion of cells to the substrate, changing their morphology from rounded to spread and decreasing their growth rate (Dean et al., 1988). We therefore assessed whether the increased FN mRNA translation in LC3-transfected HT1080 cells would alter the growth rate of the cells. As shown in Figure 3A, as early as 3 days after plating, and at 7 days, LC3-WT transfected cells, despite increased production of FN, exhibited significantly faster growth compared to both vector and LC3-R/Q transfectants (P<0.05 for each comparison at 3 days, and P <0.001 at 7 days). The difference in growth between vector-transfected and LC3-R/Q mutants was not significant on day 7 (Fig 3A). Similar results were observed using multiple clones (data not shown). To determine if LC3-WT transfected HT1080 cells could also promote tumor growth in an intact animal, SCID mice were injected subcutaneously with LC3-WT, LC3-R/Q or vector-only stably transfected HT1080 cells. Tumors were monitored in the mice as described in the Materials and Methods. The LC3-WT transfected HT1080 tumors reached a significantly larger volume when assessed both at 14, 18 days and 21 days post-injection when compared to both vector transfected and LC3-R/Q mutant cells (P <0.005 for each comparison) (Fig. 3B).
Figure 3
Figure 3
LC3 Increases proliferation of HT1080 cells in culture and in SCID Mice
To determine whether the increase in growth in LC3-WT transfected HT1080 cells was dependent on the increase in FN, RNA interference (i) was used to repress FN mRNA in both LC3-WT and vector-transfected cells. Efficient knockdown of FN protein (Fig. 4A, top panel) was observed at 72h, and in FN mRNA (Fig. 4A, bottom panel) at 48 hrs post-transfection of FN siRNA. We then showed, using the MTT assay, that the increase in cell proliferation in the LC3-WT compared to vector-transfected cells observed with control siRNA (P <0.05) was lost following transfection with FN siRNA (Fig. 4B). In vector-transfected cells in which FN was reduced by siRNA, cell proliferation was also reduced (P <0.01) (Fig. 4B).
Figure 4
Figure 4
Figure 4
Proliferation, adhesion and invasion of LC3-WT stably-transfected HT1080 cells is FN dependent
We observed that LC3-WT transfected cells treated with control siRNA were more adhesive on plastic compared to vector-transfected cells when cultured in medium containing bovine serum (Fig. 4C, 4D) and also without serum (data not shown). This feature was also related to production of FN, since cell adhesion was reduced by FN siRNA in LC3-WT cells (P <0.01) to levels observed in the control vector-transfected cells. Treating vector-transfected cells with FN siRNA further reduced their adhesion when compared to control siRNA treated cells (P <0.01). Moreover, culturing vector-transfected cells on FN-coated dishes enhanced their adhesion to the levels observed with LC3-WT transfected cells (Fig. 4D), and this was not significantly changed with FN siRNA. LC3 WT cells cultured on FN showed a further increase in adhesion than LC3 WT cells cultured on plastic, that was also not significantly reduced by FN siRNA. These experiments confirm the ability of exogenous FN to rescue the loss of adhesion attributed to reduced endogenous production of FN by siRNA.
To assess the contribution of FN to invasion, we carried out Matrigel invasion assays on LC3-WT and vector transfected HT1080 cells, as described under “Materials and Methods”. Tumor cell invasion was increased in LC3-WT transfected cells treated with control siRNA compared to vector-transfected cells (P <0.05) but, following treatment with FN siRNA, values were reduced to those in vector-transfected cells (P<0.05). Invasion was further reduced in vector-transfected cells using FN siRNA vs. control siRNA (P <0.05) (Fig. 4E). The presence of some invasion despite very low levels of FN induced by siRNA in LC3 transfected HT1080 cells, suggests additional LC3-dependent features that might contribute to invasion in these cells.
Gene Expression Profile of HT1080 Cells Stably-transfected with LC3
To identify the specific genes regulated by LC3 in HT1080 cells, we performed analyses using the significance analysis of microarrays (SAM), described under “Materials and Methods”. Nine up-regulated and eight down-regulated genes were confirmed by qRT-PCR. Confirmed up-regulated genes are listed in Table 1. Of these, the experiment revealed a significant increase in expression of six genes associated with adhesion in the LC3-WT transfected HT1080 cells, one of which, connective tissue growth factor (CTGF), has been consistently implicated in tumor growth and invasion (Aikawa et al., 2006; Planque and Perbal, 2003).
Table 1
Table 1
Genes Upregulated in LC3-WT Stably Transfected HT1080 Cells.
We therefore first confirmed an increase in expression of CTGF in LC3-WT vs. vector-transfected cells both by western immunoblot (Fig. 5A) and by qRT-PCR (Fig. 5B). To relate the increase in CTGF to FN, we further showed that loss of FN in LC3-WT transfected cells induced by FN siRNA resulted in a 72% reduction in CTGF protein, down to levels in vector- transfected cells. In vector-transfected cells, FN siRNA further reduced CTGF protein by 70% (P <0.001) (Fig. 5B). We also showed, by immunohistochemistry, an increase in both FN and CTGF in LC3-WT vs. vector-transfected tumors, in association with a greater number of blood vessels as shown by PECAM immunostaining (P <0.05) (Fig. 5C).
Figure 5
Figure 5
Figure 5
CTGF increase in LC3-WT stably transfected HT1080 cells is FN-dependent
FN-Mediated Proliferation, Adhesion and Invasion of HT1080 cells is CTGF-dependent
To determine whether FN mediates the increase in proliferation, adhesion, and invasion of LC3-WT vs. vector-transfected cells through heightened production of CTGF, these features were assessed in cells treated with CTGF siRNA. We reduced levels of CTGF protein and mRNA more than 80% by siRNA, as assessed by western immunoblot (Fig. 6A, top panel) and by quantitative RT-PCR (Fig. 6A, bottom panel) in both LC3-WT and vector-transfected cells. Adhesion, invasion and proliferation of HT1080 cells transfected with LC3-WT were reduced by CTGF siRNA to values below those observed in vector-transfected cells treated with control siRNA either in the presence of serum (Fig. 6B, 6C, 6D) or in its absence (not shown). Both vector and LC3-WT transfected HT1080 cells showed reduced adhesion following treatment with CTGF siRNA in the presence or absence of FN coating on the plates (P<0.05 for both) (Fig.6B). Following treatment with control siRNA, vector-transfected cells shown increased adhesion on FN coated plates, to the level observed in LC3-WT transfected cells. The decreased adhesion of LC3 vector and LC3-WT transfected cells that was evident following treatment with CTGF siRNA, was not significantly rescued by plating the cells on FN. This confirms that CTGF is acting downstream of FN,
Figure 6
Figure 6
Figure 6
CTGF is necessary for enhanced adhesion, invasion and proliferation of LC3-WT stably transfected HT1080 cells
Gene Expression Profile of LC3 and CTGF in Soft Tissue Tumors
As the HT1080 cell line was derived from a fibrosarcoma, we looked at a number of human soft tissue tumors (benign mesenchymal tumors and sarcomas) for expression of LC3 and CTGF. Data from previous expression profiling studies on soft tissue tumors (West and van de Rijn, 2006) indicated increased expression of both LC3 and CTGF in some tumor types (e.g., desmoid-type fibromatosis and epithelial hemangioendothelioma) but not in other soft tissue tumors such as myxoid liposarcoma (Fig. 7). Tumor necrosis factor alpha and TGFβ stimulate production of LC3 (O’Blenes et al., 2001) and FN (Dean et al., 1988), respectively. There was however, no convincing evidence that mRNA expression of LC3 and CTGF tracked with TGFβ or TNFα.
Figure 7
Figure 7
LC3 and CTGF expression in soft tissue tumors
In the present study we provide data demonstrating that LC3, as a consequence of enhancing FN mRNA translation, increases CTGF levels, and this produces a faster growing, more adhesive and more invasive fibrosarcoma cell both in culture and in a living animal. Data from previous expression profiling of 239 soft tissue tumors showed that coordinated expression of both LC3 and CTGF was present in some invasive tumor types.
In our previous studies, we produced a variety of peptides from a recombinant LC3-GST fusion protein and determined that a 27bp region of LC3 appeared to be required for binding to the ARE of FN mRNA (our unpublished data). Present in this region is an RNA binding motif containing three consecutive arginine residues, that also influences mRNA translation (Lewis et al., 1998) as well as mRNA stability (Shaw and Kamen, 1986; Treisman, 1985). However, prior to our observations, these arginine motifs (ARMs) were shown to have RNA binding properties only in proteins from bacteriophages and viruses (Weiss and Narayana, 1998). As a control for our experiments, we constructed an LC3 transcript in which the ARM was mutated with an arginine to glutamine (LC3-R/Q) substitution that neutralized the positive charge, and that greatly reduced ARE binding activity. The mutant LC3 protein was stable and formed a doublet at 16kDa, but it appeared somewhat different from the WT protein in that the upper band was more intense than the lower band and it was also shifted slightly downward. Our previous studies related the lower band of the doublet to the phosphorylated form of LC3 that is associated with the pelleted membranes of the cell and with the polyribosomes necessary for mRNA translation (O’Blenes et al., 2001). The lower band is also associated with a longer sequence (Kabeya et al., 2000). The inability of LC3-R/Q to increase FN synthesis and thus maintain steady state levels of FN protein similar to those observed in LC3-WT transfected HT1080 cells is consistent with a relative impairment in translation of FN mRNA. This is supported by the polysome analysis that shows that in LC3-WT transfected cells, as opposed to LC3-R/Q mutant cells, there is an increase in FN mRNA transcripts in the heavy polysomes. Transfecting the LC3-WT cells with the rat WT FN construct, but not with an ARE-deleted mutant construct, also showed increased distribution of the WT FN rat mRNA in the heavy polysomes. This confirms previous studies by our group in vascular smooth muscle cells, that showed that ARE is critical to the function of LC3 in increasing FN mRNA translation (Zhou et al., 1997). However, it is also clear from these and previous studies that the presence of an ARE alone does not confer increased translation in the presence of LC3. For example, the c-Myc transcript, has an ARE known to be an mRNA stability element, but LC3 does not regulate translation of c-Myc mRNA.
LC3 has functions in addition to translation of FN mRNA, and these include possible roles in microtubule assembly (Hammarback et al., 1991), in mRNA transport (Seidenbecher et al., 2004), and in autophagy (Kabeya et al., 2000; Kabeya et al., 2004). In the future, these functions could be assessed in the HT1080 cells transfected with LC3. Interestingly, loss of function of LC3 in a knockout mouse reported by our group, has no autophagy phenotype (Cann et al., 2008).
The LC3 transfected HT1080 cells appeared to be more highly proliferative both in culture and when implanted into SCID mice. Studies in cultured cells were subsequently carried out to determine whether we could account, at least in part, for this phenotype by an LC3-mediated increase in FN synthesis alone. Previous studies have attributed a FN-mediated increase in the adhesive properties of tumor cells as being responsible for their reduced proliferation (Dean et al., 1988). More recent studies have shown that fibronectin interaction with α5β1 (Aguirre-Ghiso et al., 2003) as well as α3β1 integrins increases tumor cell growth, as well as invasion by activating MMP-9 and Rac1 (Wei et al., 2007). Hence, the context is clearly important, and suggests that in response to LC3, coordinate regulation of genes at the transcriptional and post-transcriptional level may be necessary to produce the FN-dependent proliferative and invasive responses. In keeping with this, our studies show that LC3, via FN, also promotes cell adhesion, a property previously shown to be necessary for the migration of fibrosarcoma cells (Zaman et al., 2006) and vascular cells (Boudreau et al., 1991) in 3D matrices.
To address whether FN-cell interaction might be inducing other genes that are required to enhance HT1080 cell adhesion, invasion and proliferation, we carried out microarray analysis to compare LC3-WT and vector transfected HT1080 cells. Although a number of transcripts were upregulated, one, CTGF, stood out as being critical to the mechanism associated with our findings, and its upregulation was confirmed by qRT-PCR to be both LC3 and FN-dependent. While it is possible that LC3 increases CTGF mRNA by increasing mRNA stability, the dependence of enhanced CTGF expression on FN, suggests an indirect effect of LC3. Overexpression of CTGF has been shown in a number of cancers (Croci et al., 2004; Koliopanos et al., 2002; Kubo et al., 1998; Moritani et al., 2003; Pan et al., 2002; Shakunaga et al., 2000; Vorwerk et al., 2002; Wenger et al., 1999; Xie et al., 2001; Xie et al., 2004; Zeng et al., 2004), but its direct role in tumor suppression or progression has not been characterized.
CTGF is a cysteine-rich secreted protein, belonging to a group of immediate-early genes induced by growth factors, such as TGF-β, or certain oncogenes. CTGF promotes proliferation and migration of vascular endothelial cells (Takigawa et al., 2003) and stimulates human mesangial cell adhesion to fibronectin (Weston et al., 2003). CTGF stimulates mesenchymal cells, including fibroblasts, chondrocytes and osteoblasts, to proliferate and to produce connective tissue components such as collagen type 1 and FN, while also remodeling the extracellular matrix (Blom et al., 2001; Frazier et al., 1996), and promoting granulation tissue formation (Chen et al., 2001). In mice, CTGF mediates endothelial cell adhesion and migration through interaction with the αvβ3 integrin, and induces endothelial cell survival and angiogenesis (Shimo et al., 2001). Thus, heightened expression of CTGF may contribute to the angiogenic response that supports HT1080 cell growth in addition to the proliferative and invasive response of the cells per-se.
It is interesting that whereas CTGF was shown to induce FN (Blom et al., 2001; Frazier et al., 1996), in our study, the expression of CTGF is FN-dependent. This may imply a positive feedback mechanism that promotes the features of tumorigenesis by amplifying the interaction of both FN and CTGF with integrin receptors, including ανβ3 αIIbβ3 and α3β1 (Chen et al., 2001; Gao and Brigstock, 2006; Jedsadayanmata et al., 1999; Lymn et al., 2002). Future studies could address whether loss of CTGF also reduces FN. In addition, it would be of interest to further investigate whether LC3-mediated enhanced synthesis of FN can, by inducing integrin linked kinase (ILK), mediate transcriptional activity of factors upstream of the CTGF promoter, such as AP1 (Troussard et al., 2000; Troussard et al., 1999). ILK activation downstream of fibronectin-integrin interaction can induce an invasive phenotype via AP-1-dependent upregulation of matrix metalloproteinase MMP-9 (Troussard et al., 2000). It is intriguing, however, that FN induced production of CTGF was sufficient to explain the proliferative and invasive phenotype of the cultured HT1080 cells.
Our subsequent studies show co-expression of LC3 and CTGF mRNA in at least some soft tissue tumor types such as desmoid type fibromatosis but not others. Further prospective phenotyping studies and confirmation of the microarray data by qRT-PCR are necessary to indicate whether these factors could serve as important new biomarkers. Our previous studies have shown that TNF alpha upregulates FN in coronary artery smooth muscle cells via LC3 (O’Blenes et al., 2001) and TNF alpha is known to upregulate CTGF (Cooker et al., 2007), so it would be interesting to know whether TNF could mediate an increase in CTGF and FN via LC3 in HT1080 cells. TGF beta also stimulates production of FN (Dean et al., 1988). While there is no obvious coordinate expression of these cytokines with CTGF and LC3, it would be interesting to establish in future prospective studies, whether the subset of tumors with the increase in LC3 and CTGF have a cytokine signature.
Materials
DMEM, aminoglycoside G418, and fetal bovine serum (FBS) were from Invitrogen (Carlsbad, CA). All radiolabeled materials were obtained from Amersham Corp. (Arlington Heights, IL) and the HT1080 human fibrosarcoma cell line and MTT Cell Proliferation Assay kit were from ATCC (Manassas, VA). The pCR3-LC3 expression plasmid was kindly supplied by Dr. J. Hammarback, Department of Neurobiology and Anatomy, Wake Forest (Bowman Gray) School of Medicine, Winston-Salem, NC, and was generated and characterized as previously described (Mann and Hammarback, 1994). The polyclonal antibodies to LC3 were either supplied by J. Hammarback or made to the same N-terminal sequence by AnaSpec Inc. (San Jose, CA). Peroxidase-conjugated donkey anti-rabbit IgG secondary antibody was from Amersham. Mouse monoclonal anti-FN IgG was from Neomarker (Fremont, CA), rabbit polyclonal antibody to CTGF was from Abcam Inc (Cambridge, MA), fluorescein-conjugated goat-anti-mouse IgG secondary antibody and the enhanced chemiluminescence (ECL) western immunoblotting reagents were from Amersham. 18-mer RNA oligonucleotides containing either the wild type consensus sequence in bold (ACCUGUUAUUUAUCAAUU) of the AU-rich element (ARE) of the FN mRNA, or the non-ARE irrelevant consensus sequence (AGAGCGGGAGGGAGU), were synthesized by Stanford Protein and Nucleic Acid Biotechnology Facility, Stanford University (Stanford, CA). Plasmids pENTR and pDEST26 were obtained using the Gateway cloning system (Invitrogen) and mutagenesis was carried out using a kit from Stratagene (La Jolla, CA). Reagents for transfection were Lipofectin 2000 (Invitrogen), SuperFect (Qiagen, Valencia, CA) or FuGENE (Roche Diagnostics, Pleasanton CA). Antifade reagent was purchased from Molecular Probes Inc. (Eugene, OR). Gelatin 4B-Sepharose was from Pharmacia Biotech Inc. (Piscataway, NJ), Bis-Tris gel and Novex tricine gel was from Invitrogen. Nitrocellulose membranes and BCA protein assay kits were from Bio-Rad Laboratories (Hercules, CA). Qiagen RNA extracting kit and SuperFect Reagent were from Qiagen Inc. NucTrap Probe Purification Column was from Stratagene. All other chemicals unless otherwise specified, were of molecular biology grade and purchased from Sigma.
Plasmid Constructs and Site-Directed Mutagenesis
To transfect the HT1080 cells, plasmid pCR3-LC3 was kindly provided by Dr J. Hammarback. The mutant pCR3-LC3 vectors containing the full length LC3 sequence were generated by PCR. The primers for LC3-R/Q are: 5′-ATTCAAC AGCAACTGCAGCTCAAT-3′ and 5′-CAGTTGCTGTTGAATTATCTTGAT-3′. Restriction enzyme sites were introduced by a 5′-end primer 5′-GAGCTCGGATCCACTAGTCCAGTGTG GTGG-3′ and a 3′-end primer 5′-GTCACCGCCGGCGAGCTCAGATCTCCCGGG-3′ flanking the insertion site. The 963-bp BamHI-XbaI fragments containing the mutated sites were then used to replace the corresponding fragment within wild type pCR3-LC3. All constructs were confirmed by restriction enzyme mapping, and the mutations were verified by DNA sequencing. To construct a second LC3-R/Q mutant for stable transfection in HT1080 cells, the primer sequences used were: 5′-GAGCGAACTCATCAAGATAATTCAACAGCAACTGCAGCTCA ATGCTAACCAAGCC-3′, and its complementary sequence 5′-GGCTTGGTTAGCATTGAGCT GCAGTTGCTGTTGATTATCTTGATGAGTTCGCTC-3′).
Construction of Rat FN Expression Vectors
Rat FN cDNA and its 3′UTR was cloned into a pDEST26 expression vector using the Gateway cloning system (Invitrogen). This was done by first joining the FN coding region and 3′UTR using a pENTR vector. Briefly, a full-length cDNA of FN was PCR amplified from a retroviral rat FN expression plasmid (a gift from Dr. Richard O. Hynes, Department of Biology, Massachusetts Institute of Technology), using 5′ primers containing a terminal CACC site for directional cloning (5′-CACCATGCTCAG GGGTCCGGGAC-3′) and a 3′ primer containing an XbaI site (CATCTAGAGGGGCGATGCT TGGAGAAGC-3′). The fragment was then cloned into pENTR vector to form pENTR/rFN. A 3′UTR PCR fragment amplified from rat EST clone #ERN1017 (Open Biosystem, Hurtsville, AL) using a forward primer containing an XbaI site (5′CACCTCTAGAGATGTTTTGAGACTT C-3′) and a reverse primer 5′-GATCAAGAAAGCTGGGTCGGCGCGCCCA-3′, and was cloned into the pENTR vector in a similar fashion to form a pENTR/3′UTR clone. Thus the entry clone pENTR/rFN-3′UTR was generated by ligating an XbaI/AscI fragment of 3′UTR from pENTR/3′UTR to pENTR/rFN linearized using the same restriction enzymes. The final clone was generated by using LR recombination technology to introduce the rFN-3′UTR fragment into a CMV containing expression vector, the pDEST26 vector. An ARE deletion clone was generated within the pENTR/3′UTR using QuickChange Mutangenesis Kit (Stratagene, La Jolla, CA). Primers used for mutagenesis were: Forward: 5′-GCCTAGAAATATCTTTCTCTTACCT GCAATTTTTCCCAGTATTTTTATACG-3′ and its complementary sequence as 3′ reverse primer: 5′-CGTATAAAAATACTGGGAAAAATTGCAGGTAAGAGAAAGATATTTCTAGG C-3′. Both the FN Wild-type and ARE deleted sequences were confirmed by sequence analysis.
Cell Culture and Transfection
The HT1080 human fibrosarcoma cells were grown as previously described (Dean et al., 1988) and plated at a density of 105 cells/100 mm dish 24 h prior to transfection. Wild type and mutant LC3 constructs were prepared as described below. Ten μg of empty vector (pCR3), wild type pCR3-LC3 (LC3-WT) plasmid or mutant pCR3-LC3/R68-70Q (LC3-R/Q), plasmid, were used to transfect each dish for 3 h using SuperFect or FuGENE transfection reagent, according to manufacturer’s instructions. The cells were then fed with fresh complete medium containing 200 μg/ml aminoglycoside G418. The media were changed every two days with gradually increasing concentrations of G418 up to 800 μg/ml. Eight clones transfected with empty vector and 24 clones each transfected with LC3-WT and LC3-R/Q, were selected on the basis of resistance to G418 (800 μg/ml) by trypsinization and screened for LC3 expression using western immunoblot analysis. Five clones each were verified to express LC3-WT and LC3-R/Q. These clones, together with three vector-transfected clones were expanded individually and passaged at least three times before use. To determine the role of the ARE in the FN 3′UTR, transient transfections were carried out using the wild type and mutant rat FN constructs described above. In these experiments, HT1080 cells were grown to 80% confluence in 6-well plates and transfected with 4 μg of plasmid DNA using Lipofectin 2000 for 48 h, following the manufacturer’s instructions.
Western Immunoblot Analysis
LC3-WT and LC3-R/Q transfected HT1080 cells were harvested at semi-confluence and cell fractionation and western immunoblots were performed as previously described (Mason et al., 1999a). Protein extracts (20 μg) in Laemmli sample buffer (5% β-mercaptoethanol, 2% SDS, 10% glycerol, 62.5 mM TRIS-HCl pH 6.8) were separated on a 4–12% Bis-Tris gel (Novex) and transferred to a nylon membrane (Invitrogen). Membranes were probed for 1.5 h at room temperature with polyclonal antibodies to LC3 (1:3000) or FN (1:1000) or CTGF (1:1000), β-actin (1:5000) as control, and incubated with goat anti-rabbit HPR (1:5000) for LC3 and β-actin, or anti-mouse HPR (1:5000) for FN and CTGF, using the ECL detection system.
FN Biosynthesis
HT1080 cells individually expanded from vector-transfected, LC3-WT or mutant LC3-R/Q transfected clones were plated on 6-well dishes at a density of 5×105 cells/well. After 24 h, cells were labeled with [35S]-methionine (10 μCi/ml) for five hours, and FN was purified by gelatin sepharose affinity and analyzed as previously described (Mason et al., 1999b).
RNA Isolation
Total RNA was isolated from HT1080 cells using TRIzol Reagent (Invitrogen) according to the manufacturer’s instructions, and further purified using QIAGEN RNA Clean up kit. RNA quality was assessed by the integrity of rRNA bands following gel electrophoresis, and quantified by UV spectrophotometry.
Polysome Analysis
Polysome mRNA was prepared as previously described (Johannes et al., 1999). Briefly, cells were incubated with 0.1 mg/ml cycloheximide for 3 min at 37°C before being harvested. Cells were washed with PBS, and lysed directly on the plate in high salt lysis buffer. The supernatants were loaded onto 10–50% sucrose gradients and sedimented at 35,000 rpm for 2.5 h in a SW41 rotor at 4°C. Fractions of equal volume were collected from the top using a fraction collector system (ISCO) and mRNAs were precipitated in 4 M guanidine HCl after the addition of ethanol. Equal volumes of each sample were analyzed by quantitative RT-PCR as described below. All analyses were performed three times and representative experiments are shown. As a control, an EDTA release experiment was also performed in which MgCl2 was substituted with 15 mM EDTA in the extraction buffer and the gradient.
Quantitative RT-PCR
For polysome RNA, quantitative RT-PCR was performed using FAM labeled TaqMAN probes for either human or rat FN following verification that the probes could distinguish the different transcripts. We also assessed c-Myc, a control transcript with an ARE. Equal volumes (11 μl) of RNA containing samples from each fraction were used for reverse transcription (RT) using Superscript III (Invitrogen) in a final reaction volume of 20 μl, following the manufacturer’s protocol. Quantitative RT-PCR reactions were carried out in 384-well plates in a 20 μl volume containing 4 μl of cDNA, 5 μl of water, 1 μl of TaqMAN probe and 10 μl super master mix buffer (ABI, Foster City, CA). The PCR reactions were run in an ABI 7700 sequence detector (Applied Biosystems, Foster City, CA) under cycle conditions following the manufacturer’s instruction. The relative amount of RNA expression was calculated using a comparative CT method. Values were assessed un-normalized or normalized to 18S RNA with similar results. An equal amount of mouse RNA (100 ng) was added to each sample to monitor the RT efficiency.
To quantify selected transcripts from HT1080 stable cells, 2 μg of total RNA were reverse transcribed, and 50 ng of the RT reaction used for quantitative PCR. The probes used for qRT-PCR were: FN1 (Hs00415006_m1), CTGF (Hs00170014_m1), THBS1 (Hs00170236_m1), CDH11 (Hs00156438_m1), COL6A3 (Hs00189128_m1), COL12A1 (Hs00189184_m1), DSC1 (Hs00245189), INHBA (Hs00170103_m1), EGFR (Hs00193306_m1) and TRIB1 (Hs00179769_m1).
RNA-Protein Binding Assay
Cytoplasmic extracts were obtained from fibrosarcoma cells transfected with vector, LC3-WT and mutant LC3-R/Q, using the NE-PER kit (Pierce Biotechnology, Rockford, IL) and following manufacturer’s instructions. A total of 60 μg of cytoplasmic extracts were incubated for 30 minutes in a binding reaction containing γ-32P–labeled single-stranded oligonucleotides with the FN ARE sequence (ACCUGUUAUUUAUCAAUU), 100 mM KCl, 20 mM HEPES, 0.2 mM EDTA, 0.5 mM DTT, 20% glycerol, 500 ng of salmon sperm and 0.01 units of Poly (dI-dC). Signal specificity was ensured by competition reactions using a 50-fold excess (1.25pM) of non- radiolabeled (cold) fibronectin ARE oligonucleotide, compared to an irrelevant radiolabeled oligonucleotide containing no ARE (AGAGCGGGAGCAGGAAGU). Samples were run on a 6% polyacrylamide gel in 1X TBE buffer at 150V for two hours. The gel was then dried, and exposed to autoradiographic film overnight at −80°C. The volume of bands was quantified using densitometry.
Cell Proliferation Assays
HT1080 cells stably expressing empty vector, LC3-WT or LC3-R/Q were plated on 6-well dishes at a density of 1×105 cells/well. Cells were trypsinized every 24 h for a three-day course and every 72 h for a one-week course. Cell number was determined using Coulter Flow Cytometers with light scatter (Coulter Cooperation, Miami, FL). The results were confirmed by manually counting the cells using a hemocytometer. The mean cell number from three separate wells was calculated. Each experiment was repeated at least three times. In experiments using siRNA, we assessed cell proliferation by the rate of DNA synthesis using the MTT Cell Proliferation Assay kit (ATCC) in accordance with the manufacturer instructions. Briefly, 48 h following siRNA transfection, 1×103 cells were aliquoted into 96-well plates and incubated at 37°C for 24 h in 100 μl of serum free growth medium, to which 10 μl MTT reagent were added. Cells were left at room temp in the dark for two hours after addition of 100ul Detergent Reagent. The plate was read in a spectrophotometer at absorbance 570 nm and the rate of DNA synthesis was determined as the average of triplicate wells.
Tumor Model
HT1080 Fibrosarcoma cells were cultured as described above, and the cell concentration adjusted to 8×106 cells/ml. Mice were shaved and the dorsal skin was cleaned with ethanol before tumor cell injection. A suspension of 2×106 cells in 0.2 ml PBS (with Ca++) was injected into the subcutaneous dorsa of mice at the proximal midline. The mice were weighed and tumors were measured starting on day 14 after injection. Tumor volumes were determined using the formula length × width × height × 3.14/6. At the end of each experiment, the mice were euthanized with methoxyflurane (Pittman-Moore Inc.) and the tumors were isolated and frozen for sectioning.
Adhesion Assay
Adhesion assays were performed as described by Keisuke et al, with minor modifications (Ishida Keisuke et al 2004). We suspended 1×104 HT1080 cells in DMEM, with or without 10% FCS, and incubated the cells at 37°C for 1 h in 24-well plates that were either uncoated or coated with fibronectin (Becton Dickinson Labware, Bedford, MA). Both vector and LC3-WT cells were transfected either with control siRNA or FN siRNA or CTGF siRNA for 48 hours before the adhesion assay. The plates were washed with PBS, and the adherent cells were fixed and stained with DIFF QUICK Staining kit (IMEB Inc, San Marcos, CA). Cells in five random fields in each well were counted, and the mean value was calculated. Values from three separate wells were calculated for each experimental condition.
Invasion Assay
HT1080 cells grown to 80–90% confluence and 5×104 cells/ml were resuspended in culture medium containing 0.1% BSA. Cell invasion was evaluated using Growth Factor Reduced (GFR) Matrigel Invasion Chambers (Becton Dickinson) with an 8-micron pore size PET membrane. The membrane has a thin layer of GFR Matrigel matrix that serves as a reconstituted basement membrane in vitro. We added 0.75 ml of 5% FBS to each well as a chemoattractant, and 0.5 ml of the cell suspension (2.5×104 cells) were added to each well. The Matrigel Invasion Chambers were then incubated for 24 h in a humidified, 5% CO2 tissue culture incubator at 37°C. Noninvasive cells were removed from the upper surface of the membrane with a cotton swab before staining. Invasive cells on the underside of the membrane, were stained with DIFF QUICK Staining kit, and observed microscopically. The cell number from five random fields was counted and averaged. Equal numbers of BD BioCoat Control Inserts (without the GFR Matrigel coating) were included as controls. The invasion rate is expressed as the number of cells migrating through the GFR Matrigel matrix and membrane, relative to the number of cells migrating through the control (uncoated) membrane. Invasion assays were performed in triplicate wells and the counts averaged, and at least three separate experiments were conducted for each condition.
RNA-interference Transfection
RNA-interference (RNAi) was induced by transient transfection using 100 nM short-interfering RNA (siRNA) oligonucleotides complexed with Lipofectamine 2000 (Invitrogen) as per the manufacturer’s instructions. Stealth selected RNAi were purchased from Invitrogen (Catalog numbers: FN1, #HSS103782; CTGF, #HSS102444).
Microarray Analyses
Gene-expression profiling was performed essentially as reported previously (Perou et al., 2000), and detailed protocols for array fabrication and hybridization are available online (Dr. Patrick Brown’s Lab Protocols, http://brownlab.stanford.edu/protocols/). Briefly, Cy5-labeled cDNA was prepared using total RNA from HT1080 cells or from frozen sarcoma tumor specimen, and Cy3-labeled cDNA was prepared using equal amount of total RNA common reference total RNA (Stratagene). For each experimental sample, Cy5- and Cy3-labeled samples were hybridized to a cDNA microarray containing 42,000 human cDNAs, representing 28,000 different genes or ESTs (http://www.microarray.org/sfgf/). Microarrays were imaged using an Axon GenePix 4000 scanner (Axon Instruments). Fluorescence ratios for array elements were extracted using GenePix software. Control and empty spots on the arrays were not included for the analysis, as well as those spots flagged as bad spots due to technical errors. Differentially expressed genes were identified using significance analysis of microarrays (SAM) method (Tusher et al., 2001).
Immunofluorescence
Frozen tissues were sectioned and fixed with ice cold methanol for 20 min at 4°C prior to incubation with monoclonal mouse anti-Fibronectin (1:500) (Neomarker) and rabbit anti-CTGF (1:500) (Abcam) antibodies at 4°C overnight. Immunofluorescence was detected using goat anti-rabbit Alexa Fluor® 488 nm and goat anti-mouse Alexa Fluor® 594 nm secondary antibodies (Molecular Probes, Eugene, OR, USA) and slides were mounted using SlowFade® anti-fade with DAPI (Molecular Probes). Images were captured using a Leica DMRA2 microscope.
Immunohistochemistry
To detect tumor blood vessels, the frozen sections were stained with rat anti CD 31 (PECAM) antibody. Slides were fixed in cold acetone, air dried and then incubated in 0.3% hydrogen peroxide. CD 31 (anti-PECAM) primary antibody was added (1:50) for one hour followed by incubations with goat anti rat-biotinylated (1:100) and Streptavidin-HRP (1:500) antibodies for 30 min each. The mean density of PECAM staining/surface area was measured using ImageJ software, in five random areas per slide and three slides per tumor, and mean PECAM density/tumor surface area was calculated.
Statistical Analyses
For comparisons between groups, data were subjected to ANOVA followed by Bonferroni’s test of multiple comparisons to determine which groups were different. P <0.05 was judged to represent a statistically significant difference.
Acknowledgments
This work was funded by an endowment from the Vera Moulton Wall Center for Pulmonary Vascular Disease, Stanford University School of Medicine, and by NIH grant R01 HL074186 to M. Rabinovitch.
We thank Dr J. Hammarback (Wake Forest) for providing anti-LC3 antiserum and LC3 cDNA and Dr. Richard Hynes as the Massachusetts Institute of Technology for the fibronectin cDNA.
Footnotes
1The abbreviations used are: FN, fibronectin; LC3, light chain 3; ARE, AU-rich element; ARM, arginine-rich motif; UTR, untranslated region; CAT, chloramphenicol acetyl transferase; WT, wild type; SMC, smooth muscle cell.
  • Aguirre-Ghiso JA, Estrada Y, Liu D, Ossowski L. ERK(MAPK) activity as a determinant of tumor growth and dormancy; regulation by p38(SAPK) Cancer Res. 2003;63:1684–95. [PubMed]
  • Aikawa T, Gunn J, Spong SM, Klaus SJ, Korc M. Connective tissue growth factor-specific antibody attenuates tumor growth, metastasis, and angiogenesis in an orthotopic mouse model of pancreatic cancer. Mol Cancer Ther. 2006;5:1108–16. [PubMed]
  • Blom IE, van Dijk AJ, Wieten L, Duran K, Ito Y, Kleij L, deNichilo M, Rabelink TJ, Weening JJ, Aten J, et al. In vitro evidence for differential involvement of CTGF, TGFbeta, and PDGF-BB in mesangial response to injury. Nephrol Dial Transplant. 2001;16:1139–48. [PubMed]
  • Boudreau N, Turley E, Rabinovitch M. Fibronectin, hyaluronan, and a hyaluronan binding protein contribute to increased ductus arteriosus smooth muscle cell migration. Dev Biol. 1991;143:235–47. [PubMed]
  • Cann G, Guignabert C, Ying L, Deshpande N, Bekker J, Wang L, Zhou B, Rabinovitch M. Developmental expression of LC3α and β: Absence of fibronectin or autophagy phenotype in LC3β knockout mice. Dev Dyn. 2008;237:187–195. [PubMed]
  • Caput D, Beutler B, Hartog K, Thayer R, Brown-Shimer S, Cerami A. Identification of a common nucleotide sequence in the 3′-untranslated region of mRNA molecules specifying inflammatory mediators. Proc Natl Acad Sci U S A. 1986;83:1670–4. [PubMed]
  • Chen CC, Chen N, Lau LF. The angiogenic factors Cyr61 and connective tissue growth factor induce adhesive signaling in primary human skin fibroblasts. J Biol Chem. 2001;276:10443–52. [PubMed]
  • Clausell N, Molossi S, Rabinovitch M. Increased interleukin-1 beta and fibronectin expression are early features of the development of the postcardiac transplant coronary arteriopathy in piglets. Am J Pathol. 1993;142:1772–86. [PubMed]
  • Cooker L, Peterson D, Rambow J, Riser M, Riser R, Najmabadi F, Brigstock D, Riser B. TNF-alpha, but not IFN-gamma, regulates CCN2 (CTGF), collagen type I, and proliferation in mesangial cells: possible roles in the progression of renal fibrosis. Am J Physiol Renal Physiol. 2007;293(1):F157–65. [PubMed]
  • Croci S, Landuzzi L, Astolfi A, Nicoletti G, Rosolen A, Sartori F, Follo MY, Oliver N, De Giovanni C, Nanni P, et al. Inhibition of connective tissue growth factor (CTGF/CCN2) expression decreases the survival and myogenic differentiation of human rhabdomyosarcoma cells. Cancer Res. 2004;64:1730–6. [PubMed]
  • Dayton ET, Powell DM, Dayton AI. Functional analysis of CAR, the target sequence for the Rev protein of HIV-1. Science. 1989;246:1625–9. [PubMed]
  • Dean DC, Newby RF, Bourgeois S. Regulation of fibronectin biosynthesis by dexamethasone, transforming growth factor beta, and cAMP in human cell lines. J Cell Biol. 1988;106:2159–70. [PMC free article] [PubMed]
  • Frazier K, Williams S, Kothapalli D, Klapper H, Grotendorst GR. Stimulation of fibroblast cell growth, matrix production, and granulation tissue formation by connective tissue growth factor. J Invest Dermatol. 1996;107:404–11. [PubMed]
  • Gao R, Brigstock DR. A novel integrin alpha5beta1 binding domain in module 4 of connective tissue growth factor (CCN2/CTGF) promotes adhesion and migration of activated pancreatic stellate cells. Gut. 2006;55:856–62. [PMC free article] [PubMed]
  • Hammarback JA, Obar RA, Hughes SM, Vallee RB. MAP1B is encoded as a polyprotein that is processed to form a complex N-terminal microtubule-binding domain. Neuron. 1991;7:129–39. [PubMed]
  • Hynes RO, Lander AD. Contact and adhesive specificities in the associations, migrations, and targeting of cells and axons. Cell. 1992;68:303–22. [PubMed]
  • Iwai S, Pritchard C, Mann DA, Karn J, Gait MJ. Recognition of the high affinity binding site in rev-response element RNA by the human immunodeficiency virus type-1 rev protein. Nucleic Acids Res. 1992;20:6465–72. [PMC free article] [PubMed]
  • Jedsadayanmata A, Chen CC, Kireeva ML, Lau LF, Lam SC. Activation-dependent adhesion of human platelets to Cyr61 and Fisp12/mouse connective tissue growth factor is mediated through integrin alpha(IIb)beta(3) J Biol Chem. 1999;274:24321–7. [PubMed]
  • Johannes G, Carter MS, Eisen MB, Brown PO, Sarnow P. Identification of eukaryotic mRNAs that are translated at reduced cap binding complex eIF4F concentrations using a cDNA microarray. Proc Natl Acad Sci U S A. 1999;96:13118–23. [PubMed]
  • Jones PL, Cowan KN, Rabinovitch M. Tenascin-C, proliferation and subendothelial fibronectin in progressive pulmonary vascular disease. Am J Pathol. 1997;150:1349–60. [PubMed]
  • Kabeya Y, Mizushima N, Ueno T, Yamamoto A, Kirisako T, Noda T, Kominami E, Ohsumi Y, Yoshimori T. LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. Embo J. 2000;19:5720–8. [PubMed]
  • Kabeya Y, Mizushima N, Yamamoto A, Oshitani-Okamoto S, Ohsumi Y, Yoshimori T. LC3, GABARAP and GATE16 localize to autophagosomal membrane depending on form-II formation. J Cell Sci. 2004;117:2805–12. [PubMed]
  • Koliopanos A, Friess H, di Mola FF, Tang WH, Kubulus D, Brigstock D, Zimmermann A, Buchler MW. Connective tissue growth factor gene expression alters tumor progression in esophageal cancer. World J Surg. 2002;26:420–7. [PubMed]
  • Kruys V, Marinx O, Shaw G, Deschamps J, Huez G. Translational blockade imposed by cytokine-derived UA-rich sequences. Science. 1989;245:852–5. [PubMed]
  • Kruys V, Wathelet M, Poupart P, Contreras R, Fiers W, Content J, Huez G. The 3′ untranslated region of the human interferon-beta mRNA has an inhibitory effect on translation. Proc Natl Acad Sci U S A. 1987;84:6030–4. [PubMed]
  • Kubo M, Kikuchi K, Nashiro K, Kakinuma T, Hayashi N, Nanko H, Tamaki K. Expression of fibrogenic cytokines in desmoplastic malignant melanoma. Br J Dermatol. 1998;139:192–7. [PubMed]
  • Lewis T, Gueydan C, Huez G, Toulme JJ, Kruys V. Mapping of a minimal AU-rich sequence required for lipopolysaccharide-induced binding of a 55-kDa protein on tumor necrosis factor-alpha mRNA. J Biol Chem. 1998;273:13781–6. [PubMed]
  • Lymn JS, Patel MK, Clunn GF, Rao SJ, Gallagher KL, Hughes AD. Thrombospondin-1 differentially induces chemotaxis and DNA synthesis of human venous smooth muscle cells at the receptor-binding level. J Cell Sci. 2002;115:4353–60. [PubMed]
  • Malim MH, Hauber J, Le SY, Maizel JV, Cullen BR. The HIV-1 rev trans-activator acts through a structured target sequence to activate nuclear export of unspliced viral mRNA. Nature. 1989;338:254–7. [PubMed]
  • Mann SS, Hammarback JA. Molecular characterization of light chain 3. A microtubule binding subunit of MAP1A and MAP1B. J Biol Chem. 1994;269:11492–7. [PubMed]
  • Mason CA, Bigras JL, O’Blenes SB, Zhou B, McIntyre B, Nakamura N, Kaneda Y, Rabinovitch M. Gene transfer in utero biologically engineers a patent ductus arteriosus in lambs by arresting fibronectin-dependent neointimal formation. Nat Med. 1999a;5:176–82. [PubMed]
  • Mason CA, Chang P, Fallery C, Rabinovitch M. Nitric oxide mediates LC-3-dependent regulation of fibronectin in ductus arteriosus intimal cushion formation. Faseb J. 1999b;13:1423–34. [PubMed]
  • Moritani NH, Kubota S, Nishida T, Kawaki H, Kondo S, Sugahara T, Takigawa M. Suppressive effect of overexpressed connective tissue growth factor on tumor cell growth in a human oral squamous cell carcinoma-derived cell line. Cancer Lett. 2003;192:205–14. [PubMed]
  • O’Blenes CA, Kinnear C, Rabinovitch M. Tumor necrosis factor-alpha induces fibronectin synthesis in coronary artery smooth muscle cells by a nitric oxide-dependent posttranscriptional mechanism. Circ Res. 2001;89:26–32. [PubMed]
  • Pan LH, Beppu T, Kurose A, Yamauchi K, Sugawara A, Suzuki M, Ogawa A, Sawai T. Neoplastic cells and proliferating endothelial cells express connective tissue growth factor (CTGF) in glioblastoma. Neurol Res. 2002;24:677–83. [PubMed]
  • Perou CM, Sorlie T, Eisen MB, van de Rijn M, Jeffrey SS, Rees CA, Pollack JR, Ross DT, Johnsen H, Akslen LA, et al. Molecular portraits of human breast tumours. Nature. 2000;406:747–52. [PubMed]
  • Planque N, Perbal B. A structural approach to the role of CCN (CYR61/CTGF/NOV) proteins in tumourigenesis. Cancer Cell Int. 2003;3:15. [PMC free article] [PubMed]
  • Salomon RN, Hughes CC, Schoen FJ, Payne DD, Pober JS, Libby P. Human coronary transplantation-associated arteriosclerosis. Evidence for a chronic immune reaction to activated graft endothelial cells. Am J Pathol. 1991;138:791–8. [PubMed]
  • Seidenbecher CI, Landwehr M, Smalla KH, Kreutz M, Dieterich DC, Zuschratter W, Reissner C, Hammarback JA, Bockers TM, Gundelfinger ED, et al. Caldendrin but not calmodulin binds to light chain 3 of MAP1A/B: an association with the microtubule cytoskeleton highlighting exclusive binding partners for neuronal Ca(2+)-sensor proteins. J Mol Biol. 2004;336:957–70. [PubMed]
  • Shakunaga T, Ozaki T, Ohara N, Asaumi K, Doi T, Nishida K, Kawai A, Nakanishi T, Takigawa M, Inoue H. Expression of connective tissue growth factor in cartilaginous tumors. Cancer. 2000;89:1466–73. [PubMed]
  • Shaw G, Kamen R. A conserved AU sequence from the 3′ untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell. 1986;46:659–67. [PubMed]
  • Shimo T, Kubota S, Kondo S, Nakanishi T, Sasaki A, Mese H, Matsumura T, Takigawa M. Connective tissue growth factor as a major angiogenic agent that is induced by hypoxia in a human breast cancer cell line. Cancer Lett. 2001;174:57–64. [PubMed]
  • Takigawa M, Nakanishi T, Kubota S, Nishida T. Role of CTGF/HCS24/ecogenin in skeletal growth control. J Cell Physiol. 2003;194:256–66. [PubMed]
  • Treisman R. Transient accumulation of c-fos RNA following serum stimulation requires a conserved 5′ element and c-fos 3′ sequences. Cell. 1985;42:889–902. [PubMed]
  • Troussard AA, Costello P, Yoganathan TN, Kumagai S, Roskelley CD, Dedhar S. The integrin linked kinase (ILK) induces an invasive phenotype via AP-1 transcription factor-dependent upregulation of matrix metalloproteinase 9 (MMP-9) Oncogene. 2000;19:5444–52. [PubMed]
  • Troussard AA, Tan C, Yoganathan TN, Dedhar S. Cell-extracellular matrix interactions stimulate the AP-1 transcription factor in an integrin-linked kinase- and glycogen synthase kinase 3-dependent manner. Mol Cell Biol. 1999;19:7420–7. [PMC free article] [PubMed]
  • Tusher VG, Tibshirani R, Chu G. Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci U S A. 2001;98:5116–21. [PubMed]
  • Vorwerk P, Wex H, Hohmann B, Mohnike K, Schmidt U, Mittler U. Expression of components of the IGF signalling system in childhood acute lymphoblastic leukaemia. Mol Pathol. 2002;55:40–5. [PMC free article] [PubMed]
  • Wei Y, Tang CH, Kim Y, Robillard L, Zhang F, Kugler MC, Chapman HA. Urokinase receptors are required for alpha 5 beta 1 integrin-mediated signaling in tumor cells. J Biol Chem. 2007;282:3929–39. [PubMed]
  • Weiss MA, Narayana N. RNA recognition by arginine-rich peptide motifs. Biopolymers. 1998;48:167–80. [PubMed]
  • Wenger C, Ellenrieder V, Alber B, Lacher U, Menke A, Hameister H, Wilda M, Iwamura T, Beger HG, Adler G, et al. Expression and differential regulation of connective tissue growth factor in pancreatic cancer cells. Oncogene. 1999;18:1073–80. [PubMed]
  • West RB, van de Rijn M. The role of microarray technologies in the study of soft tissue tumours. Histopathology. 2006;48:22–31. [PubMed]
  • Weston BS, Wahab NA, Mason RM. CTGF mediates TGF-beta-induced fibronectin matrix deposition by upregulating active alpha5beta1 integrin in human mesangial cells. J Am Soc Nephrol. 2003;14:601–10. [PubMed]
  • Xie D, Nakachi K, Wang H, Elashoff R, Koeffler HP. Elevated levels of connective tissue growth factor, WISP-1, and CYR61 in primary breast cancers associated with more advanced features. Cancer Res. 2001;61:8917–23. [PubMed]
  • Xie D, Yin D, Wang HJ, Liu GT, Elashoff R, Black K, Koeffler HP. Levels of expression of CYR61 and CTGF are prognostic for tumor progression and survival of individuals with gliomas. Clin Cancer Res. 2004;10:2072–81. [PubMed]
  • Zaman MH, Trapani LM, Sieminski AL, Mackellar D, Gong H, Kamm RD, Wells A, Lauffenburger DA, Matsudaira P. Migration of tumor cells in 3D matrices is governed by matrix stiffness along with cell-matrix adhesion and proteolysis. Proc Natl Acad Sci U S A. 2006;103:10889–94. [PubMed]
  • Zeng ZJ, Yang LY, Ding X, Wang W. Expressions of cysteine-rich61, connective tissue growth factor and Nov genes in hepatocellular carcinoma and their clinical significance. World J Gastroenterol. 2004;10:3414–8. [PubMed]
  • Zhou B, Boudreau N, Coulber C, Hammarback J, Rabinovitch M. Microtubule-associated protein 1 light chain 3 is a fibronectin mRNA-binding protein linked to mRNA translation in lamb vascular smooth muscle cells. J Clin Invest. 1997;100:3070–82. [PMC free article] [PubMed]
  • Zhou B, Rabinovitch M. Microtubule involvement in translational regulation of fibronectin expression by light chain 3 of microtubule-associated protein 1 in vascular smooth muscle cells. Circ Res. 1998;83:481–9. [PubMed]